Virus-like nanoparticle nucleic acid drug delivery system, preparation method and application

By using a virus-like nanoparticle nucleic acid delivery system, capsid protein-mimicking peptides are used to replace ionizable lipids in LNPs, solving the problems of toxic side effects and low delivery efficiency of LNPs, achieving more efficient and stable nucleic acid delivery, and making it suitable for applications of a variety of nucleic acid products.

CN116712406BActive Publication Date: 2026-03-31SHENZHEN FU LIFE BIOMEDICINE CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202310442009.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-04-23
Publication Date
2026-03-31
Estimated Expiration
2043-04-23

AI Technical Summary

Technical Problem

Existing nucleic acid drug delivery systems, such as LNP, suffer from toxic side effects, low delivery efficiency, poor stability, and limited targeting. Furthermore, viral vectors present immunogenicity and high cost issues in large-scale applications.

Method used

A virus-like nanoparticle nucleic acid delivery system is employed, utilizing capsid protein mimic peptides to replace ionizable lipids. These peptides combine with neutral or anionic lipids to form a stable envelope-like virus structure, achieving efficient lysosomal escape and targeted delivery through the multifunctionality of the capsid protein mimic peptides.

Benefits of technology

It reduces toxic side effects on the human body, improves delivery efficiency and stability, provides higher nucleic acid protection, has broader targeting and better structural stability, and is suitable for the delivery of a variety of nucleic acid products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116712406B_ABST
    Figure CN116712406B_ABST
Patent Text Reader

Abstract

The application discloses a preparation method and application of a virus-like nanoparticle nucleic acid delivery system, simulates structural characteristics of an enveloped virus, overcomes limitations of a lipid nanoparticle nucleic acid delivery system, replaces ionizable lipids in the LNP with a capsid protein simulation peptide, reduces toxic side effects on the human body, has higher delivery efficiency than the LNP, and the virus-like nanoparticle structure can provide higher protection effect and more stable structure for the delivered nucleic acid. The technical scheme recorded in the application can be used for delivery of mRNA, DNA, siRNA, gene editing and other nucleic acid products, and finally applied to vaccine production and preparation of targeted drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of nucleic acid drugs, specifically relating to a nucleic acid drug delivery system, preparation method and application. Background Technology

[0002] The primary function of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) is to carry and transmit genetic information. Nucleic acid drugs, based on DNA and RNA molecules, are used for the prevention, diagnosis, and treatment of diseases. Nucleic acid drugs include antisense nucleic acids (ASO), small interfering RNA (siRNA), microRNA (miRNA), small activating RNA (saRNA), messenger RNA (mRNA), aptamers, ribozymes, and antibody-nucleic acid conjugates (ARC), among others.

[0003] Traditional small molecule drugs and antibody drugs mostly work by binding to target proteins. Antibody drugs can only work on cell membrane and extracellular proteins, while nucleic acid drugs regulate protein expression through genes related to protein expression, thus regulating both intracellular and extracellular proteins as well as cell membrane proteins.

[0004] Most nucleic acid drugs operate on the principle of complementary base pairing. Knowing only the base sequence of the target gene makes nucleic acid drug design relatively easy; new drugs can be created simply by rearranging the A, G, C, T (U) sequences. Nucleic acid drugs are expected to become the third major type of drug after small molecule chemical drugs and antibody drugs. They can target molecules that chemical or antibody drugs cannot target (such as mRNA and miRNA), potentially leading to breakthroughs in diseases where traditional drugs are ineffective, such as difficult-to-treat genetic diseases, cancer, and certain viral infections.

[0005] The key factor in the successful development of nucleic acid drugs is the delivery system. Nucleic acids are anionic macromolecules that cannot penetrate cell membranes to enter cells. Therefore, it is essential to develop efficient and safe drug delivery systems to address challenges related to nucleic acid drug delivery, stability, and off-target effects. Nucleic acid delivery systems can be categorized into viral vectors and non-viral vectors. Viral vectors are widely used in gene therapy, but their immunogenicity, tumorigenicity, and limited capacity limit their application in nucleic acid drug development. Non-viral vectors, such as synthetic polymers, lipid particles (liposomes or LNPs), or those that bind nucleic acid drugs to specific ligands to target specific cells, such as GalNAc, peptides, and antibodies, are used more extensively.

[0006] Lipid nanoparticles (LNPs) are one of the most widely used non-viral delivery systems in nucleic acid drug research, capable of safely and effectively delivering nucleic acids. LNPs are a relatively mature technology platform used to deliver RNA drugs, vaccines, or gene-editing tools. Nucleic acid drugs using LNPs have already been approved, such as Alnylam's approved siRNA drug Onpattro. In late 2020, BioNTech and Moderna's COVID-19 mRNA vaccine also used LNPs to deliver the SARS-CoV-2 antigen mRNA, achieving an efficacy rate exceeding 90% and playing a crucial role in pandemic control. Compared to other types of nucleic acid drug delivery systems, LNPs offer many advantages, such as high nucleic acid encapsulation efficiency, effective cell transfection, strong tissue penetration, low cytotoxicity and immunogenicity, and greater suitability for drug delivery. These advantages make LNPs the most successful nucleic acid delivery system currently available. LNPs are stable nanoparticles composed of four lipids: ionizable lipids, saturated phospholipids, cholesterol, and polyethylene glycol (PEG). Ionizable lipids promote the autonomous aggregation of mRNA into virus-sized particles and the release of mRNA into the cytoplasm; PEG prolongs the half-life of the complex; cholesterol, as a stabilizer, enhances the stability of the complex; and phospholipids support the formation of a lipid bilayer structure. The size of LNPs can be regulated by adjusting the ratio among these four components.

[0007] Despite the success of LNP delivery systems, significant limitations remain. First, the amino head of the cationic lipids in LNPs has toxic effects on human cells, and these toxicities are also related to the PEG lipids. Second, the escape rate of mRNA inclusion bodies delivered by LNPs is low. Third, nucleic acids delivered by LNPs are generally passively targeted to the liver, greatly limiting the applicability of nucleic acid drugs. Furthermore, due to their structure, LNPs have poor stability and typically require ultra-low temperatures for transport and storage. Finally, the core barrier to LNP delivery systems is patent protection. Arbutus's patents US8058069 (2009) and CN1021192178 (2015) in China provide comprehensive protection for mixtures of nucleic acids and cationic lipids, and are expected to expire in 2029. The core patent content includes novel stable lipid particles containing one or more active agents or therapeutic agents, methods for preparing lipid particles, and methods for delivering or applying lipid particles. The nucleic acid-lipid particles comprise 50-65% cationic lipids; non-cationic lipids comprising phospholipids and cholesterol or their derivatives, with phospholipids comprising 4-10% and cholesterol or its derivatives comprising 30-40% of the total lipids. Conjugated lipids that inhibit particle aggregation, comprising 0.5% to 2% of the total lipids. The patent issues surrounding LNP may pose a serious future risk.

[0008] After millions of years of evolution, viruses have become perfect nucleic acid (DNA and RNA) delivery systems, capable of accurately delivering the viral genome into the cytoplasm and nucleus. There are two types of viruses: enveloped viruses and non-enveloped viruses. Non-enveloped viruses consist only of nucleic acid and a protein capsid, while enveloped viruses are encased in a lipid bilayer derived from the host cell. Viruses infect cells by binding to cell receptors through surface membrane proteins. Virus-based nucleic acid delivery systems are widely used in gene therapy, but they have several limitations for large-scale applications. Viral vectors have very strong immunogenicity; repeated use leads to antibody and T-cell immunity, causing a decrease in delivery efficiency. Furthermore, the human body possesses immune memory for certain viral vectors, resulting in reduced efficiency upon initial use. Viral vectors are typically packaged intracellularly, leading to high production costs and making them unsuitable for large-scale preventative vaccines. Summary of the Invention

[0009] To address the technical deficiencies in the background art, this invention proposes a nucleic acid drug delivery system, preparation method, and application, solving the aforementioned technical problems and meeting practical needs. The specific technical solution is as follows:

[0010] A virus-like nanoparticle nucleic acid delivery system has the structural features of an enveloped virus, including an internally delivered nucleic acid molecule, a capsid protein mimicking peptide that encapsulates the nucleic acid and mimics the function of viral capsid proteins, and an outermost lipid bilayer molecule.

[0011] As a further technical solution of the present invention, the capsid protein mimic peptide is composed of three parts, including myristic acid at the N-terminus, a membrane fusion peptide derived from the virus in the middle, and a histidine-lysine enriched region at the C-terminus.

[0012] As a further technical solution of the present invention, the C-terminus of the capsid protein mimic peptide is a repeating sequence containing histidine-lysine, which is used to bind with nucleic acids to form a complex. After activation in an acidic environment with lysosomes, it destroys the lysosomal membrane and releases nucleic acids into the cytoplasm.

[0013] As a further technical solution of the present invention, the virus-like nanoparticle nucleic acid delivery system can bind to the outermost lipid bilayer after delivering nucleic acid to form a complex, and together form stable virus-like nanoparticles similar to enveloped viruses. The lipid bilayer is composed of neutral lipids or anionic lipids that have membrane fusion function and are similar to the outer membrane of a virus.

[0014] As a further technical solution of the present invention, the capsid protein mimic peptide is any one of the following sequences:

[0015] Pep1: Myristoyl-AVGIGAVFLGFLGAAGKHKHKHKHKHKHC;

[0016] Pep2: Myristoyl-GLFGAIAGFIENGWEGMIDGKHKHKHKHKHKHC.

[0017] As a further technical solution of the present invention, the outermost lipid bilayer of the virus-like nanoparticle nucleic acid delivery system is used to load antibodies, proteins and peptide-guided molecules, thereby completing the targeted cell delivery of nucleic acids.

[0018] A method for preparing a virus-like nanoparticle nucleic acid delivery system includes the following steps:

[0019] 1) Prepare the nucleic acid, capsid protein mimic peptide, and lipid mixture in sequence;

[0020] 2) Incubate nucleic acids with capsid protein mimic peptides to allow the capsid protein mimic peptides to encapsulate the nucleic acids, forming a nucleic acid-CMP peptide complex;

[0021] 3) A virus-like nanoparticle nucleic acid delivery system, namely VLNP, was prepared by mixing a lipid mixture with a nucleic acid-CMP peptide complex using microfluidics.

[0022] The cell membrane fusion region of the capsid protein mimic peptide is formed by linking the fusion peptide of HIV-1 gp41 or the fusion peptide of influenza virus HA2 protein to the histidine-lysine repeat sequence KHKHKHKHKHKHC, and myristic acid is linked to the N-terminus of each peptide, thus forming two viral capsid protein mimic peptides respectively.

[0023] As a further technical solution of the present invention, the types of nucleic acids include mRNA, DNA and siRNA.

[0024] A method for using a virus-like nanoparticle nucleic acid delivery system, wherein the virus-like nanoparticle nucleic acid delivery system is used in the preparation of a herpes zoster nucleic acid vaccine for delivering VZV circular RNA.

[0025] A method for applying a virus-like nanoparticle nucleic acid delivery system, wherein the virus-like nanoparticle nucleic acid delivery system is used in the preparation of nucleic acid preparations for delivering mRNA, DNA, and siRNA.

[0026] The beneficial effects of this invention are as follows: the overall use of capsid protein mimic peptides to replace the ionizable lipids in existing LNPs reduces the toxic side effects on the human body and has a higher delivery efficiency than LNPs. Furthermore, the virus-like nanoparticle structure can provide higher protection and a more stable structure for the delivery of nucleic acids.

[0027] In summary, this invention can be used for the delivery of nucleic acid products such as mRNA, DNA, siRNA, and gene editing, and can be applied in vaccine production and the preparation of targeted drugs. The virus-like nanoparticle nucleic acid delivery system based on capsid protein mimic peptides can serve as a highly efficient and accurate alternative delivery carrier for nucleic acid products, and has broad application prospects in preventive vaccines, therapeutic vaccines, gene therapy, tumor treatment, and the treatment of chronic diseases. Attached Figure Description

[0028] Figure 1 This is a schematic diagram illustrating the structural features of a simulated enveloped virus in the virus-like nanoparticle nucleic acid delivery system described in this invention.

[0029] Figure 2 This is a schematic diagram of the VZV glycoprotein E circular RNA delivered by the virus-like nanoparticle nucleic acid delivery system described in this invention.

[0030] Figure 3 This is a comparison chart showing the performance of the virus-like nanoparticle nucleic acid delivery system described in this invention compared to existing nucleic acid delivery systems. Detailed Implementation

[0031] The embodiments of the present invention will be described below with reference to the accompanying drawings and related examples. The embodiments of the present invention are not limited to the following examples, and the present invention relates to the relevant necessary components in this technical field, which should be regarded as well-known technology in this technical field and can be known and mastered by those skilled in this technical field.

[0032] A virus-like nanoparticle nucleic acid delivery system, namely VLNP, has the structural features of an enveloped virus, including an internally delivered nucleic acid molecule, a capsid protein mimicking peptide that encapsulates the nucleic acid and mimics the function of viral capsid proteins, and an outermost lipid bilayer molecule.

[0033] Furthermore, the capsid protein mimic peptide consists of three parts, including myristic acid at the N-terminus, a membrane fusion peptide derived from the virus in the middle, and a histidine-lysine enriched region at the C-terminus.

[0034] Furthermore, the C-terminus of the capsid protein mimic peptide is a repeating sequence containing histidine-lysine, which is used to bind to nucleic acids to form a complex. After activation in an acidic environment with lysosomes, it disrupts the lysosomal membrane and releases nucleic acids into the cytoplasm.

[0035] Furthermore, after delivering nucleic acid to form a complex, the capsid protein mimic peptide can bind to the outermost lipid bilayer to form stable enveloped virus-like nanoparticles. The lipid bilayer is composed of neutral or anionic lipids with membrane fusion function that are similar to the viral outer membrane.

[0036] Furthermore, the capsid protein mimic peptide is any of the following sequences:

[0037] Pep1: Myristoyl-AVGIGAVFLGFLGAAGKHKHKHKHKHKHC;

[0038] Pep2: Myristoyl-GLFGAIAGFIENGWEGMIDGKHKHKHKHKHKHC.

[0039] Furthermore, the outermost lipid bilayer of the virus-like nanoparticle nucleic acid delivery system is used to load antibodies, proteins, and peptide-directing molecules, thereby completing the targeted cell delivery of nucleic acids.

[0040] Reference Figure 1 As shown, this invention discloses a virus-like nanoparticle nucleic acid delivery system that mimics the structural features of enveloped viruses, aiming to overcome the limitations of lipid nanoparticle (LNP) nucleic acid delivery systems. The core feature of this invention is the use of multifunctional synthetic peptides to mimic the function of viral nucleocapsid proteins. The fusion peptide derived from the virus can fuse with the lysosomal membrane, promoting escape from the lysosome; the histidine-lysine region can bind to encapsulated nucleic acid molecules to provide protection and exhibits pH responsiveness; in the acidic environment of the lysosome, protonation alters the structure, further enhancing the lysosomal escape ability; myristic acid can bind to the outer lipid layer, stabilizing the structural stability of the VLNP. This synthetic peptide, which highly mimics viral capsid proteins, endows VLNPs with unique advantages in nucleic acid delivery.

[0041] Based on the above-mentioned virus-like nanoparticle nucleic acid delivery system, the present invention also proposes a preparation method thereof, comprising the following steps:

[0042] 1) Prepare the nucleic acid, capsid protein mimic peptide, and lipid mixture in sequence;

[0043] 2) Incubate nucleic acids with capsid protein mimic peptides to allow the capsid protein mimic peptides to encapsulate the nucleic acids, forming a nucleic acid-CMP peptide complex;

[0044] 3) A virus-like nanoparticle nucleic acid delivery system, namely VLNP, was prepared by mixing a lipid mixture with a nucleic acid-CMP peptide complex using microfluidics.

[0045] The cell membrane fusion region of the capsid protein mimic peptide is formed by linking the fusion peptide of HIV-1 gp41 or the fusion peptide of influenza virus HA2 protein to the histidine-lysine repeat sequence KHKHKHKHKHKHC, and myristic acid is linked to the N-terminus of each peptide, thus forming two viral capsid protein mimic peptides: Pep1: Myristoyl-AVGIGAVFLGFLGAAGKHKHKHKHKHC and Pep2: Myristoyl-GLFGAIAGFIENGWEGMIDGKHKHKHKHKHC.

[0046] Compared to existing LNP delivery systems, the VLNP delivery system obtained by the above preparation method uses natural synthetic peptides instead of cationic lipids, avoiding the toxic side effects of the latter in LNPs. Among them, the multifunctional synthetic peptides that highly mimic viral capsid proteins have higher lysosomal escape efficiency and delivery efficiency than ionizable lipids, and can deliver nucleic acids to different sites in the cell as needed, such as the cytoplasm or the nucleus, achieving a shorter effective time. Its virus-like nanoparticle structure can provide a higher protection effect for the delivered nucleic acid, avoiding the problem of premature failure of the delivered nucleic acid. Therefore, the delivery system can ultimately have a more stable structure than LNP. Compared with the limitations of LNP-delivered nucleic acids, which are generally passively targeted to the liver, the above two virus-mimicking peptides have more targeting options and better overall stability, and can still maintain activity in a lower temperature environment.

[0047] Furthermore, the types of nucleic acids include mRNA, DNA, and siRNA. These nucleic acid types cover most of the target nucleic acid fragment types involved in preventive vaccines, therapeutic vaccines, gene therapy, tumor treatment, and chronic disease treatment, thus having a very wide range of applications.

[0048] The present invention also proposes an application method for a virus-like nanoparticle nucleic acid delivery system, which is used for the delivery of VZV circular RNA and thereby for the preparation of a herpes zoster nucleic acid vaccine.

[0049] Furthermore, the virus-like nanoparticle nucleic acid delivery system is used for the delivery of mRNA, DNA, siRNA, and gene-edited nucleic acid products.

[0050] The application of a virus-like nanoparticle nucleic acid delivery system disclosed in this invention is based on the core feature of the invention, which uses a multifunctional synthetic peptide to mimic the function of viral nucleocapsid proteins. The fusion peptide derived from the virus can fuse with the lysosomal membrane to promote escape from the lysosome; the histidine-lysine region can bind to encapsulate nucleic acid molecules to provide protection and has pH responsiveness. In the acidic environment of the lysosome, the structure changes after protonation, further enhancing the escape ability of the lysosome; myristic acid can bind to the outer lipid layer to stabilize the structural stability of the VLNP. This synthetic peptide, which highly mimics the viral capsid protein, gives the VLNP a unique advantage in nucleic acid delivery.

[0051] This invention utilizes capsid protein-mimicking peptides to replace the ionizable lipids in LNPs, reducing toxicity to the human body and achieving higher delivery efficiency than LNPs. The virus-like nanoparticle structure also provides enhanced protection and a more stable structure for delivered nucleic acids. This invention can be used for the delivery of nucleic acid products such as mRNA, DNA, siRNA, and gene editing, and has applications in preventative vaccines, therapeutic vaccines, gene therapy, cancer treatment, and the treatment of chronic diseases.

[0052] The following examples illustrate the specific working mechanism and related implementation effects of the virus-like nanoparticle nucleic acid delivery system described in this invention:

[0053]

Example 1

[0054] This embodiment focuses on the selection of the structural composition of the capsid protein mimic peptide used in the virus-like nanoparticle nucleic acid delivery system of the present invention. After screening and experimentation, two virus-derived fusion peptide sequences were ultimately selected as the cell membrane fusion region of the capsid protein mimic peptide:

[0055] The two membrane fusion peptides were derived from two sources: AVGIGAVFLGFLGAAG and GLFGAIAGFIENGWEGMIDG. The first was a fusion peptide derived from HIV-1 gp41, and the second was a fusion peptide derived from the HA2 protein of influenza virus, GLFGAIAGFIENGWEGMIDG. These two peptides were linked to a histidine-lysine repeat sequence KHKHKHKHKHKHC, and myristic acid was attached to the N-terminus. This yielded two functional mimic peptides of viral capsid proteins: Pep1: Myristoyl-AVGIGAVFLGFLGAAGKHKHKHKHKHC, and Pep2: Myristoyl-GLFGAIAGFIENGWEGMIDGKHKHKHKHKHC.

[0056] Pep1 and Pep2 can rapidly encapsulate and compress nucleic acids to form stable nanoparticles, exhibiting pH responsiveness. Their structure changes in acidic environments, disrupting the lysosomal membrane and promoting the escape efficiency of nucleic acid lysosomes. Myristic acid can bind to the outer lipid layer, stabilizing the structural stability of VLNPs. Furthermore, myristication is a major mechanism for viral lysosomal escape, further promoting the escape of delivered nucleic acids from lysosomes. The capsid protein mimic peptides Pep1 and Pep2 were synthesized using a solid-phase synthesis method and purified for use in VLNP preparation. Based on their structural characteristics, the final VLNPs can be applied in vaccine production and targeted drug development.

[0057]

Example 2

[0058] In this embodiment, the virus-like nanoparticle nucleic acid delivery system (VLNP) of the present invention is used in the preparation of shingles vaccine, specifically for the delivery of shingles glycoprotein E circular RNA and the detection of its representation. In specific applications, refer to... Figure 2 As shown, the VZV glycoprotein E gene was delivered using VLNP to develop a shingles vaccine. The aim was to optimize the VZV glycoprotein E gene. Specific sequence optimization included: increasing the GC content of the mRNA sequence, using codons preferred when expressing the gene in humans, eliminating certain restriction endonuclease recognition sites that conflict with cloning, and obtaining a transcriptionally optimized mRNA sequence.

[0059] The optimized mRNA structure is more stable, resulting in higher protein translation efficiency and more persistent expression in mammals and humans. The optimized VZV glycoprotein E RNA coding sequence is shown in SEQ ID 1. Specifically, the coding sequence is as follows: an optimized VZV glycoprotein E sequence:

[0060]

[0061] *

[0062] To address the problems of low antigen expression levels and insufficient expression persistence in nucleic acid vaccines, leading to poor immunogenicity, this invention further employs an optimized capless circular RNA sequence of VZV glycoprotein E. Translation of the antigen is initiated by EMCV virus IRES. RNA circularization is performed using a permuted intron exon (PIE) method based on the Anabaena pre-tRNA sequence. To improve the circularization effect of the PIE method, preferred homologous arm sequences are selected. The optimized full-length capless circular RNA sequence of VZV glycoprotein E is shown in SEQ ID 2. Specifically, the coding sequence is as follows: an optimized full-length circular RNA sequence of VZV glycoprotein E:

[0063] CGCTGTCGGATAATGTGGGCAACAATAGATGACTTACAACTAATCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAAGCTGCAAGAGAATG AAAATCCGT TGACCTTAAA CGGTCGTTGTGGGTTCAAGTC;

[0064]

[0065] Circular RNA is more stable than linear mRNA, and its beneficial effects include high and sustained expression levels in vivo, induction of strong immune responses, and more efficient expression.

[0066]

Example 3

[0067] The preparation method of the virus-like nanoparticle nucleic acid delivery system of the present invention, specifically, involves the following steps: In step 2, the prepared materials are used to dilute circular RNA in RNase-free water and incubate it with a capsid protein mimic peptide at room temperature (RT) at 200 rpm for 1 hour. Then, the lipid dioleoylphosphatidylethanolamine (DOPE) and cholesterol are dissolved in ethanol at a weight ratio of 60:40. In step 3, the lipid mixture is combined with the ccRNA-capsid protein mimic peptide complex at a 2:1 ratio (water:ethanol) using a microfluidic mixer. After dialysis, the mixture is sterilely filtered and stored at 4°C. This storage temperature is easy to maintain and has low requirements for storage containers, thus reducing the difficulty of transportation and preservation, and exhibiting excellent flowability.

[0068] As a control, the lipid nanoparticles used were methyl 4-(N,N-dimethylamino)butyrate (dilinyl)methyl ester (Dlin-MC3-DMA), distearate phosphatidylcholine (DSPC), cholesterol, and dimyristoylglycerol-polyethylene glycol 2000 (DMG-PEG2000) in a molar ratio of 50:10:38:2. These four components were mixed to form the lipid phase. ccRNA was dissolved in 0.05M citric acid (pH 5.0) to form the aqueous phase. The lipid phase to aqueous phase volume ratio was 1:3. Cationic nanoparticles were prepared using NanoAssemblr Ignite. The size and zeta of the nanoparticles were measured using a Malvern zetasizer nanoZS nanoparticle size analyzer to ensure a particle size of approximately 100 nm and a positive potential.

[0069]

Example 4

[0070] The specific application of the virus-like nanoparticle nucleic acid delivery system described in this invention is to deliver varicella-zoster virus glycoprotein E circular RNA in the human body. Combined with the protein gene described in Example 2, the prepared VZV virus glycoprotein E circular RNA / VLNP was used to immunize mice for an immunization experiment, and the vaccine-induced humoral immune response was measured. The dosage was 1 μg / mouse. An equal volume of physiological saline injection was used as a negative control.

[0071] Ultimately, the results of cellular immunity in animals after vaccine immunization were as follows: Figure 3As shown, the in vivo delivery of VLNP has a significantly better immune effect than LNP. In addition, the local reaction of the VLNP group after immunization is significantly weaker than that of the LNP delivery group, which proves that VLNP has fewer toxic side effects.

[0072] The capsid protein mimic peptide used in this invention can be used to replace ionizable lipids in existing LNP applications, reducing toxic side effects on the human body; combined with Figure 3 As shown, it has a higher delivery efficiency than LNP; the virus-like nanoparticle structure also provides higher protection and a more stable structure for delivered nucleic acids. This invention can be used for the delivery of nucleic acid products such as mRNA, DNA, siRNA, and gene editing, and can be applied to preventive vaccines, therapeutic vaccines, gene therapy, tumor treatment, and the treatment of chronic diseases.

[0073] In this invention, the core of the virus-like nanoparticle nucleic acid delivery system (VLNP) is an optimized capsid-mimetic peptide (CMP) designed to mimic the function of the capsid proteins of enveloped viruses. Besides encapsulating and protecting the viral genome, one of the main functions of viral capsid proteins is to facilitate lysosomal escape, preventing the viral genome from being degraded within the lysosome.

[0074] Among these, the viral capsid proteins have evolved multiple mechanisms to achieve efficient lysosomal escape, the reason for which is as follows:

[0075] 1) Viral capsid proteins have amphiphilic α-helical structures with membrane fusion function, such as the VI protein of adenovirus and the gp41 protein of HIV.

[0076] 2) Viral capsid proteins have N-terminal myristoylation, such as rhinovirus VP4 protein and HIV gp41 protein.

[0077] 3) Viral capsid proteins can directly act on the enzyme-active domains of the lysosomal membrane, such as the type 2 phospholipase activity of the parvovirus VP1 protein.

[0078] In addition, histidine pH responsiveness is required, which is activated only in the acidic environment of lysosomes, enabling the virus to escape efficiently through various mechanisms such as membrane perforation, membrane disruption, degradation, and fusion.

[0079] In this invention, the designed capsid protein mimic peptide has multiple functional regions, which respectively mimic the different lysosomal escape functions of the capsid protein mentioned above:

[0080] 1) Viral fusion peptides can fuse with lysosomal membranes, facilitating escape from lysosomes;

[0081] 2) The histidine-lysine region can bind to and encapsulate nucleic acid molecules to provide protection. It is pH responsive. In the acidic environment of lysosomes, the structure changes after protonation, which further enhances the escape ability of lysosomes.

[0082] 3) Myristic acid can bind to the lipid bilayer of the outer layer of VLNP, stabilizing the structural stability of VLNP.

[0083] In addition, myristylation of viral proteins is also a major mechanism for viral lysosomal escape. This synthetic peptide, which highly mimics viral capsid proteins, gives VLNP a unique advantage in nucleic acid delivery.

[0084] The above description is only a preferred embodiment of the present invention. It should be noted that those skilled in the art can make several improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A virus-like nanoparticle nucleic acid delivery system, characterized in that, The virus-like nanoparticle nucleic acid delivery system has the structural characteristics of enveloped viruses, including internal delivery of nucleic acid molecules, capsid protein mimetic peptides that encapsulate nucleic acids and mimic the functions of viral capsid proteins, and outermost lipid bilayer molecules; The capsid protein mimetic peptide consists of three parts, including a myristic acid at the N-terminus, a membrane fusion peptide derived from a virus in the middle, and a histidine-lysine-rich region at the C-terminus; The C-terminus of the capsid protein mimetic peptide is a repeat sequence containing histidine-lysine, which is used to bind to nucleic acids to form a complex, activate after being in an acidic environment with lysosomes, break the lysosome membrane, and release nucleic acids into the cytoplasm; The capsid protein mimetic peptide can bind to the lipid bilayer after delivering nucleic acids to form a complex, together forming a stable virus-like nanoparticle similar to enveloped viruses, wherein the lipid bilayer uses neutral lipids or anionic lipids with membrane fusion functions similar to the outer membrane of viruses; The capsid protein mimetic peptide has any of the following sequences: Pep1: Myristoyl-AVGIGAVFLGFLGAAGKHKHKHKHKHKHC; Pep2: Myristoyl-GLFGAIAGFIENGWEGMIDGKHKHKHKHKHKHC; The types of nucleic acids include mRNA, DNA, and siRNA.

2. The virus-like nanoparticle delivery system of claim 1, wherein, The outermost lipid bilayer of the virus-like nanoparticle nucleic acid delivery system is used to load antibodies, proteins, and polypeptide targeting molecules, thereby completing the targeted cell delivery of nucleic acids.

3. A method of preparing the virus-like nanoparticle nucleic acid delivery system of claim 1 or 2, wherein, The method comprises the following steps: 1) Prepare nucleic acids, capsid protein mimetic peptides, and lipid mixtures in sequence; 2) Incubate the nucleic acids with the capsid protein mimetic peptides to form nucleic acid-CMP peptide complexes with the capsid protein mimetic peptides encapsulating the nucleic acids; 3) Mix the lipid mixture with the nucleic acid-CMP peptide complex using microfluidics to prepare the virus-like nanoparticle nucleic acid delivery system, i.e., VLNP.

4. Use of the virus-like nanoparticle nucleic acid delivery system of claim 1 or 2 in the preparation of a varicella zoster virus nucleic acid vaccine for delivering VZV circular RNA.

5. Use of the virus-like nanoparticle nucleic acid delivery system of claim 1 or 2 in the preparation of a nucleic acid preparation for delivering mRNA, DNA, and siRNA.

Citation Information

Patent Citations

  • Lipid formulations for nucleic acid delivery

    US8058069B2

  • Self-assembling nanoparticle drug delivery system

    US20060292174A1

  • Self-assembling nanoparticle drug delivery system

    US20090226525A1