Use of KLF12 or a KLF12 expression promoter in the manufacture of a medicament for inhibiting galectin-1 expression
By increasing KLF12 expression in tumor cells and targeting and inhibiting Galectin-1, thereby enhancing CD8+ T cell infiltration and function, the problem of CD8+ T cell activation impairment in anti-PD-1 therapy was solved, resulting in a significant improvement in the efficacy of tumor treatment.
Patent Information
- Application Number
- CN202310718732.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-16
- Publication Date
- 2026-03-24
- Estimated Expiration
- 2043-06-16
AI Technical Summary
In current anti-PD-1 immunotherapy, impaired CD8+ T cell activation, reduced infiltration, and abnormal function lead to poor treatment efficacy. It is necessary to increase the infiltration ratio and function of CD8+ T cells in the tumor microenvironment to improve the therapeutic effect.
By increasing the expression of KLF12 in tumor cells, targeting the promoter region of Galectin-1 to inhibit its expression, using KLF12 expression promoters or drugs that inhibit Galectin-1 expression, enhancing the infiltration and function of CD8+ T cells, and combining with anti-PD-1 therapy, a composition is formed for use as an anti-tumor drug.
It significantly enhances the efficacy of anti-PD-1 immunotherapy, increases the infiltration and function of CD8+ T cells in the tumor microenvironment, and improves the treatment effect of tumors, especially in lung cancer, esophageal cancer and colorectal cancer.
Smart Images

Figure CN116785437B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biotechnology and gene therapy, specifically to the use of KLF12 or KLF12 expression promoters in the preparation of drugs for inhibiting Galectin-1 expression. Background Technology
[0002] The tumor microenvironment (TME) is the environment in which tumors develop, grow, and metastasize. It is composed of tumor cells, stromal cells, immune cells, and active mediators. The type and density of immune cells in the TME are effective predictors of immunotherapy response. Different immune cell subsets interact and influence tumor cells within the TME; therefore, understanding the complex interactions between immune cells and tumor cells in the TME is crucial for elucidating the mechanisms of immunotherapy resistance. Long-term stimulation by tumor antigens or the immunosuppressive effects of the tumor microenvironment can lead to CD8+ cellular irradiation. + T cells are chronically in a state of functional exhaustion. Current research results indicate that CD8+ cells are present in patients resistant to anti-PD-1 immunotherapy. + Impaired T cell activation, reduced infiltration, and abnormal function. CD8 in the tumor microenvironment. + The number and function of infiltrated T cells are among the main factors determining the efficacy of anti-PD-1 immunotherapy. Therefore, increasing CD8+ infiltration in the tumor microenvironment is crucial. + T cell infiltration rate and recovery of CD8 + The function of T cells is of profound significance in improving the clinical efficacy of anti-PD-1 immunotherapy, and there is an urgent need to discover some potential therapeutic targets to improve the effect of anti-PD-1 immunotherapy. Summary of the Invention
[0003] This invention discovered that cancer patients with good anti-PD-1 treatment response also had higher KLF12 expression levels, and that upregulating KLF12 in tumor cells could inhibit Galectin-1 expression and increase CD8 expression. + T cell infiltration, enhanced CD8 + The function of T cells significantly enhances the in vivo therapeutic effect of anti-PD-1. Therefore, this paper proposes a technical solution to enhance the immune system by increasing the level of KLF12 in the tumor microenvironment, thereby improving the efficacy of anti-PD-1 immunotherapy.
[0004] The technical solution provided by this invention is as follows:
[0005] In a first aspect, the present invention provides the use of KLF12 or a KLF12 expression promoter in the preparation of a drug for inhibiting Galectin-1 expression. In tumor cells, KLF12 can directly target the promoter region of Galectin-1 to inhibit its transcription and expression; increased KLF12 levels in tumor cells significantly inhibit Galectin-1 expression.
[0006] Based on the above technical solution, the drug used to inhibit Galectin-1 expression is an immune enhancer. After the intracellular KLF12 content is increased, CD8+ expression in tumor tissue is also increased. + The infiltration and function of T cells are enhanced, thereby strengthening the human immune system.
[0007] Based on the above technical solution, the immune enhancer is used to increase CD8 + T cell infiltration, enhanced CD8 + T-cell immune function.
[0008] Based on the above technical solution, the drug used to inhibit Galectin-1 expression is an anti-tumor adjuvant drug.
[0009] In a second aspect, the present invention provides the use of a composition of anti-PD-1 and (i) KLF12 or a KLF12 expression promoter or (ii) a drug for inhibiting Galectin-1 expression in the preparation of an antitumor drug.
[0010] This invention has found that increased KLF12 expression or decreased Galectin-1 expression can improve the response rate of anti-PD-1 and enhance the therapeutic effect of anti-PD-1. (i) KLF12 or a KLF12 expression promoter or (ii) a drug for inhibiting Galectin-1 expression can be used as an adjunct to anti-PD-1 treatment of one or more of lung cancer, esophageal cancer, and colorectal cancer.
[0011] Based on the above technical solutions, KLF12 expression promoters include one or more of proteins, proteolytic targeting chimeras, polynucleotides, and small molecule compounds.
[0012] Based on the above technical solutions, the KLF12 or KLF12 expression promoter can enter cells through one or more of the following methods: direct naked DNA injection, liposome-encapsulated DNA direct injection, gold-coated DNA gene gun bombardment, reproduction-deficient bacteria carrying plasmid DNA, replication-deficient adenovirus carrying target DNA, PEG-modified protein drug injection, liposome-encapsulated protein intravenous injection, and protein microsphere formulation subcutaneous injection.
[0013] Based on the above technical solution, the KLF12 expression promoter is a recombinant plasmid containing the KLF12 gene and capable of normally expressing the KLF12 protein. Specifically, the sequence of the KLF12 gene is shown in SEQ ID NO.1, and the backbone of the recombinant plasmid is pCDH-CMV-MCS-EF1-Puro, as shown in the diagram. Figure 23 As shown.
[0014] Thirdly, the present invention provides a system for predicting the prognosis of anti-PD-1 immunotherapy in cancer patients, comprising:
[0015] The acquisition module is used to obtain the expression levels of KLF12 or Galectin-1;
[0016] The prediction module is used to predict the prognostic score of anti-PD-1 immunotherapy for cancer patients based on the expression level obtained by the acquisition module, and output the prognostic score.
[0017] The acquisition module and the prediction module are connected wirelessly and / or via wired means. Attached Figure Description
[0018] Figure 1 (A) KLF12 expression in tumors and normal tissues was analyzed using the TCGA database. (B) Forest plots showed the relationship between KLF12 expression and survival rate of tumor patients in 23 types of tumors in the TCGA database. (C) Prognostic survival curves were plotted by dividing the data of LUAD, LUSC, ESCA, COAD and SKCM in the TCGA database into two groups based on KLF12 expression: high expression and low expression.
[0019] Figure 2Clinical tissue samples validated a positive correlation between KLF12 and prognosis in cancer patients; (A) Immunohistochemical staining images of KLF12 in tumor tissues and paired adjacent normal tissues of lung cancer patients (scale bar, 100 μm); KLF12 expression in lung cancer; (B) Relationship between KLF12 expression in tumor tissues of lung cancer patients and patient prognosis; (C) Comparison of KLF12 expression in tumor tissues of lung cancer patients with and without lymph node metastasis; (D) Comparison of KLF12 expression in tissues of lung cancer patients at different stages; (E) Immunohistochemical staining images of KLF12 in tumor tissues and paired adjacent normal tissues of esophageal cancer patients (scale bar, 100 μm); KLF12 expression in esophageal cancer. (F) Relationship between KLF12 expression and prognosis in esophageal cancer tumor tissues; (G) Comparison of KLF12 expression in esophageal cancer tumor tissues with and without lymph node metastasis; (H) Comparison of KLF12 expression in esophageal cancer patients at different stages; (I) Immunohistochemical staining images of KLF12 in tumor tissues and paired adjacent normal tissues of colorectal cancer patients (scale bar, 100 μm); KLF12 expression in colorectal cancer; (J) Relationship between KLF12 expression and prognosis in colorectal cancer tumor tissues; (K) Comparison of KLF12 expression in tumor tissues of colorectal cancer patients with and without lymph node metastasis; (L) Comparison of KLF12 expression in colorectal cancer patients at different stages.
[0020] Figure 3 KLF12 does not affect the in vitro proliferation of various tumor cell lines; (A) The proliferation rate of A549 cells was observed and measured using IncuCyte; (B) The proliferation rate of H322 cells was observed and measured using IncuCyte; (C) The proliferation rate of KYSE30 cells was observed and measured using IncuCyte; (D) The proliferation rate of LLC cells was observed and measured using IncuCyte; (E) The proliferation rate of MC38 cells was observed and measured using IncuCyte; (F) The proliferation rate of B16-F10 cells was observed and measured using IncuCyte.
[0021] Figure 4 KLF12's inhibition of tumor growth depends on the presence of a normal immune system; (AB)KLF12 OE -A549(A), KLF12 KO - KYSE30(B) and its control group cells in nude mice: tumor growth curves and tumor weight; (CD) control LLC cells and KLF12 cells in nude mice (C) and C57BL / 6J mice (D). SH -Tumor growth curves and tumor weight of LLC cells; (EF) Wild-type B16-F10 cells and KLF12 cells in nude mice (E) and C57BL / 6J mice (F) KOTumor growth curves and weights of B16-F10 cells; control MC38 cells and KLF12 cells in nude mice (G) and C57BL / 6J mice (H). OE - Tumor growth curves and weight of MC38 cells; (IP) Images of tumors formed after subcutaneous inoculation of different tumor cells in mice.
[0022] Figure 5 Decreased KLF12 expression in tumor cells inhibits CD8 expression in tumor tissue. + T cell infiltration; (A) EPIC analysis showed a significant correlation between KLF12 expression and immune cell infiltration; (B) Flow cytometry was used to detect the total CD45 content of infiltrating immune cells (CD4, CD8, NK, NKT, M1, M2, and MDSC) in mouse tumor tissue. + (C) Proportion of lymphocytes; (D) positivity rate of CD8 in mouse tumor tissue by immunohistochemical staining (scale bar, 50 μm); (E) Detection of CD4, CD8, NK and NKT cells in total CD45 in spleen (D) and tumor draining lymph nodes (E) of tumor-bearing mice by flow cytometry. + The proportion of cells.
[0023] Figure 6 KLF12 overexpression in tumor cells promotes the inhibition of CD8. + T cell recruitment; C)CD8 + T cell migration ratio analysis; mouse spleen cells (2×10⁻⁶) 5 ( ) The cells were seeded into the upper chamber of a Transwell, and LLC, B16F-10, and MC38 cells in conditioned medium were placed into the lower chamber of the Transwell; 24 hours later, the cells that migrated into the lower chamber were analyzed by flow cytometry; (DF) Peripheral blood mononuclear cells (2×10 5 Cells were seeded into the upper chamber of the Transwell, and conditioned medium containing A549, H322, and KYSE30 cells was placed into the lower chamber of the Transwell. After 24 hours, the cells that migrated into the lower chamber were analyzed by flow cytometry.
[0024] Figure 7 Decreased KLF12 expression in tumor cells inhibits intratumoral infiltration of CD8. + T cell function; (AC) Flow cytometry analysis of control group MC38 and KLF12 OE - IFN-γ in tumor-infiltrating lymphocytes (A), tumor-draining lymph nodes (B), and spleen (C) of MC38 + TNF-α + and GZMB + CD8 +The proportion of T cells; (D, E) wild-type B16-F10 and KLF12 were detected by flow cytometry. KO GZMB, IFN-γ, and TNF-α in TILs (D) and TdLNs (E) of -B16-F10 are present in CD8+. + Expression in T cells.
[0025] Figure 8 Low expression of KLF12 in tumor cells inhibits CD8 in the tumor microenvironment. + T cell infiltration; (AB) OVA-LLC cells and OVA-KLF12 SH Five days after subcutaneous inoculation of -LLC cells into mice, DIR-labeled OT-1CD8 was infused via tail vein. + (C) T cells were used to observe the dynamic changes in tumor volume in mice; (D) CD8+ cells were observed in tumor tissue using a small animal imaging system. + (D) Fluorescence intensity of T cells; (F) Immunohistochemical detection of CD8 expression in mouse lung cancer tumor tissue (scale bar, 50 μm); (E) OVA-B16-F10 cells and OVA-KLF12 cells. KO Five days after subcutaneous inoculation of B16-F10 cells into mice, DIR-labeled OT-1CD8 was infused via tail vein. + T cells were used to observe the dynamic changes in tumor volume in mice; (G) small animal imaging was used to observe CD8+ in tumor tissue. + (H) Fluorescence intensity of T cells; (I) Detection of CD8 expression in mouse melanoma tumor tissue using immunofluorescence (scale bar, 50 μm); (II) C57BL / 6J mice were intraperitoneally injected with anti-CD8 or isotype control antibodies to eliminate CD8 in vivo. + Following T cell inoculation, wild-type B16-F10 cells and KLF12 cells were subcutaneously injected. KO -B16-F10 cells were used to observe the dynamic changes in tumor volume in mice.
[0026] Figure 9 Low expression of KLF12 in tumor cells can damage CD8. + Functions of T cells; (A) CD8 + T cells were used with wild-type B16-F10 and KLF12. KO After culturing B16-F10 cells in cell supernatant for 24 hours, intrinsic factor was detected by flow cytometry; representative flow cytometry plots and statistical graphs of GZMB, IFN-γ, and TNF-α were performed; (B)CD8 + T cells were used with control group MC38 cells and KLF12 cells. OEAfter culturing MC38 cell supernatant for 24 hours, the expression of GZMB, IFN-γ, and TNF-α was detected by flow cytometry; (C) Tumor cell-specific killing assay; OVA-B16 and OVA-KLF12 were used. OE -B16 cells, OVA-B16-F10 tumors and OVA-KLF12 KO -B16-F10 cells and OT-1CD8 + T cells were co-incubated with different effector cell to target cell (E:T) ratios (1:1, 5:1, and 10:1) for 4-6 hours, and the apoptosis rate of tumor cells was detected by flow cytometry; (D) CD8 cells were cultured using A549, H322, and KYSE30 cell supernatants. + (E) GZMB expression was detected in T cells 24 hours later; CD4 expression was detected in A549 cell supernatant 24 hours later. + GZMB expression in T cells, NK cells, and NKT cells (F) using cell supernatant cultured with H322 on CD4 cells + Expression of GZMB in T cells, NK cells, and NKT cells 24 hours later.
[0027] Figure 10 Low KLF12 expression in tumor cells promotes CD8. + T cell apoptosis; (AB) Flow cytometry was used to detect MC38 and KLF12 in the control group. OE Annexin V was present in tumor-infiltrating lymphocytes (A) and tumor-draining lymph nodes (B) of MC38. + CD8 + (C) Proportion of T cells; (C) Detection of wild-type B16-F10 and KLF12 cells by flow cytometry. KO In B16-F10 TILs and TdLNs, Annexin V-positive CD8 + T cell ratio.
[0028] Figure 11 Low expression of KLF12 in tumor cells can induce CD8 in vitro. + T cell apoptosis; flow cytometry was used to detect MC38 and KLF12 in the control group. OE After culturing lymphocytes from MC38 cell supernatant, Annexin V + CD8 + (B) The proportion of T cells; (C) The presence of LLC and KLF12 in the control group was detected by flow cytometry. SH LLC cell supernatant cultured CD8 + Annexin V expression 24 hours after T cell death; (C) CD8 expression detected by flow cytometry. +T cells in wild-type B16-F10 and KLF12 KO After culturing in B16-F10 cell supernatant for 24 hours, Annexin V + CD8 + The proportion of T cells; (D) After culturing peripheral mononuclear cells in the cell supernatant of human A549 for 24 hours, Annexin V + CD8 + Percentage of T; (E) Annexin V in peripheral blood mononuclear cells cultured using cell supernatant from lung cancer H322. + CD8 + The proportion of T; (F) After culturing peripheral blood mononuclear cells with cell supernatant from esophageal cancer KYSE30 for 24 hours, Annexin V-positive CD8+ cells were observed. + The percentage of T cells.
[0029] Figure 12 KLF12 inhibits Galectin-1 expression; plots showing the control group and KLF12... SH A549 cells, KLF12 KO (B) Heatmap of differential gene expression in KYSE30 cells and KLF12-overexpressing mouse embryos; (C) Venn diagram analysis of the three groups of differentially expressed genes; (D) Confirmation of altered KLF12 (D) and Galectin-1 (E) expression in human and mouse cell lines by WB (C) and RT-PCR.
[0030] Figure 13 KLF12 promotes CD8 expression in tumor cells by downregulating Galectin-1 expression. + T cell recruitment; (A) wild-type B16-F10 and KLF12 KO CD8+ of B16-F10 cells transfected with siGalectin-1 + (B) Percentage of T cell migration; (B) migration towards wild-type B16-F10 and KLF12 KO -B16-F10 cells were treated with Galectin-1 inhibitor, and CD8 levels were measured. + Percentage of T cell migration; (C) Control group LLC and KLF12 SH -LLC cells transfected with siGalectin-1 followed by CD8 + Percentage of T cell migration; (D) Control group LLC and KLF12 SH -LLC cells after addition of Galectin-1 inhibitor CD8 + Percentage of T cell migration; (E) Control group H322 and KLF12 SH -H322 cells after addition of Galectin-1 inhibitor CD8+ Percentage of T cell migration; (F) Control group A549 and KLF12 SH -A549 cells after adding Galectin-1 inhibitor CD8 + Percentage of T cell migration; (G) wild-type KYSE30 and KLF12 KO -KYSE30 cells after addition of Galectin-1 inhibitor CD8 + The percentage of T cell migration.
[0031] Figure 14 Tumor cells KLF12 promote CD8 expression by downregulating Galectin-1 expression. + Cytokine secretion by T cells; (A) Wild-type B16-F10 and KLF12 KO B16-F10 cells transfected with siGalectin-1 followed by GZMB + IFN-γ + and TNF-α + CD8 + Percentage of T cells; (B) Control group LLC and KLF12 SH GZMB cells transfected with siGalectin-1 in LLC cells + IFN-γ + and TNF-α + CD8 + Percentage of T cells; (C) Wild-type B16-F10 and KLF12 KO B16-F10 cells treated with Galectin-1 inhibitors showed reduced levels of GZMB, IFN-γ, and TNF-α in CD8 cells. + Expression in T cells; (D) Control group LLC and KLF12 SH LLC cells treated with Galectin-1 inhibitors showed reduced levels of GZMB, IFN-γ, and TNF-α in CD8 cells. + Expression in T cells.
[0032] Figure 15 KLF12 inhibits CD8 in tumor cells by downregulating Galectin-1 expression. + T cell apoptosis; (A) Wild-type B16-F10 and KLF12 KO Annexin V after transfection of B16-F10 cells with siGalectin-1 + CD8 + Percentage of T cells; (B) Control group LLC and KLF12 SH -LLC cells transfected with siGalectin-1 followed by Annexin V + CD8+ Percentage of T cells; (C) Wild-type B16-F10 and KLF12 KO Annexin V in CD8 cells after treatment with Galectin-1 inhibitor -B16-F10 cells + Expression in T cells; (D) Control group LLC and KLF12 SH -LLC cells treated with Galectin-1 inhibitor Annexin V on CD8 + Expression in T cells.
[0033] Figure 16 (A) ChIP-seq trajectory of KLF12 at the LGALS1 gene locus in HEK293 and HepG2 cells; (B) ChIP-PCR analysis of KLF12 binding to the Galectin-1 promoter in A549, H322 and KYSE30 cells; (C) Evaluation analysis by measuring OD value of luciferase after co-transfecting wild-type or mutant (MU) Galectin-1 promoter luciferase reporter gene and KLF12 overexpression plasmid into HEK293 cells for 24 hours; (D) RT-PCR detection of Galectin-1 expression in HEK293 cells overexpressing Flag-labeled WT or various truncated KLF12 mutants.
[0034] Figure 17 KLF12 and Galectin-1 are associated with immune checkpoint expression; (A) TCGA database analysis of the correlation between KLF12, Galectin-1 and checkpoints in LUAD, LUSC, ESCA, COAD and SKCM; (B) Immunohistochemistry was used to detect PD-1 expression in tumor tissues of colorectal cancer, lung cancer and melanoma in mice (scale bar, 50 μm).
[0035] Figure 18 In vivo experiments verified that KLF12 regulates CD8 by inhibiting Galectin-1 expression. + T cells; (AB) wild-type B16-F10 cells and KLF12 KO B16-F10 cells were injected subcutaneously into C57BL / 6J mice, followed by treatment with Galectin-1 inhibitors or PBS. Tumor growth (A) and mouse survival (B) were then analyzed; (C) Images of B16-F10 melanoma tumors treated with Galectin-1 inhibitors or PBS; (D) Immunofluorescence assay of CD8 expression in B16-F10 melanoma tumor tissue; (E) Flow cytometry analysis of CD8 expression in the B16-F10 melanoma tumor microenvironment. +The proportion of T cells; (F) Flow cytometry analysis of CD4 in the B16-F10 melanoma tumor microenvironment. + The proportions of T cells, NK cells, and NKT cells; (G) Flow cytometry analysis of CD8+ in the B16-F10 melanoma tumor microenvironment. + T cell secretion of GZMB, IFN-γ, and TNF-α; (H) Flow cytometry analysis of CD8+ in the B16-F10 melanoma tumor microenvironment. + Annexin V expression in T cells; (I, J) monitoring of Control-MC38 and KLF12. OE -MC38, Galectin-1 OE -MC38 and KLF12 OE Galectin-1 OE - MC38 tumor size (I) and tumor volume (J); (K) Immunohistochemical detection of CD8 in the MC38 tumor microenvironment + Tumor infiltration of T cells (scale bar, 50 μm).
[0036] Figure 19 Correlation between KLF12 and Galectin-1, CD8 and PD-1 expression in tumor tissues; (AC) Correlation between KLF12, Galectin-1, CD8 and PD-1 in lung cancer (A), esophageal cancer (B) and colorectal cancer (C).
[0037] Figure 20 KLF12 / Galectin-1 mediates the efficacy of anti-PD-1 treatment; (A) Subcutaneous inoculation of mice with wild-type B16-F10 and KLF12 KO -B16-F10 cells were administered to mice on day 5, followed by analysis of tumor growth curves and mouse survival; (B) Mice were subcutaneously inoculated with control LLC and KLF12 cells. SH (C) Mice injected with LLC cells received anti-PD-1 or IgG treatment on day 5, followed by analysis of tumor growth and mouse survival; (D) Mice injected with B16-F10 cells subcutaneously received anti-PD-1, Galectin-1 inhibitors, or both simultaneously via intraperitoneal injection on day 5; tumor size was observed using representative bioluminescent images of the mice, tumor volume was dynamically observed, and the overall survival time of tumor-bearing mice was analyzed;
[0038] Figure 21 (a) Expression levels of KLF12 and Galectin-1 in tumor tissues are predictive molecules of anti-PD-1 efficacy; (b) Expression of KLF12, Galectin-1, CD8, and PD-1 in a lung cancer immunotherapy cohort; (c) Differences in the expression of KLF12, Galectin-1, CD8, and PD-1 between the anti-PD-1 treatment response group and the non-response group in lung cancer patients; (d) Correlation among KLF12, Galectin-1, CD8, and PD-1 in a lung cancer immunotherapy cohort; (e) Expression of KLF12, Galectin-1, CD8, and PD-1 in an esophageal cancer immunotherapy cohort; (f) Differences in the expression of KLF12, Galectin-1, CD8, and PD-1 between the effective and ineffective groups of anti-PD-1 treatment in esophageal cancer patients; (g) Correlation among KLF12, Galectin-1, CD8, and PD-1 in an esophageal cancer immunotherapy cohort.
[0039] Figure 22 A schematic diagram of the KLF12 / Galectin-1 pathway regulating tumor immunity in tumor cells.
[0040] Figure 23 : A map of the backbone vector of the human KLF12 recombinant plasmid vector. Figure 24 : A skeletal vector map of the mouse KLF12 recombinant plasmid vector.
[0041] Figure 25 : Backbone vector map of the human KLF12 gene interference vector. Figure 26 : Backbone vector map of mouse KLF12 gene interference vector.
[0042] In the above figures, OE represents overexpression, SH represents knockdown, and KO represents knockout. Detailed Implementation
[0043] Unless otherwise specified, the Galectin-1 inhibitor used in this invention is OTX008, which was purchased from MedChemExpress (MCE).
[0044] The method for constructing KLF12-overexpressing cancer cells according to this invention is as follows: A KLF12 recombinant plasmid vector containing the KLF12 gene and capable of normal expression of the KLF12 protein is constructed, and this vector is introduced into purchased cancer cells to obtain KLF12-overexpressing cancer cells. Construction of the KLF12 recombinant plasmid vector: The target gene is cloned into a backbone vector using molecular cloning technology to obtain the KLF12 recombinant plasmid vector. The target gene is the gene sequence encoding KLF12, as shown in SEQ ID NO.1. The backbone vector map of the human KLF12 recombinant plasmid vector is shown below. Figure 23The backbone vector of the mouse KLF12 recombinant plasmid vector is as follows: Figure 24 As shown.
[0045] The method for constructing KLF12 knockout cancer cells according to this invention is as follows: A KLF12 gene interference vector is constructed, and the KLF12 gene interference vector is introduced into purchased cancer cells to interfere with the expression of KLF12 in the cancer cells, thereby obtaining cancer cells with inhibited KLF12 expression. Construction of the KLF12 gene interference vector: The target gene is cloned into a backbone vector using molecular cloning technology to obtain the KLF12 gene interference vector; Target sequence 1: CGCCAAGAGCTTTGTGCTGAA; Target sequence 2: GGTGTAACACCAAGGAAGAT;
[0046] Target sequence 3: AGACGGACATGAATTCAAGTT. The backbone vector map of the human KLF12 gene interference vector is shown below. Figure 25 The backbone vector of the mouse KLF12 gene interference vector, such as Figure 26 As shown.
[0047] Example 1: KLF12 is positively correlated with the prognosis of various cancer patients.
[0048] Analysis of transcriptome data from the public database The Cancer Genome Atlas (TCGA) revealed that KLF12 was expressed at low levels in various tumor tissues compared to normal tissues. Figure 1 A), and the mRNA expression level of KLF12 is positively correlated with the survival time of various tumors. Figure 1 (BC) suggests that KLF12 is an important predictor of survival in cancer patients. Immunohistochemical staining was performed on three common solid tumor cohorts: 161 cases of non-small cell lung cancer, 53 cases of esophageal cancer, and 173 cases of colorectal cancer. The results showed that KLF12 expression was significantly reduced in all three tumor tissues compared to normal tissues. Figure 2 A, 2E, 2I). Meanwhile, patients with high KLF12 expression had significantly longer survival times than patients with low KLF12 expression (A, 2E, 2I). Figure 2 B, 2F, 2J). KLF12 expression is closely associated with lymph node metastasis and clinical stage: lymph node metastasis occurs ( Figure 2 KLF12 expression was lower in patients with C, 2G, 2K and later stages. Figure 2 The above results indicate that KLF12 plays an important role in tumors, and low expression of KLF12 predicts poorer patient survival.
[0049] Example 2: KLF12 does not affect tumor cell proliferation
[0050] A549, H322, KYSE30, 293T, LLC, MC38, B16, and B16-F10 cell lines were purchased from the Cell Bank of the Chinese Academy of Sciences. Human lung cancer A549, human lung cancer H322, and mouse colorectal cancer MC38 cell lines overexpressing KLF12, as well as KLF12 knockout A549, H322, human esophageal cancer KYSE30, mouse lung cancer LLC, and mouse melanoma B16-F10 cell lines, were constructed. Cell proliferation rate was dynamically monitored using IncuCyte. The results showed that changes in KLF12 expression did not affect the in vitro proliferation capacity of tumor cells. Figure 3 The above experimental results suggest that KLF12 does not affect the in vitro proliferation of tumor cells.
[0051] Next, animal models of KLF12 overexpression and KLF12 knockout were constructed to further investigate the effect of KLF12 on tumor growth in mice. Control groups and KLF12... OE -A549( Figure 4 A) KLF12 SH -KYSE30( Figure 4 B) KLF12 SH -LLC( Figure 4 C) KLF12 KO -B16-F10( Figure 4 E) and KLF12 OE -MC38( Figure 4 KLF12 cells were subcutaneously inoculated into nude mice, and the growth rate of the tumors was observed. Tumor volume growth curves were plotted. The results showed that KLF12 did not affect the growth rate of tumor cells in nude mice. The tumors were removed, and the images showed little difference in tumor volume between the experimental and control groups. Figure 4 I, 4J, 4K, 4M, 4O).
[0052] KLF12 mice SH -LLC, KLF12 KO -B16-F10, KLF12 OE MC38 cells and control cells were subcutaneously seeded into C57BL / 6J mice. Results showed that the cell line with altered KLF12 expression did not affect tumor growth in nude mice (immune deficient), but it did affect tumor growth in C57BL / 6J mice (immune normal). KO -B16-F10 and KLF12 SH -LLC tumor cells grow faster in C57BL / 6J mice ( Figure 4 D, 4F, 4L, 4N), while KLF12 OE This resulted in a slower progression of MC38 tumors in C57BL / 6J mice. Figure 4These results suggest that KLF12's inhibition of multiple tumor progressions depends on the presence of a normal immune system.
[0053] Example 3: KLF12 and tumor immune cell infiltration
[0054] To investigate the specific effects of KLF12 on the tumor immune microenvironment, the relationship between KLF12 and immune cell infiltration in the TCGA database was first analyzed. Analysis of the TCGA database indicated a positive correlation between KLF12 and the infiltration of immune cells such as T cells in pan-cancer. Figure 5 A) These results suggest that KLF12 may synergistically work with tumor immune cells. To clarify the detailed mechanism by which KLF12 inhibits tumor progression by modulating the tumor microenvironment, subcutaneous tumor tissues from C57BL / 6J mice were collected, and the differences in infiltration of various immune cells (CD4, CD8, NK, NKT, M1, M2, and MDSC) in the mouse subcutaneous tumor microenvironment were analyzed by flow cytometry. By analyzing the proportion of immune cells in the tumor microenvironment, the results showed that, compared with the control group, KLF12... SH -LLC tumors ( Figure 5 B, upper part) and KLF12 KO -B16-F10 tumor ( Figure 5 B, Central) CD8 + T cell infiltration was significantly reduced, while KLF12 OE -MC38 tumor ( Figure 5 B, lower part) CD8 + Increased T cell infiltration was observed, but the proportions of other immune cells did not show consistent changes. Immunohistochemical analysis of CD8 expression in the tumor microenvironment of mouse tissue revealed that KLF12 expression was present in the LLC tumor model. SH Compared with the control group, the tumor CD8 + T cell recruitment was significantly reduced. Figure 5 C, upper part), in KLF12 KO Consistent results were also obtained in the -B16-F10 melanoma model. Figure 5 C, Central). Conversely, in KLF12 OE In a colorectal cancer model, CD8 in the tumor microenvironment + T cell infiltration was significantly increased ( Figure 5 C, lower part). Further analysis of the composition of immune cells in the spleen and tumor-drained lymph nodes (TdLNs) of tumor-bearing mice showed that, compared with the control group, KLF12 expression was reduced when CD8 expression was decreased. + The proportion of T cells decreases, while CD8 cells are elevated when KLF12 expression increases. + The proportion of T cells is relatively high.Figure 5 DE). After KLF12 expression changes, CD8 + T cell infiltration exhibited consistent changes across three different tumor models, namely, increased KLF12 expression in tumor cells promoted CD8 cell infiltration. + T-cell infiltration.
[0055] Example 3: KLF12 affects CD8 + T cell infiltration
[0056] Further exploration of KLF12 versus CD8 + T cell chemotaxis: In vitro chemotaxis experiments to observe the effect of different treatments of tumor cell supernatant on CD8. + In vitro chemotaxis of T cells. KLF12 SH -LLC and KLF12 KO -B16-F10 tumor cell line conditioned medium (CM) induces CD8 + The number of T cells that migrated was less than that in the culture supernatant of Control-LLC and WT-B16-F10 tumor cell lines. Figure 6 AB), while CD8 is recruited in the cell culture supernatant of KLF12-overexpressing tumor cell lines. + The number of T cells increased compared to the control group. Figure 6 C). The same experiments were performed on the supernatants of human lung cancer and esophageal cancer cell lines, yielding consistent results. Figure 6 DF). These results indicate that increased KLF12 expression in tumor cells can promote CD8. + In vitro recruitment of T cells.
[0057] To further clarify CD8 + T cells are regulated by the expression level of KLF12 in tumor cells. Nude mice were subcutaneously inoculated with OVA-LLC and OVA-KLF12. SH -LLC, OVA-B16-F10 and OVA-KLF12 KO -B16-F10 cells. Cells were extracted from the spleen of healthy OT-1 mice on the same day and activated in vitro to culture CD8+ cells. + T cells. Five days later, activated OT-1CD8 cells were labeled with DIR dye. + T cells, labeled cells, were reinfused into tumor-bearing mice via tail vein injection. Results showed that without CD8 injection... + T-cell control group and KLF12 SH -LLC and KLF12 KO The tumor volume of -B16-F10 remained unchanged, while the tail vein injection of OT-1CD8... + After T cells, KLF12 SH-LLC and KLF12 KO There was a statistically significant difference in tumor volume between mice in the -B16-F10 group and the control group. Figure 8 This result (AB, EF) also suggests that KLF12 expression in tumor cells may enhance CD8. + The anti-tumor function of T cells was further validated through a series of subsequent experiments. Next, the fluorescence intensity of DIR dye in tumor tissue was measured to assess CD8. + The number of infiltrating T cells was detected using a small animal imaging system to measure the infiltrating CD8+ cells in tumor tissue. + The fluorescence signal of T cells showed that KLF12 SH -LLC and KLF12 KO CD8 in B16-F10 tumors + T cells have lower signal intensity ( Figure 8 C, G). Immunohistochemical staining further analyzed the positive rate of CD8 in mouse tumor tissues, and the results showed that KLF12 SH -LLC and KLF12 KO The CD8 positivity rate in B16-F10 tumor tissues was significantly lower than that in the control group, suggesting that the absence of KLF12 leads to CD8 positivity. + Decreased T cell infiltration ( Figure 8 D, H).
[0058] To further verify CD8 + The important role of T cells in suppressing tumor progression in KLF12, and the depletion of CD8 in normally immunized mice by intraperitoneal injection of CD8 antibodies into C57BL / 6J mice. + T cells, then proceed to clear CD8 + T cells were subcutaneously implanted in C57BL / 6J mice with wild-type B16-F10 and KLF12 cells. KO -B16-F10 cells were used to observe the growth of tumor cells in two groups. The results showed that the tumor cells lacked CD8. + In the presence of T cells, the tumor growth difference between the KLF12 knockout group and the control group was significantly greater than that in the presence of CD8. + T cells decrease when they function ( Figure 8 IJ), CD8 + Alterations in T cells are a key factor in KLF12's tumor-suppressive function. These results indicate that KLF12 exerts its tumor-suppressive function by promoting CD8+. + T cell infiltration in the tumor microenvironment inhibits tumor progression.
[0059] Example 4: KLF12 regulation of CD8 + T cell function
[0060] Next, CD8 can be identified by detecting cytokine secretion and direct killing effects. + The functional status of T cells was investigated to explore the effect of KLF12 expressed in tumor cells on CD8. + The impact on T cell function.
[0061] First, CD8+ isolated from tumor tissues of MC38 and B16-F10 tumor-bearing mice was detected by flow cytometry. + The secretion of tumor-killing factors by T cells showed that mice subcutaneously inoculated with MC38 tumors compared to mice inoculated with KLF12 showed a significant difference. OE -MC38 cells are mouse tumor-infiltrating lymphocytes (TILs) Figure 7 A) Tumor draining lymph nodes ( Figure 7 B) and spleen ( Figure 7 C) CD8 + T showed higher expression of IFN-γ, TNF-α, and granzyme B (GZMB), i.e., CD8+. + T cell function was enhanced. To validate these results, WT-B16-F10 and KLF12 were further analyzed. KO CD8 in B16-F10 tumor tissue + T cell function, results showed that KLF12 KO -B16-F10 tumor-infiltrating lymphocytes ( Figure 7 D) and tumor draining lymph nodes ( Figure 7 E) IFN-γ + TNF-α + and GZMB + CD8 + The proportion of T cells decreased. These results indicate that, in mice, decreased KLF12 expression in tumor tissue can inhibit CD8 expression in the tumor microenvironment, tumor-draining lymph nodes, and spleen of tumor-bearing mice. + The ability of T cells to secrete cytokines.
[0062] Next, we will verify whether KLF12 knockout tumor cells can directly inhibit CD8 in vitro. + T cell function. Wild-type B16-F10 and KLF12 were collected. KO -B16-F10 tumor cell conditioned medium was added to 24-well plates for in vitro culture of CD8 cells derived from the spleen of healthy mice. + T cells, CD8 count was measured 24 hours later. + The expression of IFN-γ, TNF-α, and GZMB in T cells was analyzed, and the results showed that compared with the wild-type B16-F10 group, the addition of KLF12... KOCD8 cells cultured in conditioned medium of B16-F10 cells + T cells showed significantly decreased expression of IFN-γ, TNF-α, and GZMB. Figure 9 A). CD8 cells cultured in the supernatant of the control group MC38 cells were compared with those cultured in... + Compared to T cells, KLF12 OE - MC38 cell supernatant cultured CD8 + T cells secrete higher levels of IFN-γ, TNF-α, and GZMB. Figure 9 B). OVA-B16 and OVA-KLF12 OE -B16, OVA-B16-F10 and OVA-KLF12 KO -B16-F10 cells were labeled with CFSE dye and then OT-1CD8 + T cells were co-incubated with tumor cells at three different effector-target ratios of 1:1, 1:5, and 1:10. After 4-6 hours, the apoptosis rate of tumor cells was detected by flow cytometry. The killing assay results showed that tumor cells with high KLF12 expression were more cytotoxic than those with CD8+. + The apoptosis rate was higher after co-culture with T-1CD8. + T cells exhibit stronger cytotoxicity against tumor cells with high KLF12 expression. Figure 9 C, left side), while KLF12 knockout cells are affected by CD8. + T cells are not sensitive to killing ( Figure 9 (C, right side). This leads to the conclusion that decreased KLF12 expression in mouse tumor cells significantly inhibits CD8. + The function of T cells. To demonstrate that the same phenomenon exists in the human body, further investigation was conducted to determine whether decreased KLF12 expression in lung and esophageal cancer cells would induce human CD8+. + T cell dysfunction was observed. Peripheral blood was collected from healthy donors, and peripheral mononuclear cells were isolated using gradient centrifugation. These cells were then added to tumor cell culture supernatant and cultured in vitro for 24 hours. Intracellular factors were subsequently detected by flow cytometry. Results showed that, compared to the control group, the supernatant cultured from KLF12-knockdown tumor cells contained significantly higher levels of CD8+. + Reduced expression of GZMB in T cells ( Figure 9 D), while the expression of GZMB in other immune cells (CD4 cells, NK cells, and NKT cells) showed little difference. Figure 9 E). In summary, decreased KLF12 expression in tumor cells can inhibit CD8. + The ability of T cells to secrete intracellular factors and inhibit CD8 + The function of T cells.
[0063] The present invention then tested CD8 in tumor-bearing mice. +T cell apoptosis was detected by flow cytometry in tumor tissue and draining lymph nodes. The results showed that, compared with the control group MC38 tumor, KLF12... OE -MC38 tumor tissue ( Figure 10 A) Tumor draining lymph nodes ( Figure 10 B) CD8 + Annexin V expression was lower in T cells. Further analysis of wild-type B16-F10 and KLF12 cells using flow cytometry revealed this difference. KO CD8 in the B16-F10 tumor model + T cell apoptosis was observed, and the results showed that KLF12 KO CD8 in B16-F10 tumor tissue and tumor-draining lymph nodes + T cells are more prone to apoptosis. Figure 10 C). The above results suggest that decreased KLF12 expression in mouse tumor cells can induce CD8+ expression in tumor sites and tumor-draining lymph nodes. + T cell apoptosis.
[0064] To validate these results, further in vitro experiments were conducted to analyze the effect of KLF12 expression levels in tumor cells on CD8. + The effect of T cell apoptosis. CD8 cells were treated with culture supernatants from different tumor cells. + T cells were detected by flow cytometry 24 hours later, and CD8 counts were also analyzed. + T cell apoptosis was observed, and the results showed that compared with the control group, in KLF12 OE CD8+ cells treated with MC38 cell culture supernatant + The T cell apoptosis rate is low. Figure 11 A). In contrast, in KLF12 KO CD8 cells treated with cell culture supernatant + T cells compared to CD8+ in wild-type cell culture supernatant. + T cells are more prone to apoptosis. Figure 11 BC). The above experiments were repeated using human cell lines, and the results were consistent with those using mouse cell lines. Figure 11 (DF). In summary, decreased KLF12 expression in tumor cells can lead to CD8+ cloning in both in vivo and in vitro experiments. + T cells tend to undergo apoptosis.
[0065] These results indicate that decreased KLF12 expression in tumor cells can inhibit CD8. + T cell infiltration and function, and induction of CD8 + T cell apoptosis.
[0066] Example 5: KLF12 affects CD8 by regulating Galectin-1 + T cell infiltration and function
[0067] 1. RNA-seq screening of downstream regulatory genes of KLF12
[0068] To clarify the role of KLF12 in regulating CD8 in the tumor microenvironment + The specific downstream molecular mechanisms of T cells, including KLF12 SH -A549 and KLF12 KO Transcriptome sequencing (RNA-seq) was performed on the KYSE30 cell line. Differential analysis of the transcriptome data revealed that KLF12… SH -A549 and KLF12 KO -KYSE30 cells showed differential expression of multiple genes (DEGs) compared to the control group. The top 200 genes with the largest fold differences were selected for visualization. Figure 12 A). To identify key downstream regulatory genes of KLF12 in mice, differentially expressed molecules after KLF12 overexpression were further referenced from the mouse embryo database GSE166054 compared to the control group. A visualization heatmap showed the differentially expressed genes in mice after KLF12 overexpression. Figure 12 A). Through comprehensive analysis of these three transcriptome sequencing datasets, a Venn diagram was drawn by taking the intersection, revealing that Galectin-1 was present in KLF12. SH -A549 and KLF12 KO -KYSE30 expression was increased in cells and decreased in mouse embryos overexpressing KLF12, making it a molecule with consistently differential expression across all three datasets. Figure 12 B). To further verify the changes in Galectin-1, RT-PCR and Western Blot techniques were used to verify the alteration of Galectin-1 expression at the mRNA and protein levels. Results from multiple cell lines indicated that Galectin-1 expression increased when KLF12 decreased, while Galectin-1 expression was significantly inhibited when KLF12 increased. Figure 12 (CE). The above data indicate that Galectin-1 is a key downstream molecule of KLF12.
[0069] 2. Galectin-1 participates in KLF12 regulation of CD8 + T cells
[0070] To explore whether Galectin-1 mediates KLF12 regulation of CD8 + T cells, further rescue experiments revealed, in B16-F10 cells ( Figure 13A) and LLC cells ( Figure 13 In C), KLF12 KO and KLF12 SH Silencing the Galectin-1 gene in cell lines can eliminate CD8-related induced by KLF12 reduction. + T cell infiltration was reduced. To further verify the above conclusions, Galectin-1 expression was inhibited using the Galectin-1 inhibitor OTX008 (Sharanek et al. 2021). The rescue experiment was repeated with the addition of the Galectin-1 inhibitor, and the results showed that the in vitro addition of the Galectin-1 inhibitor could restore or alleviate CD8 expression. + Decreased T cell infiltration Figure 13 B, 13D). The same experiment was then performed in human cell lines, with consistent results. Figure 13 (EG). Therefore, KLF12 can promote CD8 expression by inhibiting Galectin-1 expression. + T cell infiltration in the tumor microenvironment.
[0071] Flow cytometry was used to detect CD8 in the rescue assay. + The ability of T cells to secrete GZMB, IFN-γ, and TNF-α. (Towards KLF12) KO -B16-F10 cells ( Figure 14 A) and KLF12 SH -LLC cells ( Figure 14 In cell lines B), transfection with siGalectin-1 revealed that Galectin-1 gene silencing reversed the CD8 reduction induced by KLF12. + T cell dysfunction was observed, and the same phenomenon was also observed with the use of Galectin-1 inhibitors, resulting in decreased CD8 cell count due to reduced KLF12. + The decreased ability of T cell cytokines to secrete was significantly improved after the addition of a Galectin-1 inhibitor. Figure 14 Therefore, we infer that KLF12 can promote CD8 expression by inhibiting Galectin-1 expression. + T cell cytokine secretion function.
[0072] Next, Galectin-1 was explored in relation to CD8. + The effect of T cell apoptosis was analyzed by flow cytometry, showing that KLF12 cells had a significantly lower T cell apoptosis rate compared to wild-type B16-F10 and control LLC cells. KO -B16-F10 and KLF12 SH -LLC cells lead to Annexin V + CD8 +An increase in the proportion of T cells, coupled with the downregulation of the Galectin-1 gene due to transfection with siGalectin-1 or the addition of a Galectin-1 inhibitor, can lead to CD8 cell proliferation. + The proportion of T cell apoptosis decreased ( Figure 15 (AD). Therefore, it can be inferred that Galectin-1 is a KLF12 regulator of CD8. + Key downstream molecules of T cell apoptosis.
[0073] C57BL / 6J mice were subcutaneously inoculated with KLF12. KO B16-F10 and wild-type B16-F10 cells were injected intraperitoneally with Galectin-1 inhibitors starting on day 5 after inoculation, once every other day. Tumor volume in mice was dynamically observed and measured. Results showed that compared to mice not receiving the inhibitor, mice receiving the Galectin-1 inhibitor experienced significantly slower tumor growth. Figure 18 A) prolonged the survival time of mice. Figure 18 B), mouse tumor volume was significantly reduced ( Figure 18 C), and after using Galectin-1 inhibitors, WT-B16-F10 tumors were associated with KLF12. KO -The difference in tumor volume between B16-F10 tumors decreased ( Figure 18 The results suggest that KLF12 can inhibit tumor progression by downregulating Galectin-1. Next, immunofluorescence assays were performed on mouse tumor tissues to investigate whether KLF12 affects CD8 by downregulating Galectin-1. + The results showed that the use of Galectin-1 inhibitors significantly promoted CD8 cell infiltration and function. + T cells accumulate at the tumor site and can reverse CD8+ stunting caused by KLF12 knockout. + Decreased T cell infiltration ( Figure 18 D). This phenomenon was further verified by detecting immune cells in the tumor microenvironment using flow cytometry. The results showed that after the application of Galectin-1 inhibitor, the injection of KLF12... KO Tumors with B16-F10 cells compared to those injected with KLF12 without Galectin-1 inhibitors KO Compared to mouse tumors of type B16-F10 cells, CD8 + The proportion of T cells in the tumor microenvironment increased significantly. Figure 18 E). It was also found that Galectin-1 inhibitors can increase CD4 levels. + T cell infiltration, but no significant effect on NK cells and NKT cells. Figure 18 F). Furthermore, CD8 was detected by flow cytometry.+ T cell cytokine secretion was observed to be enhanced when KLF12 was knocked out in combination with a Galectin-1 inhibitor, compared to tumor models where KLF12 was knocked out alone. + T cells' ability to secrete GZMB, IFN-γ, and TNF-α ( Figure 18 G), reduce CD8 + T cell apoptosis ( Figure 18 H). Next, MC38 cells co-overexpressed with KLF12 and Galectin-1 were used. After subcutaneous inoculation of tumor cells, changes in tumor volume in mice were dynamically monitored, and tumor growth curves were plotted. The results showed that MC38 tumors overexpressed with KLF12 grew the slowest, while those overexpressed with Galectin-1 grew the fastest. The tumor growth rate of MC38 cells co-overexpressed with KLF12 and Galectin-1 was intermediate between the two. The in vivo mouse experiments suggest that Galectin-1 overexpression can counteract the tumor-suppressive effect caused by KLF12 overexpression. Figure 18 IJ). Further immunohistochemical analysis of CD8 expression in MC38 tumor tissue revealed that KLF12 overexpression could increase CD8 expression. + T cell infiltration, while Galectin-1 overexpression reduces CD8. + T cell infiltration, KLF12-induced CD8 during co-expression of Galectin-1 and KLF12 + The accumulation of T cells at the tumor site can be reversed by Galectin-1 ( Figure 18 In summary, in mice, KLF12 promotes CD8 expression by downregulating Galectin-1. + T cell infiltration, increased CD8 + T cell function and reduced CD8 + T cell apoptosis, thereby inhibiting tumor progression.
[0074] 3. KLF12 directly regulates Galectin-1 transcription:
[0075] Based on published chromatin immunoprecipitation sequencing (ChIP-seq) data and DNA binding sites from HEK293 and HepG2 cell lines, genome-wide transcription factor binding site analysis revealed the potential presence of a KLF12 binding site in the Galectin-1 promoter. Figure 16A, left side). To verify the above results, ChIP-PCR and dual-luciferase reporter gene assays were performed in lung cancer and esophageal cancer cell lines. ChIP-PCR results showed that KLF12 could be recruited to the promoter region of Galectin-1, inhibiting Galectin-1 transcription. Figure 16 B, right side). Dual-luciferase reporter gene assays also confirmed that KLF12 can bind to the Galectin-1 promoter. When the binding site between the two was mutated, the transcriptional repression of Galectin-1 by KLF12 was significantly relieved. Figure 16 C). To further identify the KLF12 structural region that interacts with Galectin-1, flag-tagged wild-type or various truncated KLF12 mutants were overexpressed in HEK293 cells. Quantitative real-time PCR results showed that expression of the KLF12Δ1-100 truncated mutant attenuated the inhibition of Galectin-1, possibly suggesting that the binding site of Galectin-1 to KLF12 is located within the first 100 amino acids. Figure 16 D). These data indicate that KLF12 can directly bind to the promoter region of Galectin-1, exerting a transcriptional repression function to downregulate the expression of Galectin-1 in tumors.
[0076] 4. KLF12 / Galectin-1 pathway mediates the efficacy of anti-PD-1 therapy in tumors:
[0077] 4.1. Relationship between KLF12 and PD-1 expression:
[0078] Previous in vivo and in vitro experiments have shown that both high expression of KLF12 and inhibition of Galectin-1 expression can increase CD8 expression. + T cell infiltration in the tumor microenvironment and enhanced killing ability were investigated. Further validation was conducted using KLF12, Galectin-1, and CD8. + The regulatory relationships among T cells were first analyzed using the TCGA database, revealing a negative correlation between KLF12 and Galectin-1 and multiple immune checkpoints. The results showed that KLF12 was negatively correlated with Galectin-1 and positively correlated with most immune checkpoints. Figure 17 A). Furthermore, immunohistochemical staining was used to detect PD-1 expression in tumor tissues of tumor-bearing mice, and the results showed that KLF12... OE - PD-1 expression was higher in MC38 tumors than in the control group. Figure 17 B, left side), while KLF12 SH -LLC( Figure 17 B, middle) and KLF12 KO -B16-F10(Figure 17 (B, right side) The number of PD-1 positive cells in the tumor was lower than that in the control wild-type cells. The results suggest that the expression of KLF12 and Galectin-1 is also correlated with the expression of PD-1.
[0079] To further verify KLF12, Galectin-1, CD8 + The regulatory relationship and correlation between T cells and PD-1 were further analyzed using multicolor immunofluorescence to examine the correlation among KLF12, Galectin-1, CD8, and PD-1 in clinical samples from 161 lung cancer, 53 esophageal cancer, and 173 colorectal cancer patients. The results indicated that compared to patients with low KLF12 expression, patients with high KLF12 expression had lower Galectin-1 expression and higher CD8 and PD-1 expression in their tumor tissues. Figure 19 AC, left side). Significant correlations were observed among these four molecules; KLF12 was negatively correlated with Galectin-1 and positively correlated with CD8 and PD-1 expression. Figure 19 AC (right side). This suggests that KLF12 and Galectin-1 may be closely related to the therapeutic efficacy of anti-PD-1.
[0080] 4.2. KLF12 / Galectin-1 mediated sensitivity to anti-PD-1 therapy
[0081] This invention further explored the effects of KLF12 and Galectin-1 expression on the efficacy of anti-PD-1 immunotherapy. The findings revealed that decreased KLF12 expression and increased Galectin-1 expression both led to CD8... + Reduced T cell infiltration at tumor sites was significantly correlated with PD-1 expression. Animal models were then used to verify whether alterations in KLF12 and Galectin-1 could affect the efficacy of anti-PD-1 therapy. First, wild-type B16-F10 and KLF12 cells were constructed. KO A B16-F10 mouse xenograft model was established. Tumor growth curves were observed after intraperitoneal injection of anti-PD-1. Results indicated that compared to wild-type mice, KLF12... KO The anti-PD-1 response was poor in the B16-F10 mouse melanoma model. Figure 20 A, left side). The mouse tumor volume reached 2000 mm². 3 Defined as death, KLF12 inoculation KO Mice with B16-F10 melanoma cells had a shorter overall survival than the control group, and the same phenomenon was observed after anti-PD-1 treatment. Figure 20A, right side). Further validation was performed in a mouse lung cancer model, showing that compared to tumors injected with control group LLC cells, those inoculated with KLF12... SH Mice with -LLC cells showed poorer response to anti-PD-1 treatment and faster tumor progression. Figure 20 B). The above results indicate that KLF12 knockout can reduce the sensitivity to anti-PD-1 therapy.
[0082] Based on these results, we hypothesized that inhibiting Galectin-1 in tumor tissue could enhance the efficacy of anti-PD-1 therapy. We further investigated whether combining Galectin-1 inhibitors and anti-PD-1 could achieve superior efficacy compared to monotherapy by reducing Galectin-1 expression in tumor tissue through intraperitoneal injection of Galectin-1 inhibitors. B16-F10 cells were subcutaneously inoculated into C57BL / 6J mice, and Galectin-1 inhibitors and anti-PD-1 were administered intraperitoneally (each drug administered every two days). The effect of combined treatment on B16-F10 cell tumor growth was observed. Five days after tumor cell inoculation, the long and short axes of the mouse tumors were measured every two days using calipers to dynamically monitor tumor volume changes. The combined treatment group (Galectin-1 inhibitor and anti-PD-1) showed slower tumor growth than the monotherapy group. In vivo imaging results indicated that the tumor size in the combined treatment group was smaller than that in the monotherapy group. Analysis of mouse survival revealed a significant increase in survival time in the combined Galectin-1 inhibitor and anti-PD-1 group. Figure 20 C). The same experiment was further validated in a mouse xenograft model of LLC lung cancer, and the results also showed that, compared with single-agent therapy, the combination of Galectin-1 inhibitor and anti-PD-1 could better control tumor growth, resulting in smaller tumor volume, slower tumor growth and progression, and prolonged overall survival. Figure 20 D). These results demonstrate that reducing Galectin-1 in tumor tissue can enhance the efficacy of anti-PD-1 therapy.
[0083] Based on the above experiments, it was found that targeting the KLF12 / Galectin-1 pathway can improve the therapeutic efficacy of anti-PD-1.
[0084] 4.3. KLF12 and Galectin-1 in tumor tissue are predictive molecules for the efficacy of anti-PD-1 therapy.
[0085] To further confirm the relationship between KLF12 and Galectin-1 and the efficacy of anti-PD-1 treatment, multiplex immunofluorescence staining analysis was performed on non-small cell lung cancer patients receiving anti-PD-1 treatment. The results showed that patients with high anti-PD-1 treatment response rates had higher expression levels of KLF12, CD8, and PD-1, while Galectin-1 expression was lower. Figure 21 A). Statistical analysis revealed that compared with patients in the anti-PD-1 ineffective group, the overall expression level of KLF12 in the response group was higher than that in the non-responder group, while the overall expression level of Galectin-1 in the response group was lower than that in the non-responder group. Figure 21 B). It was also found that patients with better anti-PD-1 response had higher levels of CD8 in their tumor microenvironment. + T cell infiltration and PD-1 expression ( Figure 21 A, B). To further validate the results, the above experiment was repeated in an esophageal cancer immunotherapy cohort. The results showed that patients with high KLF12 expression and low Galectin-1 expression had better overall efficacy with anti-PD-1 treatment. Figure 21 D, E). Correlation analysis results showed that in non-small cell lung cancer receiving anti-PD-1 therapy (D, E). Figure 21 C) and esophageal cancer ( Figure 21 In cohort F), KLF12 expression was negatively correlated with Galectin-1 expression and positively correlated with CD8 and PD-1; Galectin-1 expression was negatively correlated with CD8 and PD-1. These results suggest that KLF12 and Galectin-1 can serve as indicators for predicting the efficacy of anti-PD-1 therapy. High KLF12 expression indicates good anti-PD-1 treatment efficacy, while high Galectin-1 expression indicates poor anti-PD-1 efficacy.
Claims
1. The use of KLF12 or a KLF12 expression promoter in the preparation of a drug for inhibiting Galectin-1 expression; wherein the KLF12 expression promoter is a recombinant plasmid containing the KLF12 gene and capable of normally expressing the KLF12 protein; and the drug for inhibiting Galectin-1 expression is a drug for treating colorectal cancer.
2. The application according to claim 1, characterized in that, The drug used to inhibit Galectin-1 expression is an immune enhancer.
3. The application according to claim 2, characterized in that, The immune enhancer is used to increase CD8. + T cell infiltration, enhanced CD8 + T-cell immune function.
4. The application according to claim 1, characterized in that, The drug used to inhibit Galectin-1 expression is an adjuvant antitumor drug.
5. The application according to any one of claims 1 to 4, characterized in that: The KLF12 or KLF12 expression promoter can enter cells via one or more of the following methods: direct naked DNA injection, liposome-encapsulated DNA direct injection, gold-coated DNA gene gun bombardment, reproduction-deficient bacteria carrying plasmid DNA, replication-deficient adenovirus carrying target DNA, PEG-modified protein drug injection, liposome-encapsulated protein intravenous injection, and protein microsphere formulation subcutaneous injection.
6. The use of the combination of anti-PD-1 and OTX008 in the preparation of drugs for treating lung cancer.