A recombinant lactobacillus plantarum expressing anchoring eimeria tenella ron2 antigen and application thereof
By designing recombinant Lactobacillus plantarum that expresses the RON2 antigen of Eimeria tenella and using DCpep as an adjuvant, the shortcomings of existing anticoccidial drugs and vaccines have been overcome, and a safe and effective immune protection effect has been achieved.
Patent Information
- Application Number
- CN202310904846.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-21
- Publication Date
- 2026-03-17
- Estimated Expiration
- 2043-07-21
AI Technical Summary
Existing anticoccidial drugs lead to drug resistance and drug residue problems, and coccidiosis vaccines pose high costs and safety risks, necessitating the development of safe and effective coccidiosis vaccines.
A recombinant Lactobacillus plantarum was designed to express the RON2 antigen of Eimeria tenella var. tenderis, which is anchored to the antigen. The RON2 and DCpep genes were fused together, and DCpep was used as an adjuvant to stimulate an immune response through surface anchoring expression of the recombinant Lactobacillus plantarum.
It improved immunogenicity, enhanced the body's immune response, significantly increased the weight gain rate and anticoccidial index of chicks, and reduced oocyst excretion and cecal lesions.
Smart Images

Figure CN116948933B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of engineered microbial technology, specifically relating to a recombinant Lactobacillus plantarum expressing the RON2 antigen of Eimeria tenella, and the application of the recombinant Lactobacillus plantarum in the preparation of drugs for the prevention and treatment of coccidiosis in chickens. Background Technology
[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] Coccidiosis is a serious parasitic disease in poultry. Chicken coccidiosis (Avian coccidiosis) is an acute intestinal parasitic disease caused by infection with coccidia of the genus *Eimeria*. Chicken coccidia belong to the phylum Apicomplaxa, class Sporozoasida, order Euccidiasina, family Eimeriidae, and genus *Eimeria* in pathogenic classification. Of the thirteen species of chicken coccidia recorded globally, nine have been found in my country. The pathogenicity of coccidia varies depending on the species and the location of their parasitic location in the chicken intestine. *Eimeria tenella*, which primarily parasitizes the cecum, is the most pathogenic and causes the most severe damage.
[0004] Eimeria tenella is a member of the phylum Apicocytocomplexa, a group of obligate intracellular parasitic protozoa. Although different species of Apicocytocomplexa parasites inhabit different host species and cell types, they all share a common host cell invasion mechanism due to the presence of apicocytocomplex organ cells in the anterior part of their bodies that secrete proteins. This invasion process relies on the coordinated action of various specialized proteins secreted by the apicocytocomplex organ.
[0005] Invasion-related proteins are involved in the invasion process of Apicocomplex protozoa, and these proteins work together to mediate the adhesion and recognition of host cells by the protozoan. Among them, rod-shaped body proteins are important invasion proteins. Rod-shaped body neck proteins are located in the neck of the rod-shaped body, synthesized by the endoplasmic reticulum and Golgi apparatus, and then transported to the rod-shaped body for storage, subject to Ca2+ control. 2+Following signal stimulation, the proteins, including RON1 to RON8, are secreted extracellularly after being processed by proteases in the neck of the rod-shaped protozoan. Among these neck proteins, RON2 is particularly important. Only RON2 contains two transmembrane domains among the rod-shaped protozoan neck proteins involved in the formation of the motility contact ring (MJ). This is why RON2 can cross the host cell membrane and interact with apical membrane antigen-1 (AMA1), thereby mediating invasion of the host cell. Furthermore, the molecular mechanism of AMA1-RON2 interaction in the formation of the MJ structure in Acrocomplexa protozoa is conserved. Therefore, blocking the interaction between AMA1 and RON2, and thus blocking the formation of the MJ structure, could also be a pathway to inhibit the invasion of Acrocomplexa protozoa, suggesting that the rod-shaped protozoan neck protein RON2 may be a potential research direction for novel drugs or vaccines.
[0006] Prevention and control of Eimeria tenella coccidiosis mainly rely on anticoccidial drugs and live coccidial vaccines. However, the long-term use of anticoccidial drugs has led to the emergence of drug-resistant strains and drug residues in animal products, posing risks to human health and the environment. Coccidial vaccines can be an effective strategy for controlling coccidiosis in chickens, but live coccidial vaccines are expensive, difficult to store, and carry the risk of reversion and shedding of the virus. Therefore, developing safe and effective coccidial vaccines is crucial for the control of coccidiosis. Summary of the Invention
[0007] To address the shortcomings of existing technologies, this invention provides a recombinant *Lactobacillus plantarum* strain that targets dendritic cells with the *Eimeria tenella* RON2 antigen and its preliminary applications. This recombinant strain contains the RON2-DCpep fusion gene, exhibiting good immunogenicity. Furthermore, the recombinant *Lactobacillus plantarum* can anchor the *Eimeria tenella* fusion antigen onto its surface for expression. Immunization of animals with this strain demonstrates excellent immunogenicity, inducing activation of dendritic cells (DCs) in Peyer's lymph nodes, increasing T cell activity and secreting cytokines IFN-γ and IL-2, and promoting elevated levels of sIgA and IgG antibodies. Compared to commercially available vaccines, the recombinant *Lactobacillus plantarum* immunization group of chicks showed significantly increased weight gain and anticoccidial index, and significantly reduced oocyst expulsion and cecal lesions.
[0008] Based on the above-mentioned technical effects, the present invention provides the following technical solution:
[0009] In a first aspect, the present invention provides a recombinant Lactobacillus plantarum expressing the RON2 antigen of Eimeria tenella, wherein the recombinant Lactobacillus plantarum is modified to have RON2-Dcpep fusion protein expression activity compared with the wild type.
[0010] The fusion protein is composed of RON2 and Dcpep linked together, and the Dcpep sequence is shown in SEQ ID NO.1.
[0011] Existing research indicates that the rod-shaped body neck protein RON2 may possess coccidiosis antigen activity. This invention designs it as a vaccine antigen. In the above scheme, the RON2 refers to the extracellular region (aa. 1082–1402) of GenBank accession number XM_013375678C. To further enhance the immunogenic activity of the vaccine, this invention adds Dcpep as an adjuvant to RON2.
[0012] Dendritic cells (DCs) play a crucial role in taking up, processing, and presenting antigens to stimulate an immune response. DCs are a type of cell that matures with numerous dendritic processes, hence their name. Upon maturity, these cells can recognize, take up, and process exogenous antigens, presenting antigenic peptides to naive T cells, thereby inducing T cell activation and proliferation. They are the most potent antigen-presenting cells. DCs are the initiators of the body's adaptive immune response and also serve as a "bridge" connecting the innate and adaptive immune responses.
[0013] The inventors discovered that DCpep can effectively target dendritic cells, thereby inducing an immune response. Using DCpep as an adjuvant offers the advantage of a short sequence, solving the problem of tag expression and facilitating antigen preparation. Furthermore, DCpep, composed of only 12 amino acids, can specifically target and bind to dendritic cells (DCs), helping DCs recognize antigens and induce an immune response. Its short sequence also plays a crucial role in immune homeostasis. However, in some embodiments of this invention, the inventors found that the 12-amino acid composition of DCpep makes its spatial conformation easily altered, hindering the stable exertion of its advantages. The inventors investigated this issue to improve upon this newly discovered disadvantage. Ultimately, they discovered that using DCpep in tandem improves the situation, especially using three DCpep molecules in tandem. This avoids conformational changes while ensuring sufficient exposure, resulting in better action on DCs and, while leveraging its advantages, better assisting in stimulating a stronger immune response. Therefore, in some embodiments of the present invention where the effect is better, the fusion protein is composed of RON2 and three DCpep gene fragments (3×DCpep) tandemly, and its codon-optimized nucleotide sequence is shown in SEQ ID NO.2, and its amino acid sequence is shown in SEQ ID NO.3. In other embodiments, the nucleotide sequence further includes other sequences that can be translated into the RON2-Dcpep fusion protein based on codon degeneracy, or nucleotide sequences that can hybridize with the sequence shown in SEQ ID NO.2 under high stringency conditions.
[0014] This invention has verified the ability of the above-mentioned fusion protein as an antigen. The results show that RON2-DCpep has better immunogenicity than the antigen obtained by RON2 expression, and has higher compatibility with the endogenous metabolic flux of *Lactobacillus plantarum*, making it easier to express in recombinant *Lactobacillus plantarum*. Therefore, in the preferred embodiment of the first aspect described above, the specific example of the starting strain is *Lactobacillus plantarum* NC8.
[0015] Generally, recombinant exogenous proteins can be directionally transported using plasmid expression vectors. Based on the relative position of the protein and the host bacterium, the expression of recombinant exogenous proteins is classified in the art into intracellular secretory expression, extracellular secretory expression, and strain surface anchoring expression. This invention designs the above-mentioned recombinant *Lactobacillus plantarum* as a vaccine. To enhance the antigenicity of this engineered bacterium, this invention designs the above-mentioned fusion protein to be anchored and expressed on the surface of recombinant *Lactobacillus plantarum*. The anchoring group is polyglutamate synthase A (pgsA), derived from *Bacillus subtilis*, composed of 1143 nucleotides, encoding 381 amino acids. It is a membrane protein anchoring sequence with a transmembrane region at its N-terminus, creating conditions for its surface display. Furthermore, pgsA' (pgsA truncated to pgsA', its nucleotide sequence is shown in SEQ ID NO.4, and its amino acid sequence is shown in SEQ ID NO.5) serves as a single anchoring element on the surface, enabling the antigen to be anchored and stably expressed on the recipient bacterium surface.
[0016] Therefore, in another embodiment of the present invention with better effect, the RON2-Dcpep fusion protein in the recombinant Lactobacillus plantarum is fused with the above-mentioned anchoring element and expressed. The amino acid sequence of the fused polypeptide is shown in SEQ ID NO.6, that is, the recombinant Lactobacillus plantarum has the expression activity of the polypeptide shown in SEQ ID NO.6 compared with the wild type.
[0017] In addition, in the first aspect mentioned above, the "modification" of the recombinant Lactobacillus plantarum is carried out by constructing a recombinant plasmid, such as the pSIP409-pgsA' plasmid. At the same time, the RON2-DCpep fusion gene also contains a promoter, a terminator, and a restriction enzyme site gene sequence, wherein the restriction enzyme sites are XbaI (TCTAGA) and HindIII (AAGCTT).
[0018] Secondly, the application of the recombinant Lactobacillus plantarum described in the first aspect in the preparation of drugs for the prevention and treatment of coccidiosis in chickens is provided.
[0019] In one embodiment where the effect is better, the drug for preventing coccidiosis in chickens is a vaccine, and more preferably, an oral vaccine.
[0020] Thirdly, an oral vaccine is provided, wherein the vaccine uses the recombinant Lactobacillus plantarum described in the first aspect as an antigen.
[0021] The aforementioned oral vaccines also include pharmaceutically essential excipients, such as solvents, solubilizers, suspending agents, isotonic agents, buffers, soothing agents, preservatives, antioxidants, colorants, sweeteners, or other formulation additives. Because the recombinant *Lactobacillus plantarum* exhibits superior acid and bile salt resistance compared to the wild type, this effectively reduces the technological complexity of vaccine preparation, broadens the range of excipients to choose from, and provides better intestinal adhesion.
[0022] Fourthly, the application of the recombinant Lactobacillus plantarum described in the first aspect in the preparation of poultry feed is provided.
[0023] The poultry include chickens, ducks, or geese, and the feed should contain edible substances necessary for animal growth, such as carbohydrates, lipids, amino acids, trace elements, feed additives, and vitamins.
[0024] Fifthly, the recombinant Lactobacillus plantarum described in the first aspect and the oral vaccine described in the third aspect are provided for use in any of the following aspects:
[0025] (1) Activating the body's immune cells and / or preparing products that activate the body's immune cells;
[0026] (2) Activating Pain's lymph node DCs and / or preparing products that activate Pain's lymph node DCs;
[0027] (3) Stimulating the production of specific cytokines, T cells, and B cells in the spleen and / or mesenteric lymph nodes and / or preparing products that stimulate cytokines in the spleen, mesenteric lymph nodes, and / or Peyer's lymph nodes; said cytokines, T lymphocytes, CD4 + CD8 + , IFN-γ, IL-2, IgG, SIgA.
[0028] The beneficial effects of one or more of the above technical solutions are as follows:
[0029] The recombinant *Lactobacillus plantarum* provided by this invention has the ability to express the RON2-Dcpep fusion protein. This fusion protein exhibits significantly enhanced antigenic activity compared to RON2, and its expression level in the recombinant strain is also increased. Furthermore, this invention adds an anchoring element to the fusion protein, enabling it to be anchored and expressed on the surface of the recombinant *Lactobacillus plantarum*.
[0030] In addition, immunization of animals can induce the activation of dendritic cells (DCs) in Pain's lymph nodes, induce the increase of T cells and secretion of cytokines IFN-γ and IL-2, and promote the increase of sIgA and IgG antibody levels. Compared with commercially available vaccines, the weight gain rate and anticoccidial index of chicks immunized with this recombinant Lactobacillus plantarum were significantly increased, and the amount of oocysts excreted and cecal lesions were significantly reduced. Attached Figure Description
[0031] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0032] Figure 1 The target gene fragment was obtained by double enzyme digestion in Example 1;
[0033] Figure 2 The results of PCR amplification of the target gene in Example 1;
[0034] Figure 3 This refers to the gel recovery of the double-enzyme digested vector product in Example 1;
[0035] Figure 4 Double enzyme digestion verification of recombinant plasmid pSIP409-pgsA'-RON2 in Example 1; M: DL10,000 DNA Marker; 1: single enzyme digestion of pSIP409-pgsA'-RON2; 2: double enzyme digestion verification of pSIP409-pgsA'-RON2;
[0036] Figure 5 Double enzyme digestion verification of recombinant plasmid pSIP409-pgsA'-RON2-DCpep in Example 1; M: DL10,000 DNA Marker; 1: Double enzyme digestion verification of pSIP409-pgsA'-RON2-DCpep; 2: Single enzyme digestion of pSIP409-pgsA'-RON2-DCpep;
[0037] Figure 6 The plasmid pattern of pSIP409-pgsA'-RON2 in Example 1;
[0038] Figure 7 The plasmid map of pSIP409-pgsA'-RON2-DCpep in Example 1;
[0039] Figure 8 This is a growth curve of the strain in Example 1;
[0040] Figure 9 Western blot analysis of pSIP409-pgsA'-RON2 protein obtained by ultrasonic disruption in Example 1 in recombinant Lactobacillus plantarum; M: protein marker; 1: pSIP409-pgsA'; 2: expression product of pSIP409-pgsA'-RON2;
[0041] Figure 10Western blot detection of pSIP409-pgsA'-RON2-DCpep protein obtained by ultrasonic disruption in Example 1 in recombinant Lactobacillus plantarum; M: protein marker; 1: pSIP409-pgsA'; 2: expression product of pSIP409-pgsA'-RON2-DCpep;
[0042] Figure 11 The results are from the flow cytometry analysis in Example 2.
[0043] Figure 12 The results of lymphocyte proliferation in the spleen in Example 2;
[0044] Figure 13 The changes in serum IFN-γ levels are shown in Example 2.
[0045] Figure 14 The change in serum IL-2 cytokine levels in Example 2;
[0046] Figure 15 This refers to the changes in serum IgG antibody levels in Example 2;
[0047] Figure 16 The change in SIgA antibody levels in the intestinal lavage fluid in Example 2;
[0048] Figure 17 The change in body weight of chicks after parasite treatment in Example 2;
[0049] Figure 18 This refers to the amount of oocysts expelled in Example 2;
[0050] Figure 19 The cecal lesion score in Example 2;
[0051] Figure 20 This describes the cecal lesions after worm attack in Example 2.
[0052] Figure 21 This is a pathological section of cecal tissue from Example 2;
[0053] In the above figures, * indicates P < 0.05; ** indicates P < 0.01; *** indicates P < 0.001; **** indicates P < 0.0001. Detailed Implementation
[0054] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0055] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.
[0056] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0057] Example 1: Construction and Validation of Recombinant Lactobacillus Plantarum Targeting Dendritic Cells with Surface Anchored Eimeria tenella RON2 Antigen
[0058] Studies on *Eimeria tenella* have revealed that RON2 is an important invasive functional protein in the parasite. In this study, RON2 was selected as the protective antigen. *Lactobacillus plantarum* strain NC8 was used as the initial strain, pSIP409 was used as the vector to express the protective antigen, and DCpep was used as an adjuvant to construct recombinant *Lactobacillus plantarum* strains NC8-pSIP409-pgsA'-RON2-DCpep and NC8-pSIP409-pgsA'-RON2. Western blot analysis was used to detect the expression of the target protein, and its immunoprotective effect against *Eimeria tenella* infection was evaluated.
[0059] 1. Materials and Methods
[0060] Strains and plasmids: BL21, DH5α, pSIP409-pgsA' plasmid, and Lactobacillus plantarum (L. plantarum) NC8 were constructed and preserved by the laboratory of Jilin Provincial Engineering Research Center for Animal Microecological Preparations.
[0061] Enzymes and main reagents: Restriction endonucleases (XbaI, HindIII, EcoRI), T4 DNA ligase, DNA Marker (DL-2000, DL-5000, DL-10000), Prime STAR Max Premix (2×), and SDS PAGE Loading Buffer (5×) were purchased from TaKaRa Ltd.; Common plasmid miniprep kit, DNA purification and recovery kit, DNA gel recovery kit, HRP-labeled goat anti-mouse IgG secondary antibody, and His-tagged protein purification kit were purchased from Beijing Kangwei Century Co., Ltd.; Erythromycin, kanamycin, and lysozyme were purchased from Beijing Solarbio Technology Co., Ltd.; and the Bradford protein concentration assay kit was purchased from Beyotime Biotechnology Co., Ltd.
[0062] The main instruments and equipment used in the experiment were: gradient PCR instrument (Leica); gel imaging analysis system (Universal Hood II); refrigerated metal bath (TANGEN); biochemical incubator HERACELL240i (Thermo Scientific); electrophoresis apparatus (BIO-RAD); analytical balance ME204E (Mettler Toledo); and electroporation apparatus (Gene Pulser Xcell™ System).
[0063] 1.1 Test Methods
[0064] Construction and identification of recombinant Lactobacillus plantarum:
[0065] Synthesis of the target gene RON2-DCpep:
[0066] manual
[0067] RON2 gene sequence: RON2 is the extracellular region (aa.1082~1402) of GenBank accession number XM_013375678C. The RON2 sequence is tandemly linked with 3 DCpep to form the target fragment and ligated into the pUC-57 vector.
[0068] Note: XbaI restriction site gene sequence: TCTAGA; HindIII restriction site gene sequence: AAGCTT; DCpep gene sequence: TTTATCCATCATATCATTCAACTCCACAACG TCCA (SEQ ID NO.1). The 3×DCpep gene sequence is shown in SEQ ID NO.7.
[0069] Primer design:
[0070] To obtain the RON2 fragment from the pUC-57-RON2-DCpep plasmid, primers RON2-F and RON2-R were designed, with the following sequences:
[0071] RON2-F:5'-GCTCTAGAATGAGGAGCGCCGGCTTCC-3' (SEQ ID NO.8);
[0072] RON2-R: 5'-CCAAGCTTTTAATGGTGATGGTGATGATGGAAATCT-3' (SEQ ID NO. 9).
[0073] Construction of the pSIP409-pgsA'-RON2 recombinant plasmid:
[0074] Obtaining the RON2 target fragment:
[0075] The pUC57-RON2-DCpep plasmid was double-digested with enzymes, and the RON2-DCpep fragment was recovered using a gel extraction kit according to the kit's instructions. Using RON2-DCpep as a template, PCR amplification of the target gene RON2 was performed. The PCR system is as follows:
[0076] Table 1 Enzyme digestion system
[0077]
[0078] Table 2 PCR System
[0079]
[0080] The PCR amplification conditions are as follows:
[0081] Pre-denaturation at 95℃ for 3 min, denaturation at 95℃ for 30 s, annealing at 65℃ for 30 s, extension at 72℃ for 30 s, 35 cycles, extension at 72℃ for 5 min, storage at 4℃. Purify the PCR amplification product.
[0082] After purification, 2 μL of the sample was taken out for 1% agarose gel electrophoresis.
[0083] Acquisition of the carrier:
[0084] The pSIP409-pgsA' gene was double-digested at the same restriction site as the target gene. The digestion system is as follows:
[0085] Table 3 Enzyme digestion system
[0086]
[0087]
[0088] After overnight enzyme digestion at 37°C, gel recovery was performed according to the kit instructions.
[0089] Target fragment and vector ligation:
[0090] RON2-DCpep and RON2 fragments are linked to the pSIP409-pgsA' vector;
[0091] The recovered product was ligated to a vector using T4 DNA ligase. The ligation system is as follows:
[0092] Table 4 Connection Reaction System
[0093]
[0094] The connection condition is overnight at 16°C.
[0095] pSIP409-pgsA' and pSIP409-pgsA'-RON2 recombinant plasmids were transformed into DH5α competent cells:
[0096] The recombinant plasmids pSIP409-pgsA'-RON2-DCpep and pSIP409-pgsA'-RON2 were transformed into DH5α competent cells using conventional transformation methods.
[0097] a. Take 50 μL of competent cells thawed on an ice bath, add the target DNA, mix gently, and place in an ice bath for 30 minutes;
[0098] b. Heat shock the centrifuge tube in a 42°C water bath for 45 seconds, then quickly transfer the EP tube to an ice bath for 3 minutes. Do not shake the centrifuge tube during this process.
[0099] c. Add 700 μL of LB medium to each centrifuge tube, mix well, and incubate at 37°C and 200 rpm for 12 hours to allow the bacteria to recover.
[0100] d. Add 100 μL of transformed competent cells to LB agar medium containing erythromycin and spread the cells evenly. Incubate the plate at 37°C until the liquid is absorbed, then invert the plate and incubate overnight at 37°C.
[0101] Enzyme digestion identification of pSIP409-pgsA'-RON2-DCpep and pSIP409-pgsA'-RON2 recombinant plasmids:
[0102] Pick a single colony and incubate it overnight at 37°C in 5 mL LB liquid medium. Transfer 200 μL of 80% glycerol and 800 μL of bacterial culture to a cryovial, mix well, and store the culture at -80°C. Extract plasmids from the remaining fresh bacterial culture and perform double enzyme digestion for identification. The enzyme digestion system is as follows:
[0103] Table 5 Enzyme digestion system
[0104]
[0105] After enzyme digestion at 37℃ overnight, agarose gel electrophoresis was performed to identify the band size.
[0106] Plasmid sequencing: After enzyme digestion and PCR identification, the plasmid was sequenced (Jilin Kumei Biotechnology Co., Ltd.).
[0107] Recombinant plasmid transformed into NC8 competent cells:
[0108] NC8 competent state production:
[0109] After thawing and subculturing the frozen NC8 bacteria, a bacterial suspension with an OD600 between 0.2 and 0.3 was obtained. The suspension was washed twice with washing buffer (34.21 g sucrose, 0.029 g MgCl2, 100 mL ddH2O, pH adjusted to 7.4), centrifuged at 5000 rpm for 10 min at 4 °C, and the supernatant was discarded. The precipitate was resuspended in electroporation buffer (0.19 g Na3PO4, 0.009 g MgCl2, 100 mL ddH2O, pH adjusted to 7.4), and then aliquoted into 100 μL tubes and stored at -80 °C.
[0110] Transformation of recombinant plasmids: The constructed plasmids were transformed into NC8 via electroporation. The conditions were as follows:
[0111] 2000V, 400Ω, 25μF.
[0112] Expression and identification of recombinant Lactobacillus plantarum:
[0113] First, the culture conditions for *Lactobacillus plantarum* were optimized, and the growth curve was determined: frozen bacterial culture was thawed and subcultured at 30°C under anaerobic conditions. OD600 was measured at 2 mL intervals of 1 hour. When the OD600 value was around 0.3, induced SPPIP (12.5 μL / 5 mL) was added. Furthermore, the immunization dose of the two recombinant *Lactobacillus plantarum* strains was calculated using plate counting (the optimal number of *Lactobacillus plantarum* strains fed was 0.5 × 10⁻⁶). 9 ~1×10 9 CFU).
[0114] To detect the protein expression of the two constructed recombinant Lactobacillus plantarum strains NC8-pSIP409-pgsA'-RON2-DCpep and NC8-pSIP409-pgsA'-RON2, recombinant bacterial proteins were extracted using ultrasonic disruption and Western blot validation. Diluted His and Flag antibodies were used as primary antibodies (1:3000), and HRP-labeled goat anti-mouse IgG was used as secondary antibodies.
[0115] 1.2 Results
[0116] Target gene synthesis results: The constructed target gene RON2-DCpep is 1104 bp in size, as shown below. Figure 1 As shown.
[0117] RON2 target gene fragment acquisition results: The RON2 target fragment was obtained by PCR. The target gene fragment was visible at 996 bp. The PCR amplification results of the RON2 gene are as follows: Figure 2 As shown.
[0118] The vector was double-digested with enzymes, and a vector band was visible at 8742 bp, as shown below. Figure 3 As shown.
[0119] Enzyme digestion identification results: Double digestion of the recombinant plasmid pSIP409-pgsA'-RON2 confirmed clear bands at 996bp and 8742bp. Figure 4 Double digestion of the recombinant plasmid pSIP409-pgsA'-RON2-DCpep confirmed the presence of clear bands at 1104 bp and 8742 bp. Figure 5 This indicates that the target gene fragment has been successfully ligated into the target vector.
[0120] Plasmid sequencing: The plasmid sequencing results were correct. Plasmid maps of pSIP409-pgsA'-RON2 and pSIP409-pgsA'-RON2-DCpep were generated using SnapGene software, as shown below. Figure 6 , Figure 7 .
[0121] Expression and identification results of recombinant Lactobacillus plantarum:
[0122] Optimization of culture conditions for recombinant Lactobacillus plantarum: After three culture cycles and measurement of OD600, the growth curves (24h) of NC8-pSIP409-pgsA', NC8-pSIP409-pgsA'-RON2, and NC8-pSIP409-pgsA'-RON2-DCpep were plotted using GraphPad Prism software. (See attached image) Figure 8 The optimal induction time is 4 hours after bacterial culture transfer. Based on the results of three colony droplet counts, the 10th hour (6 hours after induction) was selected as the feeding time point. 0.2 mL of NC8-pSIP409-pgsA', 0.22 mL of NC8-pSIP409-pgsA'-RON2-DCpep, and 0.25 mL of NC8Δ-pSIP409-pgsA'-RON2 bacterial cultures contained 1×10⁻⁶ cells / mL. 9 CFU.
[0123] Western blot analysis of fusion protein expression results: Western blot analysis was performed to assess the reactivity of the recombinant *Lactobacillus plantarum*. Based on the amino acid sequence, the expected molecular weight of NC8-pSIP409-pgsA'-RON2 was approximately 44 kDa, and the expected molecular weight of NC8-pSIP409-pgsA'-RON2-DCpep was approximately 48 kDa. After sonication and disruption of the induced recombinant *Lactobacillus plantarum*, clear protein bands were observed at 44 kDa and 48 kDa. Figure 9 , Figure 10 The protein size is as expected, indicating that both recombinant Lactobacillus plantarum strains can express the corresponding protein.
[0124] 1.4 Summary
[0125] In this embodiment, recombinant Lactobacillus plantarum NC8-pSIP409-pgsA'-RON2-DCpep and NC8-pSIP409-pgsA'-RON2 expressing RON2-DCpep and RON2 were successfully constructed.
[0126] Example 2: Study on the Immunological Effect of Recombinant Lactobacillus plantarum
[0127] Recombinant Lactobacillus plantarum vaccines have advantages such as low cost, ease of large-scale production, and the ability to colonize the gut for a long time, exerting a sustained effect. Furthermore, Lactobacillus plantarum itself is a probiotic, capable of enhancing immunity and promoting mucosal immunity. The oral administration method further facilitates administration. Therefore, recombinant Lactobacillus plantarum vaccines have broad development prospects.
[0128] Lactobacillus plantarum can serve as an antigen delivery carrier and possesses natural adjuvant activity, regulating intestinal flora and promoting intestinal absorption while inducing mucosal and systemic immunity. Therefore, the recombinant Lactobacillus plantarum NC8-pSIP409-pgsA'-RON2-DCpep and NC8-pSIP409-pgsA'-RON2 successfully constructed in Example 1 were orally immunized into chicks, and the levels of SIgA in the intestines, IgG in the serum, and the levels of cytokines IFN-γ and IL-2 were detected; CD4+ in splenic lymphocytes were also detected. + CD8 + Indicators such as T cell levels were analyzed to assess the immunomodulatory capacity of recombinant *Lactobacillus plantarum* against chicken Eimeria tenella sporulated oocysts. Furthermore, after oral administration of sporulated oocysts of *Eimeria tenella* to chicks, indicators such as weight gain rate, oocyst excretion, and cecal lesion score were statistically analyzed, and the anticoccidial index (ACI) was calculated to evaluate the immunoprotective effect of recombinant *Lactobacillus plantarum* against *Eimeria tenella* in chickens.
[0129] 2.1 Materials and Methods
[0130] Test strains: NC8-pSIP409-pgsA'-RON2 recombinant Lactobacillus plantarum, NC8-pSIP409-pgsA'-RON2-DCpep recombinant Lactobacillus plantarum, and NC8-pSIP409-pgsA' empty vector Lactobacillus plantarum. The recombinant Lactobacillus plantarum was constructed according to the method in Example 1.
[0131] Sporulated oocysts of Eimeria tenella were preserved in 2.5% K2Cr2O7 at 4°C by the Jilin Provincial Engineering Research Center for Animal Microecological Preparations.
[0132] Experimental animals: One-day-old broiler chickens were purchased from Changchun Northern Breeding Farm. Animal housing was cleaned using formaldehyde fumigation to remove or kill harmful microorganisms in the environment. Feed troughs and water troughs were sterilized by dry heat to strictly ensure no coccidiosis contamination. The cages were sterile metal cages sterilized by formaldehyde fumigation and free of parasite eggs. Drinking water was distilled water sterilized at high temperatures. Feed was strictly controlled to be free of anticoccidial agents and any antibiotics.
[0133] Test reagents: Chicken spleen lymphocyte separation kit and CCK-8 cell proliferation kit were purchased from Beijing Solarbio Technology Co., Ltd.; Cytokine (IFN-γ, IL-2) ELISA kit was purchased from Jiangsu Kete Biotechnology Co., Ltd.; Mouse anti Chicken CD4-PE, CD3-FITC, and CD8-APC antibodies were purchased from BD Bioscience; Chicken coccidiosis trivalent live vaccine (DLV vaccine) was purchased from Xi'an Skyda Biological Products Co., Ltd.
[0134] Experimental instruments: The main instruments are the same as in Example 1.
[0135] Grouping and immunization protocols for laboratory animals:
[0136] Immunization Grouping: Healthy 1-day-old chicks were divided into 6 groups of 20 chicks each, totaling 120 chicks. From day 1, they were strictly fed daily pelleted feed free of antibiotics and anticoccidial drugs, and provided with sterilized distilled water. At 3 days of age, chicks with similar individual differences were selected and grouped into 6 groups of 20 chicks each. Leg bands were used to label the chicks, and the group and individual number were marked on the leg bands. The specific grouping and immunization schedule are as follows:
[0137] Table 6 Grouping and Immunization Schedule
[0138]
[0139]
[0140] Immunization schedule: Primary immunization is performed on days 3-5, and booster immunization is performed on days 17-19. Chicks are observed after booster immunization, and the immunization effect is evaluated on day 29 by flow cytometry analysis of CD4+ in spleen lymphocytes. + and CD8 + Cell count was determined using ELISA to detect the content and levels of SIgA in intestinal contents, IgG, IFN-γ, and IL-2 in serum.
[0141] Flow cytometry: Detecting CD4+ in spleen lymphocytes using flow cytometry. + CD8 + T lymphocyte count. Before the challenge, five chickens were randomly selected from each group, and their spleens were harvested. The spleens were ground into a single-cell suspension using a copper mesh in a clean bench. Lymphocytes were isolated according to the instructions of the chicken spleen lymphocyte separation kit and counted. 1×10⁻⁶ cells were taken from each sample. 6 Single cell using CD3 + CD4 + CD8 + Antibodies were co-incubated with samples and treated with single-labeled samples. After incubation at 4°C in the dark for 30 min, the samples were washed twice with PBS. Flow cytometry analysis was performed, and experimental data were analyzed using FlowJo 7.6.1.
[0142] Detecting the proliferation of splenic lymphocytes:
[0143] The proliferative capacity of spleen lymphocytes was detected using the CCK-8 assay before and after insecticidal challenge.
[0144] In a clean bench, the spleen was ground into a single-cell suspension using a copper mesh; lymphocytes were isolated according to the instructions of the chicken spleen lymphocyte separation kit; the cells were resuspended in RPMI 1640 medium (10% FBS, 1% penicillin-dextrose antibody) and counted; based on the counting results, 5 × 10⁶ cells were seeded per well for each chicken. 5 Cells were placed in 96-well plates and stimulated with RON2 protein (2 μg / well) as described in Example 1. The cells were cultured in a cell culture incubator for 45 h. 10 μL of CCK-8 was added to each well. After 3 h of reaction, the cells were detected by an ELISA reader and the stimulation index (SI) was calculated. SI = (experimental group - blank group) / (control group - blank group).
[0145] ELISA detection of SIgA levels in intestinal lavage fluid:
[0146] Five chickens were randomly selected from each group. A segment of duodenum was harvested, the intestinal tract was cut open, and the intestinal wall was scraped using a glass slide. The scraped material was placed in PBS containing PMSF and centrifuged at 4000 rpm for 15 min. The supernatant was retained and stored at -80℃ for later use. SIgA levels were detected using an ELISA kit. See the instruction manual for detailed procedures.
[0147] Detection of cytokine IFN-γ and IL-2 levels and IgG levels:
[0148] To detect the levels of cytokines IFN-γ, IL-2, and IgG antibodies in experimental chickens, blood was collected from the heart of the chickens and placed in EP tubes. After incubating at 37°C for 2 hours, the serum was separated by centrifugation (4000 rpm, 15 min) and stored at -80°C. The detection procedures for IFN-γ, IL-2, and IgG antibodies were performed according to the ELISA kit instructions.
[0149] Immune protection index testing
[0150] Weight measurement:
[0151] After the parasite was introduced, the weight of each experimental animal was measured and recorded daily according to the group. When weighing and feeding, care was taken to ensure that the PBS control group was absolutely free of coccidia infection.
[0152] Average weight gain = body weight at sacrifice - body weight at the time of insect attack;
[0153] Weight gain rate (%) = (body weight at euthanasia - body weight at insect attack) / body weight at insect attack × 100%;
[0154] Relative weight gain rate (%) = Average weight gain of experimental group / Average weight gain of PBS group × 100%.
[0155] Oocyte expulsion volume detection:
[0156] On the 7th day after insect invasion, feces were collected according to groups. 2g of the collected feces from each group was placed in a clean mortar, and 58mL of fully saturated saline was added. After the feces and saline were mixed evenly, the sample was taken and placed in the counting chamber of the counting plate. After standing for 2-3 minutes, the oocysts were counted using a microscope. The calculation of the oocyst value is shown in Table 7.
[0157] Table 7 Calculation of Oocyte Count
[0158]
[0159] Oocyst ratio (%) = Number of oocysts in the experimental group / Number of oocysts in the challenge group × 100%.
[0160] Intestinal lesion score:
[0161] After the parasite treatment, five chickens were randomly euthanized in each group, and their cecums were removed according to their corresponding numbers. The lesions of each chicken were observed and scored. The specific scoring criteria are shown in Table 8.
[0162] Table 8. Lesion Scoring Criteria
[0163]
[0164] H&E staining for intestinal pathological changes:
[0165] Seven days after worm introduction, experimental chickens were sacrificed, and the middle section of the cecum was collected and fixed in 4% formaldehyde solution for at least 48 hours. After trimming both ends, the cecum was embedded in paraffin and stained with Hexagonal and Escherichia coli (H&E). The steps are as follows:
[0166] Dehydration: Gradient alcohol dehydration was used, with dehydration time determined according to the size of the tissue block. Dehydration was carried out sequentially at 70%, 80%, 85%, 90%, 95% I and 95% II, and 100% I and 100% II.
[0167] Clearing: After draining the alcohol, place in xylene for 8 minutes to clear until it looks like cooked pork skin to the naked eye. The clearing time should be determined according to the size of the tissue.
[0168] Paraffin infiltration and embedding: The tissues were placed in paraffin I, paraffin II and paraffin III respectively, and infiltrated in paraffin at 55°C for 40 min. Then the tissue blocks were placed in an embedding cassette for embedding.
[0169] Sectioning, spreading, baking and staining: Tissue sections with a thickness of 3μm were cut from each embedded block, spread at 41℃, and then the slides were baked at 80℃ for 1 hour before H&E staining.
[0170] After mounting, the pathological sections were observed under a microscope.
[0171] Anticoccidial Index (ACI) Calculation
[0172] ACI = Survival rate + Relative weight gain rate - (Oocyte value + Lesion value), and the evaluation criteria are shown in Table 9.
[0173] Table 9 ACI Evaluation Criteria
[0174]
[0175] 2.2 Results
[0176] Flow cytometry detection:
[0177] CD4+ cells in spleen lymphocytes after oral administration of recombinant Lactobacillus plantarum + CD8 + The proportion of T cells increased;
[0178] Following the secondary immunization, lymphocytes were isolated using a chicken spleen lymphocyte separation kit. The isolated lymphocytes were then analyzed by flow cytometry. After incubation with CD3, CD4, and CD8 antibodies, the differentiation of T lymphocyte populations in the chicken spleen lymphocytes was determined. The results are as follows: Figure 11 As shown; CD4+ in lymphocytes of the RON2-DCpep group and RON2 group compared with the PBS group and Vector group. +The proportions of CD8+ cells in both the RON2-DCpep group and the RON2 group were significantly higher than those in the PBS group (P<0.001); compared with the PBS group, the proportions of CD8+ cells in the lymphocytes of both the RON2-DCpep group and the RON2 group were significantly higher. + The proportion also increased significantly (P<0.001), and the RON2-DCpep group was significantly higher than the RON2 group (P<0.01).
[0179] Results of lymphocyte proliferation in the spleen:
[0180] Oral administration of recombinant Lactobacillus plantarum enhances the proliferative capacity of splenic lymphocytes.
[0181] The proliferative capacity of splenic lymphocytes stimulated by RON2 protein was detected using the CCK-8 assay, and the corresponding stimulation index SI was calculated (SI = (experimental group - blank group) / (control group - blank group)). The results are as follows: Figure 12 As shown, after oral immunization with recombinant Lactobacillus plantarum NC8-pSIP-409-pgsA'-RON2-DCpep and NC8-pSIP-409-pgsA'-RON2, the specific proliferation capacity of spleen lymphocytes after RON2 protein stimulation was significantly higher in the RON2-DCpep group and the RON2 group than in the Challenge group (P<0.001).
[0182] Serum IFN-γ levels increased after oral administration of recombinant Lactobacillus plantarum.
[0183] Following immunization, the serum IFN-γ levels of orally immunized recombinant Lactobacillus plantarum NC8-pSIP-409-pgsA'-RON2-DCpep and NC8-pSIP-409-pgsA'-RON2 were measured before and after challenge. ELISA results are shown below. Figure 13 As shown, after immunization, the expression levels of RON2-DCpep group and RON2 group were significantly higher than those of Challenge group and Vector group (P<0.001); after challenge, the IFN-γ levels of the two recombinant Lactobacillus plantarum groups were still significantly higher than those of Challenge group and Vector group (P<0.001), and significantly higher than those of Vaccine group (P<0.001), with the highest level in RON2-DCpep group.
[0184] Serum IL-2 levels increased after oral administration of recombinant Lactobacillus plantarum.
[0185] The regulatory effect of recombinant *Lactobacillus plantarum* on serum IL-2 before and after insect challenge was detected by ELISA. Before insect challenge, the IL-2 level in the immunized recombinant *Lactobacillus plantarum* group was significantly higher than that in the Challenge group (P<0.001), but significantly lower than that in the Vaccine group (P<0.001). After insect challenge, the overall IL-2 level increased, with a significant increase in the RON2-DCpep group, which was significantly higher than that in the Challenge and Vector groups (P<0.001), but not different from that in the Vaccine group. The results are shown in [Figure number missing]. Figure 14 .
[0186] Serum IgG levels increased after oral administration of recombinant Lactobacillus plantarum.
[0187] After two immunizations, the IgG levels in chicken serum before and after parasite challenge were measured in each group. The results are as follows: Figure 15 As shown, before the challenge, the serum IgG levels in the recombinant Lactobacillus plantarum RON2-DCpep group and RON2 group were higher than those in the Challenge group (P<0.001); after the challenge, the RON2-DCpep group and
[0188] Serum IgG levels were elevated in the RON2 group, significantly higher than in the Challenge group (P<0.001).
[0189] Increased SIgA levels in intestinal lavage fluid following oral administration of recombinant Lactobacillus plantarum:
[0190] SIgA levels in each group before and after insect challenge were detected using ELISA. Results are as follows: Figure 16 As shown, the SIgA levels in the intestinal lavage fluid of the RON2-DCpep group and the RON2 group before and after challenge were significantly higher than those in the Challenge group (P<0.001), and the SIgA levels in the RON2-DCpep group and the RON2 group after challenge were significantly higher than those in the vaccine group (P<0.001).
[0191] Average weight gain increased after oral administration of recombinant lactobacillus plantarum:
[0192] The effects of oral administration of recombinant *Lactobacillus plantarum* NC8-pSIP-409-pgsA'RON2-DCpep and NC8-pSIP-409-pgsA'-RON2 on the body weight of experimental animals after challenge were investigated. Chick weights were recorded daily at the same time according to grouping and numbering, and average and relative weight gains were calculated. The results are shown in Table 10, and the growth trend is as follows. Figure 17As shown, the results indicated that the weight gain rate in the RON2-DCpep group was significantly higher than that in the Challenge group (P<0.001), and also higher than that in the Vaccine group. The weight gain rate in the RON2 group was slightly lower than that in the RON2-DCpep group, but still higher than that in the Challenge, Vector, and Vaccine groups. Overall, the weight gain in the RON2-DCpep and RON2 groups after immunization was significantly higher than that in the Challenge group (P<0.001), with the relative weight gain rate in the RON2-DCpep group reaching as high as 93.89% and the relative weight gain rate in the RON2 group reaching as high as 93.49%.
[0193] Table 10 Weight Changes
[0194]
[0195] The amount of oocysts excreted decreased after oral administration of recombinant Lactobacillus plantarum.
[0196] To investigate the effect of oral immunization with recombinant *Lactobacillus plantarum* NC8-pSIP-409-pgsA'-RON2-DCpep and NC8-pSIP-409-pgsA'-RON2 on the amount of oocysts expelled after challenge. (Table 11...) Figure 18 It can be seen that the number of oocytes released in the RON2-DCpep group and the RON2 group was significantly reduced. The oocyte reduction rate in the RON2-DCpep group was the highest at 60.61%, which was significantly higher than that in the Challenge group and the Vaccine group (P<0.001, P<0.01). The oocyte reduction rate in the RON2 group was 54.33%, which was also significantly higher than that in the Challenge group and the Vaccine group (P<0.001, P<0.5).
[0197] Table 11 Oocyte Expulsion Amount
[0198]
[0199]
[0200] Cecal lesions were reduced after oral administration of recombinant Lactobacillus plantarum.
[0201] To investigate the effects of oral immunization with recombinant Lactobacillus plantarum NC8-pSIP-409-pgsA'-RON2-DCpep and NC8-pSIP-409-pgsA'-RON2 on cecal lesions, experimental animals were sacrificed on day 7 post-infection. Five chickens from each group were randomly selected, and their cecums were harvested. Intestinal pathological changes were carefully observed, and lesion scores were assigned according to Table 8. The scoring results are shown in Table 12. The RON2-DCpep and RON2 groups had the lowest lesion values, the Challenge group had the most severe cecal lesions, followed by the Vector group. Figure 19The results showed that the recombinant Lactobacillus plantarum effectively reduced cecal lesions. The RON2-DCpep group and the RON2 group showed a significant reduction in cecal lesions, which was significantly lower than that in the Challenge and Vector groups (P<0.05).
[0202] Table 12 Cecal Lesion Scoring
[0203]
[0204] Comparative results of intestinal lesions showed that oral administration of recombinant lactobacillus plantarum reduced cecal lesions:
[0205] like Figure 20 As shown, compared with the blank control PBS group, obvious bleeding points could be observed in the intestinal wall of the Challenge group and Vector group, and the overall degeneration and shortening of the cecum were severe; the cecum lesions were reduced after anthelmintic treatment in the RON2-DCpep group, and no obvious pathological changes were observed in the intestinal wall, and no obvious lesions were observed in the cecum; the intestinal lesions were also reduced after anthelmintic treatment in the RON2 group, but a small number of bleeding points were present; the intestinal lesions in the Vaccine group were relatively mild, but mild atrophy was also observed, and a small number of bleeding points were present in the intestinal wall.
[0206] Histopathological results of cecal tissue sections showed that oral administration of recombinant lactobacillus plantarum reduced cecal lesions.
[0207] To investigate the effects of oral immunization with recombinant *Lactobacillus plantarum* NC8-pSIP-409-pgsA'-RON2-DCpep and NC8-pSIP-409-pgsA'-RON2 on cecal pathological changes after anthelmintic infection, H&E staining was used for direct comparison of intestinal pathological changes. In the Challenge and Vector groups, incomplete intestinal villi were observed, along with increased erythrocyte and inflammatory cell infiltration, and a large accumulation of coccidia oocysts within the tissue. In contrast, the RON2-DCpep, RON2, and Vaccine groups showed significantly reduced pathological damage, with less coccidia oocyst accumulation (only sporadic oocysts were observed), decreased intestinal villi damage, and reduced erythrocyte and inflammatory cell infiltration. The comparison showed that the RON2-DCpep and RON2 groups exhibited significantly less pathological changes compared to the Vaccine group. Figure 21 As shown.
[0208] The anticoccidial index (ACI) indicates that recombinant Lactobacillus plantarum has a good protective effect against coccidiosis.
[0209] The anticoccidial index (ACI) is an important indicator for detecting the anticoccidial effect. To detect the overall anticoccidial effect of oral immunization with recombinant Lactobacillus plantarum NC8-pSIP-409-pgsA'-RON2-DCpep and NC8-pSIP-409-pgsA'-RON2, the anticoccidial index (ACI) of each group was calculated, as shown in Table 13. The RON2-DCpep group had the highest anticoccidial index of 170.89. The recombinant Lactobacillus plantarum RON2 group was similar to the RON2-DCpep group, with an ACI of 170.49. Furthermore, the anticoccidial effects of the recombinant Lactobacillus plantarum NC8-pSIP-409-pgsA'-RON2 and NC8-pSIP-409-pgsA'-RON2 groups were higher than those of the commercial vaccine group. The results showed that the recombinant Lactobacillus plantarum NC8-pSIP-409-pgsA'-RON2-DCpep and NC8-pSIP-409-pgsA'-RON2 had good protective effects against coccidia.
[0210] Table 13 Anticoccidial Index
[0211]
[0212]
[0213] 2.3 Summary
[0214] This experiment demonstrates that oral administration of recombinant Lactobacillus plantarum NC8-pSIP-409-pgsA'-RON2-DCpep and NC8-pSIP-409-pgsA'-RON2 can increase serum cytokine IFN-γ and IL-2 levels, improve intestinal SIgA and serum IgG antibody levels, enhance splenic lymphocyte proliferation, and stimulate CD4+. + CD8 + The proportion of T lymphocytes increases.
[0215] Recombinant Lactobacillus plantarum expressing RON2 protein can increase weight gain, reduce oocyst excretion, and decrease cecal lesions after coccidia infection, indicating that this recombinant Lactobacillus plantarum has a good immunoprotective effect against Eimeria tenella and demonstrating that DCpep protein has the effect of enhancing immune response.
[0216] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A recombinant Lactobacillus plantarum expressing an anchored Eimeria tenella RON2 antigen, characterized in that, Compared with the wild type, the recombinant Lactobacillus plantarum is modified to have RON2-Dcpep fusion protein expression activity; The fusion protein is formed by linking RON2 with Dcpep, and the Dcpep sequence is shown as SEQ ID NO.
1. The RON2-Dcpep fusion protein in the recombinant Lactobacillus plantarum is expressed in fusion with the anchor element pgsA', and the amino acid sequence of the fusion polypeptide is shown as SEQ ID NO.
6.
2. The recombinant Lactobacillus plantarum of claim 1, wherein, The fusion protein is composed of RON2 and three DCpep gene fragments in series, and the codon-optimized nucleotide sequence is shown as SEQ ID NO. 2, and the amino acid sequence is shown as SEQ ID NO.
3.
3. The recombinant Lactobacillus plantarum of claim 2, wherein, The nucleotide sequence also includes other sequences that can translate the RON2-Dcpep fusion protein based on codon degeneracy.
4. The recombinant Lactobacillus plantarum of claim 1, wherein, The modification of the recombinant Lactobacillus plantarum is constructed by the pSIP409-pgsA' recombinant plasmid, and meanwhile, the RON2-DCpep fusion gene contains promoter, terminator and enzyme cutting site gene sequences, and the enzyme cutting site is XbaI and HindIII.
5. Use of the recombinant Lactobacillus plantarum of any one of claims 1 to 4 for the preparation of a medicament for the prevention of coccidiosis caused by Eimeria tenella, characterized in that, The drug for preventing Eimeria tenella disease is an oral vaccine.
6. An oral vaccine, characterized in that, The vaccine uses the recombinant Lactobacillus plantarum of any one of claims 1-4 as an antigen, and the oral vaccine also contains pharmaceutically necessary excipients, including but not limited to solvents, solubilizers, suspending agents, isotonic agents, buffers, soothing agents, preservatives, antioxidants, coloring agents, sweeteners or other formulation additives.
7. Use of the recombinant Lactobacillus plantarum of any one of claims 1 to 4 for the preparation of a feed for poultry, characterized in that, The poultry is chicken.
8. Use of the recombinant Lactobacillus plantarum of any one of claims 1-4 or the oral vaccine of claim 6 in the preparation of a drug for preventing Eimeria tenella disease.