An ultra-sensitive detection composition of aquatic product pathogenic bacteria, application and detection method thereof

By using an ultrasensitive detection composition for pathogenic bacteria in aquatic products and utilizing the HCR reaction of amplification primers and hairpin probes, the problems of speed, accuracy, and sensitivity in the detection of pathogenic Escherichia coli in aquatic products have been solved, achieving efficient food safety detection.

CN117431327BActive Publication Date: 2026-06-30HAINAN UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HAINAN UNIV
Filing Date
2022-07-20
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing methods for detecting pathogenic Escherichia coli in aquatic products are cumbersome, time-consuming, have low sensitivity, high cost, and high false positive rates, making it difficult to meet the needs for rapid and accurate food safety testing.

Method used

A highly sensitive detection composition for aquatic pathogens is employed, comprising amplification primers and hairpin probes modified with fluorescent and quenching groups. Detection is performed via hybridization chain reaction (HCR), combining reverse transcription, conventional PCR, and asymmetric PCR amplification to achieve high specificity and sensitivity.

Benefits of technology

It enables rapid and accurate detection of Escherichia coli in aquatic products, with a sensitivity of 0.4 CFU/mL and a linear range of 40 CFU/mL to 4×10⁵ CFU/mL. It avoids false positives and interference from other bacteria, and has high detection efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117431327B_ABST
    Figure CN117431327B_ABST
Patent Text Reader

Abstract

The application discloses a super-sensitive detection composition of aquatic product pathogenic bacteria and an application and a detection method thereof, and belongs to the technical field of biotechnology.The composition comprises an amplification primer with a sequence shown as SEQ ID No.1-2, a hairpin probe H1 with a fluorescent group and a quenching group modified on a nucleotide sequence shown as SEQ ID No.3, and a hairpin probe H2 with a sequence shown as SEQ ID No.4.Compared with conventional detection technologies such as a bacterial culture method, an instrument analysis method, a molecular biology method and an immunology method, the application provides a set of amplification primers and hairpin probes based on HCR, has higher specificity when detecting escherichia coli of aquatic products, and can avoid the influence of staphylococcus aureus, streptococcus pyogenes, pseudomonas aeruginosa and salmonella; meanwhile, the application has better sensitivity, and the detection limit can reach 0.4 CFU / mL; in addition, compared with other hairpin probes, the application can avoid false positives and improve reaction efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of biotechnology, and in particular to an ultrasensitive detection composition for pathogenic bacteria in aquatic products, its application, and detection method. Background Technology

[0002] With the improvement of people's living standards, aquatic products are increasingly popular among consumers due to their low fat, high protein, rich content of various amino acids needed by the human body, and delicious taste. This has driven the rapid development of marine and freshwater aquaculture and marine fishing industries.

[0003] Pathogenic microorganisms have always been a significant factor affecting the quality and safety of aquatic products. Pathogenic contamination of aquatic products is generally categorized into primary and secondary contamination. Primary contamination refers to infection of fish, shrimp, and shellfish by pathogens from the natural environment, while secondary contamination refers to contamination after capture. Pathogenic Escherichia coli is a common pathogen in aquatic products. As a foodborne pathogen, pathogenic Escherichia coli can cause diseases such as diarrhea. Therefore, rapid and accurate detection of pathogenic Escherichia coli in aquatic products is an effective method to improve their safety.

[0004] Currently, the main diagnostic methods for pathogenic Escherichia coli include bacterial culture, instrumental analysis, molecular biology, and immunology. (1) Traditional bacterial culture requires enrichment, isolation, and purification, which takes a long time (generally at least one week), is cumbersome, and is easily affected by external factors. It has low detection sensitivity and is difficult to meet the needs of rapid detection. (2) Instrumental analysis mainly uses gas chromatography, high performance liquid chromatography, etc., and mainly detects pathogenic Vibrio based on the chemical composition or the characteristic spectrum of its metabolites. These methods are reliable and highly sensitive, but require cumbersome sample pretreatment, sophisticated and expensive instruments, and experienced operators, which is not conducive to promotion at the grassroots level. (3) Molecular biology methods, including commonly used loop-mediated isothermal amplification (LAMP), detect pathogenic bacteria by amplifying their specific expression genes. This method greatly shortens the detection time and simplifies the detection procedure, but it requires the extraction of total bacterial DNA or RNA in the early stage and has a high false positive rate; (4) Immunological methods are based on the principle of specific binding between antigens and antibodies to achieve detection. Commonly used methods include enzyme-linked immunosorbent assay (ELISA), enzyme-linked fluorescence assay (ELFA), and electrochemical analysis. Immunological detection methods have the advantages of high specificity, high sensitivity, and easy observation, but the preparation of antibodies is time-consuming and costly, and they are not suitable for long-term stable storage, thus limiting their widespread application. Therefore, there is an urgent need for a modern detection method that is easy to operate, fast and accurate, and has high sensitivity and specificity to meet the needs of rapid detection of modern aquatic product food safety. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide an ultrasensitive detection composition for pathogenic bacteria in aquatic products, which has better reaction efficiency, sensitivity and specificity when applied to the detection of pathogenic Escherichia coli in aquatic products.

[0006] Another object of the present invention is to provide the use of the above-described detection composition in the detection of Escherichia coli in aquatic products for non-diagnostic purposes or in the preparation of a kit for the detection of Escherichia coli in aquatic products;

[0007] Another object of the present invention is to provide a kit based on the above-described detection composition and a method for detecting Escherichia coli in aquatic products.

[0008] To solve the aforementioned technical problems / achieve the aforementioned objectives, or at least partially solve the aforementioned technical problems / achieve the aforementioned objectives, as a first aspect of the present invention, an ultrasensitive detection composition for aquatic product pathogens is provided, comprising amplification primers, hairpin probe H1, and hairpin probe H2; wherein the sequences of the amplification primers are as shown in SEQ ID No. 1-2; the hairpin probe H1 is a single-stranded probe modified with a fluorescent group and a quenching group on the nucleotide sequence shown in SEQ ID No. 3, and the hairpin probe H2 is a single-stranded probe with the sequence shown in SEQ ID No. 4.

[0009] Optionally, the bases modified by the fluorescent group and the quencher group are adjacent to each other and located on different stem chains of the hairpin probe H1. Further optionally, the bases modified by the fluorescent group and the quencher group are spaced at least 9 nt apart.

[0010] Optionally, the fluorescent group is FAM, and the quenching group is BHQ1.

[0011] As a second aspect of the invention, the application of the detection composition in the non-diagnostic detection of Escherichia coli in aquatic products or in the preparation of a kit for detecting Escherichia coli in aquatic products is proposed. The aquatic products may be fish, crustaceans, or mollusks.

[0012] As a third aspect of the present invention, a kit for detecting Escherichia coli in aquatic products is provided, comprising a detection composition of any of the aforementioned schemes, and one or more selected from reverse transcription reaction reagents, conventional PCR reaction reagents, and asymmetric PCR reaction reagents.

[0013] As a fourth aspect of the present invention, a method for detecting Escherichia coli in aquatic products for non-diagnostic purposes is provided, comprising:

[0014] Step 1: Obtain the 16S RNA of the aquatic product to be tested and reverse transcribe it into cDNA;

[0015] Step 2: Using the cDNA as a template, perform PCR amplification using the amplification primers with the nucleotide sequence shown in SEQ ID No. 1-2 to obtain the PCR amplification product;

[0016] Step 3: Using the PCR amplification product as a template, perform asymmetric PCR amplification using the nucleotide sequence shown in SEQ ID No. 1 or SEQ ID No. 2 to obtain the asymmetric PCR amplification product;

[0017] Step 4: Using the asymmetric PCR amplification product as the initiation chain, perform HCR reaction with the hairpin probes H1 and H2 described in this invention to obtain the fluorescence signal peak.

[0018] Optionally, it also includes preparing a standard curve of E. coli concentration versus fluorescence signal peak:

[0019] Prepare E. coli bacterial suspensions of known concentrations. Calculate the number of E. coli per unit volume of the asymmetric PCR amplification product based on the template volume and total system volume of the reverse transcription reaction system, the conventional PCR reaction system, and the asymmetric PCR reaction system. Serially dilute the asymmetric PCR product to obtain asymmetric PCR amplification products of varying concentrations. Perform HCR reaction as described in step 4 above. Using the concentration of E. coli and its corresponding fluorescence signal peak as coordinates, obtain a curve showing the change of fluorescence signal peak with the concentration of E. coli.

[0020] Find points on the curve that exhibit linear variation, perform linear fitting, and obtain a standard curve of E. coli concentration versus fluorescence signal peak value.

[0021] Optionally, step 1 is:

[0022] Step 1.1: Obtain an in vitro sample from the aquatic product to be tested, pre-treat it, centrifuge at low speed to collect the supernatant, and centrifuge the supernatant at high speed to obtain bacterial precipitate;

[0023] Step 1.2: After resuspending the bacterial cell precipitate, repeatedly freeze and thaw to obtain 16S RNA from the aquatic product to be tested.

[0024] Compared with conventional detection techniques such as bacterial culture, instrumental analysis, molecular biology, and immunology, this invention provides a set of amplification primers and hairpin probes based on hybridization chain reaction (HCR), which has high specificity in detecting Escherichia coli in aquatic products and can avoid the influence of Staphylococcus aureus, Streptococcus pyogenes, Pseudomonas aeruginosa, and Salmonella. It also has excellent sensitivity, with a detection limit of 0.4 CFU / mL and a range of 40 CFU / mL to 4 × 10⁻⁶ CFU / mL. 5 It exhibits a good linear range at CFU / mL; furthermore, it avoids false positives and improves reaction efficiency compared to other hairpin probes. Attached Figure Description

[0025] Figure 1 The diagram shows the structural schematic of the hairpin probes H1 and H2 of this invention;

[0026] Figure 2 The diagram shown is a flowchart illustrating the detection method of the present invention.

[0027] Figure 3 The graph shown is a bar chart of fluorescence signal peaks as a function of E. coli concentration; control is the control group without asymmetric amplification products; 0-6 represents 10 n The values ​​of n in the power correspond to concentrations of 0.4, 4, 40, 400, 4000, 40000, and 400000 CFU / mL, respectively.

[0028] Figure 4 The figure shows a standard curve of fluorescence signal peak as a function of E. coli concentration; 2-6 represents 10 n The values ​​of n in the power correspond to concentrations of 40, 400, 4000, 40000, and 400000 CFU / mL, respectively.

[0029] Figure 5 The image shows the gel electrophoresis results of E. coli PCR and asymmetric PCR amplification products; lane M is the 50bp marker; lane 1 is the purchased ssDNA (69 nt, 1 μM, sequence same as SEQ ID No. 5, the same below); lane 2 is the negative control group for PCR amplification (F+R+Premix Taq enzyme); lane 3 is the PCR product; lane 4 is the asymmetric PCR product;

[0030] Figure 6 The results of the feasibility analysis by polyacrylamide gel electrophoresis are shown below; lane 1 contains the purchased ssDNA (69 nt, 1 μM, sequence same as SEQ ID No. 5); lane 2 contains H1 (1.6 μM); lane 3 contains H2 (0.8 μM); lane 4 contains the purchased ssDNA (69 nt, 1.6 μM) + H1 (0.8 μM); lane 5 contains the purchased ssDNA (69 nt, 1.6 μM) + H2 (0.8 μM); lane 6 contains H1 (0.4 μM) + H2 (0.4 μM); lane 7 contains 7.5 μl of asymmetric PCR product + H1 (0.4 μM) + H2 (0.4 μM); lane 8 contains the purchased ssDNA (69 nt, 0.1 μM) + H1 (0.4 μM) + H2 (0.4 μM).

[0031] Figure 7The results of the feasibility analysis of fluorescence detection are shown below; the curves from top to bottom are: asymmetric PCR product 5 μl + H1 (0.4 μM) + H2 (0.8 μM); purchased ssDNA (69 nt, 0.1 μM) + H1 (0.4 μM) + H2 (0.8 μM); H1 (0.4 μM) + H2 (0.8 μM);

[0032] Figure 8 The results of gel electrophoresis for F / R primer specificity detection are shown.

[0033] Figure 9 The image shows the gel electrophoresis results for asymmetric PCR specific detection.

[0034] Figure 10 The results of polyacrylamide gel electrophoresis of the hairpin probe in control group 1 are shown below; lane 1 contains purchased ssDNA (69 nt, 1.6 μM); lane 2 contains H1-1 (1.6 μM); lane 3 contains H2-1 (0.8 μM); lane 4 contains ssDNA (69 nt, 1.6 μM) + H1-1 (0.8 μM); lane 5 contains ssDNA (69 nt, 1.6 μM) + H2-1 (0.8 μM); lane 6 contains H1-1 (0.4 μM) + H2-1 (0.4 μM); lane 7 contains purchased ssDNA (69 nt, 0.1 μM) + H1-1 (0.4 μM) + H2-1 (0.4 μM); lane 8 contains 7.5 μl of asymmetric PCR product + H1-1 (0.4 μM) + H2-1 (0.4 μM).

[0035] Figure 11 The results of polyacrylamide gel electrophoresis of the hairpin probe in control group 2 are shown below; lane 1 contains purchased ssDNA (69 nt, 1.6 μM); lane 2 contains H1-2 (1.6 μM); lane 3 contains H2-2 (0.8 μM); lane 4 contains ssDNA (69 nt, 1.6 μM) + H1-2 (0.8 μM); lane 5 contains ssDNA (69 nt, 1.6 μM) + H2-2 (0.8 μM); lane 6 contains H1-2 (0.4 μM) + H2-2 (0.4 μM); lane 7 contains purchased ssDNA (69 nt, 0.1 μM) + H1-2 (0.4 μM) + H2-2 (0.4 μM); lane 8 contains 7.5 μl of asymmetric PCR product + H1-2 (0.4 μM) + H2-2 (0.4 μM). Detailed Implementation

[0036] This invention discloses an ultrasensitive detection composition for pathogenic bacteria in aquatic products, its application, and a detection method thereof. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired result. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The products, processes, and applications described in this invention have been described through preferred embodiments. Those skilled in the art can obviously make modifications or appropriate alterations and combinations to the products, processes, and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention. Obviously, the described embodiments are only a part of the embodiments of this application, not all of them. All other embodiments obtained by those skilled in the art based on the embodiments in this application without creative effort are within the scope of protection of this application.

[0037] It should be noted that, in this document, relational terms such as “first” and “second”, “step 1” and “step 2”, “S1” and “S2”, and “(1)” and “(2)” are used merely to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Without further limitation, an element defined by the phrase “comprising one…” does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element.

[0038] In a first aspect of the present invention, an ultrasensitive detection composition for aquatic product pathogens is provided, comprising amplification primer F, amplification primer R, hairpin probe H1, and hairpin probe H2; wherein the sequences of the amplification primers F and R are shown in SEQ ID No. 1-2;

[0039] F: GGAGGAAGGGAGTAAAGTTAAT;

[0040] R: GGAGTTAGCCGGTGCTTCT;

[0041] The sequence amplified by primers F / R is GGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCC (SEQ ID No. 5), derived from *Escherichia coli* (E. coli). Escherichia 16S RNA is reverse transcribed.

[0042] The hairpin probe H1 is a single-stranded probe with a fluorescent group and a quencher group modified on the nucleotide sequence shown in SEQ ID No. 3, and the hairpin probe H2 is a single-stranded probe with the sequence shown in SEQ ID No. 4.

[0043] H1 (modified with fluorescent and quenching groups): TCATTGACGTTACCCGCACTTCCAATGCGGGTAACGTCAATGAGCAAAGG;

[0044] H2: TTGGAAGTGCGGGTAACGTCAATGACCTTTGTCATTGACGTTACCCGCA;

[0045] The H1 and H2 probes exhibit a hairpin structure when not involved in the HCR reaction. (See [link to HCR reaction]) Figure 1 Schematic diagram (H1 does not list modified fluorescent groups and quenching groups).

[0046] In some embodiments of the present invention, the bases modified by the fluorescent group and the quencher group are adjacent to each other and located on different stem chains of the hairpin probe H1. The relative proximity means that the complementary base of the base modified by the fluorescent group and the base modified by the quencher group are separated by less than 9 nt, for example, 8 nt, 7 nt, 6 nt, 5 nt, 4 nt, 3 nt, 2 nt, 1 nt or 0 nt in the range of 0-8 nt, where 0 nt means that the bases modified by the fluorescent group and the quencher group are complementary.

[0047] In some embodiments of the present invention, in order to ensure that when the H1 probe participates in the HCR reaction, there is sufficient spacing between the fluorescent group and the quenching group to enable the fluorescent group to generate a fluorescent signal, the bases modified by the fluorescent group and the quenching group are spaced at least 9 nt apart.

[0048] In some embodiments of the present invention, the quenching group is modified on the 5' end base of the nucleotide sequence shown in SEQ ID No. 3, and the fluorescent group is modified on the 41st base of the nucleotide sequence shown in SEQ ID No. 3.

[0049] H1: Quenching group -TCATTGACGTTACCCGCACTTCCAATGCGGGTAACGTCAAT (fluorescent group)GAGCAAAGG;

[0050] In some embodiments of the present invention, the fluorescent group is carboxyfluorescein (FAM) and the quenching group is a black hole quenching group (BHQ1).

[0051] In a second aspect of the invention, the application of the detection composition in the detection of Escherichia coli in aquatic products for non-diagnostic purposes or in the preparation of a kit for the detection of Escherichia coli in aquatic products is proposed. The non-diagnostic purpose refers to detecting the number of pathogens for food safety purposes, not for the direct purpose of obtaining the health status of aquatic products. The aquatic product samples obtained can be live or dead (sampled immediately after euthanasia).

[0052] In some embodiments of the present invention, the aquatic products may be fish, crustaceans, or mollusks. Fish include, but are not limited to, tilapia, crucian carp, and cobia; crustaceans include, but are not limited to, shrimp (Litopenaeus vannamei, Penaeus monodon, Penaeus sinensis, etc.) and crabs; and shellfish include, but are not limited to, oysters, abalone, and scallops.

[0053] In a third aspect of the invention, a kit for detecting *Escherichia coli* in aquatic products is provided, comprising a detection composition according to any of the foregoing schemes, and one or more selected from reverse transcription reaction reagents, conventional PCR reaction reagents, and asymmetric PCR reaction reagents. The reverse transcription reaction reagents, conventional PCR reaction reagents, and asymmetric PCR reaction reagents can all be purchased from reagent companies.

[0054] In a fourth aspect of the invention, a method for detecting Escherichia coli in aquatic products for non-diagnostic purposes is provided, comprising:

[0055] Step 1: Obtain the 16S RNA of the aquatic product to be tested and reverse transcribe it into cDNA;

[0056] Step 2: Using the cDNA as a template, perform PCR amplification using the amplification primers with the nucleotide sequence shown in SEQ ID No. 1-2 to obtain the PCR amplification product;

[0057] Step 3: Using the PCR amplification product as a template, perform asymmetric PCR amplification using the nucleotide sequence shown in SEQ ID No. 1 or SEQ ID No. 2 to obtain the asymmetric PCR amplification product;

[0058] Step 4: Using the asymmetric PCR amplification product as the initiation chain, perform HCR reaction with the hairpin probes H1 and H2 described in this invention to obtain the fluorescence signal peak.

[0059] In some embodiments of the present invention, the reverse transcription process can be performed using the PrimeScript commercial kit from Takara Reagents. TM cDNA was obtained using the RT reagent kit (Perfect Real Time) (which contains universal reverse transcription primers).

[0060] The reverse transcription reaction system was 10 μl, and the amounts of each substance added were as follows:

[0061] 5×PrimeScript buffer 2 μl;

[0062] PrimeScript RT Enzyme 0.5 μl;

[0063] Oligo dT Primer 0.5 μl;

[0064] Random 6 mers 0.5 μl;

[0065] 1 μl of E. coli bacterial fragments;

[0066] RNase-Free dH2O 5.5 μl

[0067] Reverse transcription procedure:

[0068] 37 ℃ for 15 min;

[0069] 85 ℃ for 5 seconds;

[0070] In some embodiments of the present invention, a conventional PCR reaction is performed using amplification primers F / R with cDNA as a template to obtain a large amount of double-stranded DNA (dsDNA) PCR amplification products. The enzyme used for PCR is Premix Taq from Takara Reagents. TM (Takara Taq) TM Version 2.0 plus dye);

[0071] The reaction system for the conventional PCR was 25 μl, and the amounts of each substance added were as follows:

[0072] Premix Taq 12.5 μl;

[0073] F (10 μM) 0.5 μl;

[0074] R (10 μM) 0.5 μl;

[0075] 2 μl of reverse transcription product;

[0076] ddH2O 9.5 μl;

[0077] Standard PCR procedure: 95℃, 30s;

[0078] 95℃, 20s;

[0079] 53℃, 20s; 20 cycles

[0080] 68℃, 5s;

[0081] 68℃, 20s;

[0082] In some embodiments of the present invention, the nucleotide sequence shown in SEQ ID No. 1 is used as a template to amplify dsDNA amplified by conventional PCR, and a large amount of single-stranded DNA (ssDNA) asymmetric PCR product is obtained again. The enzyme used for asymmetric PCR is Premix Taq from Takara Reagents. TM (Takara Taq) TM Version 2.0 plus dye);

[0083] The reaction system for the asymmetric PCR was 25 μl, and the amounts of each substance added were as follows:

[0084] Premix Taq 2.5 μl;

[0085] F (10 μM) 1 μl;

[0086] 5 μl of PCR product;

[0087] ddH2O 16.5 μl;

[0088] Asymmetric PCR program: 95℃, 30s

[0089] 95℃, 20s

[0090] 49℃, 20s, 80 cycles

[0091] 68℃, 5s;

[0092] 68℃, 20s;

[0093] In some embodiments of this invention, ssDNA amplified by asymmetric PCR is used as the initiating strand to initiate an HCR reaction. The ssDNA binds to the closed H1 portion and opens H1. The opened H1 then binds to the closed H2 portion and opens H2. The opened H2 then binds to the closed H1 portion and opens H1 again, and this cycle repeats to form a nicked dsDNA product that is several thousand base pairs long. This achieves secondary amplification of the nucleic acid signal, and the output of the fluorescence signal enables ultrasensitive detection of Escherichia coli in aquatic products. A schematic diagram of the principle is shown below. Figure 2 .

[0094] In some embodiments of the present invention, the total volume of the HCR reaction system is 20 μl, and the amount of each substance added is as follows:

[0095] 10 μl of asymmetric PCR product;

[0096] H1 (10 μM) 0.8 μl;

[0097] H2 (10 μM) 0.8 μl;

[0098] Buffer 8.4 μl;

[0099] The buffer may optionally consist of: 5 mM MgCl2, 0.3 M NaCl, 20 mM Tris-HCl, and pH 7.6.

[0100] In some embodiments of the present invention, a standard curve of Escherichia coli concentration versus fluorescence signal peak value is also prepared:

[0101] Prepare E. coli bacterial suspensions of known concentrations. Calculate the number of E. coli per unit volume of the asymmetric PCR amplification product based on the template volume and total system volume of the reverse transcription reaction system, the conventional PCR reaction system, and the asymmetric PCR reaction system. Serially dilute the asymmetric PCR product to obtain asymmetric PCR amplification products of varying concentrations. Perform HCR reaction as described in step 4 above. Using the concentration of E. coli and its corresponding fluorescence signal peak as coordinates, obtain a curve showing the change of fluorescence signal peak with the concentration of E. coli.

[0102] Find points on the curve that exhibit linear variation, perform linear fitting, and obtain a standard curve of E. coli concentration versus fluorescence signal peak value.

[0103] A non-limiting illustrative explanation of the conversion of E. coli concentration during the preparation of the standard curve is provided:

[0104] (1) If the total number of bacteria is 10 7 If 50 μl of bacterial fragments (prepared with DEPC water) are obtained, then 1 μl of bacterial fragments is equivalent to 2 × 10⁻⁶. 5 One bacterium;

[0105] (2) If 2 μl of bacterial fragments are reverse transcribed to obtain cDNA, and the reverse transcription system is set to 20 μl, then 1 μl of reverse transcription product is equivalent to 2 × 10 4 One bacterium;

[0106] (3) If 2 μl of reverse transcription product is used for PCR amplification and the PCR amplification reaction system is set to 20 μl, then 1 μl of PCR product is equivalent to 2000 bacteria.

[0107] (4) If 5 μl of PCR amplification is used for asymmetric PCR amplification, and the asymmetric PCR reaction system is set to 20 μl, then 1 μl of asymmetric PCR is equivalent to 500 bacteria.

[0108] (5) If 10 μl of asymmetric PCR product is added to the HCR reaction, the number of bacteria added is 5000; if 1 μl of asymmetric PCR product is added to the HCR reaction, the number of bacteria added is 500; if 1 μl of asymmetric PCR product is diluted 10 times and added to the HCR reaction, the number of bacteria added is 50; the number of bacteria is converted in this way.

[0109] In some embodiments of the present invention, step 1 is as follows:

[0110] Step 1.1: Obtain an in vitro sample from the aquatic product to be tested, pre-treat it, centrifuge at low speed to collect the supernatant, and centrifuge the supernatant at high speed to obtain bacterial precipitate;

[0111] Step 1.2: After resuspending the bacterial cell precipitate, repeatedly freeze and thaw to obtain 16S RNA from the aquatic product to be tested.

[0112] In some embodiments of the present invention, the bacterial cell precipitate is resuspended in DEPC water and then reverse transcribed.

[0113] In some embodiments of the present invention, for in vitro samples, mainly blood and tissue, the pretreatment of blood generally involves low-speed centrifugation (e.g., 400-600g) to collect the supernatant containing E. coli, followed by high-speed centrifugation (e.g., 6000-8500g) to collect the bacterial precipitate; the pretreatment of tissue generally involves cutting it into pieces, soaking it in physiological saline, low-speed centrifugation (e.g., 400-600g) to collect the supernatant containing E. coli, and then high-speed centrifugation again (e.g., 6000-8500g) to collect the bacterial precipitate.

[0114] In some embodiments of the present invention, the ex vivo sample of fish aquatic products is blood, and the ex vivo sample of crustaceans and mollusks is tissue.

[0115] In the comparative experiments provided by this invention, unless otherwise specified, the experimental conditions and materials are kept consistent in order to ensure comparability.

[0116] The following provides a further description of an ultrasensitive detection composition for pathogenic bacteria in aquatic products, its application, and detection method provided by the present invention.

[0117] Example 1: Detection of Escherichia coli in fish and aquatic products

[0118] 1. Establishment of the standard curve

[0119] Pathogenic Escherichia coli were cultured on LB medium, and then counted to obtain 2 × 10⁻⁶ bacteria. 5Based on the template volume and total system volume of the reverse transcription reaction system, conventional PCR reaction system, and asymmetric PCR reaction system (see the system in the detection method below), the number of E. coli per unit volume of the asymmetric PCR amplification product was calculated. The asymmetric PCR product was serially diluted to obtain asymmetric PCR amplification products at concentrations of 0.4, 4, 40, 400, 4000, 40000, and 400000 CFU / mL. Then, an HCl reaction was performed. A bar graph showing the change in fluorescence signal peak value with E. coli concentration was obtained, plotted against the E. coli concentration. (See [reference needed]). Figure 3 ;

[0120] Five points exhibiting linear variation were identified on the curve, and linear fitting was performed to obtain a standard curve of E. coli concentration versus fluorescence signal peak value. (See figure) Figure 4 .

[0121] according to Figure 3 The bar chart showing the change in fluorescence intensity with different bacterial concentrations indicates that the limit of detection for Escherichia coli is 0.4 CFU / mL.

[0122] according to Figure 4 It can be seen that the detection method of the present invention is effective in the range of 40 CFU / mL to 4×10⁻⁶ CFU / mL. 5 The CFU / mL concentration exhibits excellent linearity, with a fitted curve of y = 1859.6x - 996 and R0. 2 It is 0.9912.

[0123] 2. Detection Method

[0124] (1) Pretreatment

[0125] The cultured E. coli were then subjected to 10 7 The fish were injected with CFU / mL and fed for 1, 3, and 5 days. Blood was drawn from the fish and the supernatant was collected by low-speed centrifugation at 500g. The supernatant was then centrifuged at high speed at 6500g to collect the bacterial precipitate.

[0126] (2) 16S RNA acquisition and reverse transcription to obtain cDNA

[0127] The bacterial pellet was resuspended in 60 μl of DEPC water and subjected to 20 freeze-thaw cycles to induce bacterial lysis and release 16S RNA. cDNA was then obtained by reverse transcription using a commercial kit.

[0128] The reaction system for reverse transcription is 10 μl, and the amounts of each substance added are as follows:

[0129] 5×PrimeScript buffer 2 μl;

[0130] PrimeScript RT Enzyme 0.5 μl;

[0131] Oligo dT Primer 0.5 μl;

[0132] Random 6 mers 0.5 μl;

[0133] 1 μl of E. coli bacterial fragments;

[0134] RNase-Free dH2O 5.5 μl

[0135] Reverse transcription procedure:

[0136] 37 ℃ for 15 min;

[0137] 85 ℃ for 5 seconds;

[0138] (3) Conventional PCR amplification

[0139] Using the amplification primers F / R of this invention, a conventional PCR reaction was performed with cDNA as a template to obtain a large amount of double-stranded DNA (dsDNA) PCR amplification products.

[0140] The reaction volume for a standard PCR reaction is 25 μl, and the amounts of each substance added are as follows:

[0141] Premix Taq 12.5 μl;

[0142] F (10 μM) 0.5 μl;

[0143] R (10 μM) 0.5 μl;

[0144] 2 μl of reverse transcription product;

[0145] ddH2O 9.5 μl;

[0146] Standard PCR procedure: 95℃, 30s;

[0147] 95℃, 20s;

[0148] 53℃, 20s; 20 cycles

[0149] 68℃, 5s;

[0150] 68℃, 20s;

[0151] (4) Asymmetric PCR amplification

[0152] Using the amplification primer F of this invention as a template, asymmetric PCR amplification was performed to obtain asymmetric PCR products.

[0153] The reaction volume for asymmetric PCR was 25 μl, and the amounts of each substance added were as follows:

[0154] Premix Taq 2.5 μl;

[0155] F (10 μM) 1 μl;

[0156] 5 μl of PCR product;

[0157] ddH2O 16.5 μl;

[0158] Asymmetric PCR program: 95℃, 30s

[0159] 95℃, 20s;

[0160] 49℃, 20s; 80 cycles

[0161] 68℃, 5s;

[0162] 68℃, 20s;

[0163] (5) HCR reaction

[0164] The asymmetric PCR amplification products were reacted at 25°C for 12 hours according to the following system;

[0165] 10 μl of asymmetric PCR product;

[0166] H1 (10 μM) 0.8 μl;

[0167] H2 (10 μM) 0.8 μl;

[0168] Buffer 8.4 μl;

[0169] The buffer composition is: 5 mM MgCl2, 0.3 M NaCl, 20 mM Tris-HCl, pH 7.6.

[0170] (6) Test results

[0171] Substituting the fluorescence signal peak into the standard curve, the concentrations of E. coli in the blood of tilapia after injection with E. coli solution were calculated to be 303 CFU / mL, 1914 CFU / mL, and 19452 CFU / mL, respectively, after 1, 3, and 5 days of rearing. Simultaneously, parallel plate culture methods were used to measure the maximum E. coli concentrations at 418 CFU / mL, 1625 CFU / mL, and 21689 CFU / mL, which were essentially consistent with the results, demonstrating that the method has good detection accuracy in actual samples.

[0172] 3. Method Validation

[0173] (1) Agarose gel electrophoresis was used to verify the results of E. coli PCR and asymmetric PCR.

[0174] according to Figure 5 The results show that lane 3 is a PCR product, and the amplified dsDNA is between 50 bp and 100 bp, which is consistent with the theoretical value of 69 bp.

[0175] Lane 4 contains asymmetric PCR products. Compared to lane 3, in addition to dsDNA, another product band with a lower molecular weight appears. The electrophoresis speed is consistent with that of the purchased ssDNA (69 nt), indicating that this band is the target band obtained by amplification.

[0176] (2) Feasibility analysis results of polyacrylamide gel electrophoresis

[0177] according to Figure 6 The results showed that lane 6 contained H1 (0.4 μM) + H2 (0.4 μM), but no hybrid long-chain dsDNA molecule was formed; while lane 7 contained 7.5 μL of asymmetric PCR product + H1 (0.4 μM) + H2 (0.4 μM), and the hybrid long-chain dsDNA formed by the HCR reaction was too large and moved slowly, basically remaining at the lane opening; lane 8 contained purchased ssDNA (69 nt, 0.1 μM) + H1 (0.4 μM) + H2 (0.4 μM), and a hybrid long-chain dsDNA band was also formed at the lane opening, indicating that the asymmetric PCR amplification product can trigger the HCR reaction.

[0178] (3) Feasibility analysis results of fluorescence detection

[0179] The asymmetric PCR product was mixed with H1 and H2 and reacted at 25℃ for 2 hours. The fluorescence spectrum was then measured using a microplate reader. Excitation was performed at 480 nm, and the emission spectrum was measured at 500–600 nm. The results are shown below. Figure 7 ;

[0180] Depend on Figure 7 It can be seen that after the addition of asymmetric PCR products, the peak fluorescence curve of the experimental group (top curve) is close to 9000, which is significantly higher than that of the positive control group (middle curve) and 4.5 times that of the negative control group (bottom curve).

[0181] (4) Specific detection of F / R primers

[0182] Escherichia coli, Staphylococcus aureus, Streptococcus pyogenes, Pseudomonas aeruginosa, and Salmonella were cultured, freeze-thawed, and reverse transcribed, respectively. Amplification was then performed according to the standard PCR system and procedure described above. Gel electrophoresis images are shown below. Figure 8 ;

[0183] Figure 8 Only the lanes containing E. coli showed a clear DNA amplification product band, with the band molecule between 50 bp and 100 bp, consistent with the expected 69 bp. In contrast, no DNA bands were observed in the lanes containing only F / R primers or other bacteria, demonstrating that the detection method of this invention has excellent specificity.

[0184] (5) Specific detection by asymmetric PCR

[0185] The conventional PCR amplification products of each bacterium in (4) were amplified by asymmetric PCR using primer F, as described above. The gel electrophoresis results are shown in [image missing]. Figure 9 ;

[0186] Figure 9 The results showed that only the lanes of E. coli showed a clear DNA amplification product band below 50 bp, consistent with the expected 69 nt, while the lanes of the F primer alone and other bacteria did not show any DNA band below 50 bp, proving that the detection method of the present invention has good specificity.

[0187] Example 2: The Influence of Different Hairpin Probes H1 on the Detection Method

[0188] For the toe domain bases of hairpin probes H1 and H2 (unpaired bases in the stem chain, see...), see... Figure 1 And the cyclic base adjustment, the complementary pairing bases are the same as those of the hairpin probe of this invention, and different control groups are set up:

[0189] Control group 1

[0190] H1-1: TCATTGACGTTACCCGCACTTCCATGCGGGTAACGTCAATGA GCAAAG (SEQ ID NO.6);

[0191] H2-1: TGGAAGTGCGGGTAACGTCAATGACTTTGCTCATTGACGTTACCCGCA (SEQ ID NO.7);

[0192] Control group 2

[0193] H1-2: TCATTGACGTTACCCGCACCTTCCAATGCGGGTAACGTCAATGAGCAAAGGT (SEQ IDNO.8);

[0194] H2-2:TTGGAAGGTGCGGGTAACGTCAATGAACCTTTGTCATTGACGTTACCCGCA (SEQ IDNO.9);

[0195] Referring to the detection method in Example 1, the hairpin probes of the two control groups were replaced for detection. The products after the HCR reaction were detected by electrophoresis, and the results are shown in [Figure 1]. Figure 10 and Figure 11 ;

[0196] In control group 1 Figure 10 In the results, lane 7 (positive control group) showed a clear HCR reaction product band with a molecular weight of 1500 bp or higher. Lane 8, after the addition of asymmetric PCR product, showed an HCR product that was basically the same as that in lane 7, proving that the addition of asymmetric PCR product could successfully initiate the HCR reaction. However, both lanes 7 and 8 showed hairpin structure bands (bands below 50 bp), indicating that H1-1 and H2-1 were remaining and had not reacted completely, proving that the hairpin probe of control group 1 had a lower reaction efficiency than the hairpin probe of this invention when the HCR reaction occurred.

[0197] In control group 2 Figure 11 In the results, lane 7 (positive control group) and lane 8 (experimental group) showed obvious HCR reaction product bands (appearing from the lane opening); however, lane 6 showed that even without the addition of the standard priming strand (69 nt), the mixture of H1-2 and H2-2 alone could spontaneously generate long-chain products. This result indicates that the hairpin probe in control group 2, without the addition of the standard priming strand or asymmetric PCR products, will spontaneously react with hairpin H1-2 and H2-2, causing false positive results and inaccurate detection results.

[0198] The above description is merely a specific embodiment of the present invention, enabling those skilled in the art to understand or implement the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features claimed herein.

Claims

1. A kit for detecting Escherichia coli in aquatic products, characterized in that, The invention includes an ultrasensitive detection composition, as well as reverse transcription reaction reagents, conventional PCR reaction reagents, and asymmetric PCR reaction reagents. The ultrasensitive composition includes amplification primers, hairpin probe H1, and hairpin probe H2. The sequences of the amplification primers are shown in SEQ ID No. 1-2. The hairpin probe H1 is a single-stranded probe modified with a fluorescent group and a quencher group on the nucleotide sequence shown in SEQ ID No. 3, and the hairpin probe H2 is a single-stranded probe with the sequence shown in SEQ ID No.

4.

2. The kit of claim 1, wherein The bases modified by the fluorescent group and the quencher group are adjacent to each other and are located on different stem chains of the hairpin probe H1.

3. The kit of claim 2, wherein The bases modified by the fluorescent group and the quencher group are spaced at least 9 nt apart.

4. The kit according to any one of claims 1 to 3, characterized in that, The fluorescent group is FAM, and the quenching group is BHQ1.

5. The use of the kit according to any one of claims 1-4 in the detection of Escherichia coli in aquatic products for non-diagnostic purposes.

6. The application according to claim 5, characterized in that, The aquatic products mentioned are fish, crustaceans, or mollusks.

7. A method for detecting Escherichia coli in aquatic products for non-diagnostic purposes, characterized in that, include: Step 1: Obtain the 16S RNA of the aquatic product to be tested and reverse transcribe it into cDNA; Step 2: Using the cDNA as a template, perform PCR amplification using the amplification primers with the nucleotide sequence shown in SEQ ID No. 1-2 to obtain the PCR amplification product; Step 3: Using the PCR amplification product as a template, perform asymmetric PCR amplification using the nucleotide sequence shown in SEQ ID No. 1 to obtain the asymmetric PCR amplification product; Step 4: Using the asymmetric PCR amplification product as the initiation chain, perform an HCR reaction with hairpin probe H1 and hairpin probe H2 from claim 1 to obtain a fluorescence signal peak.

8. The method according to claim 7, characterized in that, This also includes the preparation of a standard curve of E. coli concentration versus fluorescence signal peak value: Prepare E. coli bacterial suspensions of known concentrations. Calculate the number of E. coli per unit volume of the asymmetric PCR amplification product based on the template volume and total system volume of the reverse transcription reaction system, the conventional PCR reaction system, and the asymmetric PCR reaction system. Serially dilute the asymmetric PCR product to obtain asymmetric PCR amplification products of varying concentrations. Perform HCR reaction according to step 4 of claim 7. Using the concentration of E. coli and its corresponding fluorescence signal peak as coordinates, obtain a curve showing the change of fluorescence signal peak with the concentration of E. coli. Find points on the curve that exhibit linear variation, perform linear fitting, and obtain a standard curve of E. coli concentration versus fluorescence signal peak value.

9. The method according to claim 7, characterized in that, Step 1 is: Step 1.1: Obtain an in vitro sample from the aquatic product to be tested, pre-treat it, centrifuge at low speed to collect the supernatant, and centrifuge the supernatant at high speed to obtain bacterial precipitate; Step 1.2: After resuspending the bacterial cell precipitate, repeatedly freeze and thaw to obtain 16S RNA from the aquatic product to be tested.