An indel molecular marker closely linked to green leaf related pigment content of non-heading Chinese cabbage and primer and application thereof

Abstract

The application discloses an InDel molecular marker closely related to the pigment content of Brassica campestris and application thereof. The molecular marker related to the pigment content of Brassica campestris disclosed in the application obtains a DNA fragment shown in SEQ ID No. 3 or SEQ ID No. 4 under amplification of primers of SEQ ID No. 1 and SEQ ID No. 2. Tests prove that the molecular marker is related to the contents of chlorophyll a, chlorophyll b, total chlorophyll, lutein, carotene and carotenoid in Brassica campestris. The molecular marker can be used to effectively identify the contents of chlorophyll a, chlorophyll b, total chlorophyll, lutein, carotene and carotenoid in Brassica campestris, has the characteristics of good repeatability and high specificity, and can be used for molecular marker assisted breeding selection of Brassica campestris. Therefore, the application not only saves breeding cost, but also greatly accelerates the breeding process.

Description

Technical Field

[0001] This invention relates to the field of non-heading Chinese cabbage breeding technology, specifically to an InDel molecular marker closely linked to the content of pigments related to the green leaves of non-heading Chinese cabbage, its primers, and applications. Background Technology

[0002] Non-heading Chinese cabbage is a common leafy green vegetable in my country. It has a long history of cultivation in China and has abundant germplasm resources. It is widely cultivated in my country.

[0003] As people's living standards improve, their demands for the appearance and quality of vegetables are also constantly increasing. Green leaves have certain market and ornamental value. Non-heading Chinese cabbage has a rich variety of leaf colors, such as dark green, light green, white-green, yellowish-green, and yellow. Green trait is one of the important traits in the breeding of non-heading Chinese cabbage. Green leaves are mainly affected by pigments such as chlorophyll and carotenoids. The amount of these pigments plays a decisive role in the appearance of green leaf color. The level of chlorophyll content also affects the photosynthetic capacity of Chinese cabbage, which has a certain impact on its growth vigor and yield. Carotenoids are one of the common nutritional qualities. Traditional breeding and variety identification methods are subject to various factors such as being time-consuming and labor-intensive. With the development of sequencing technology and molecular biology technology, breeding technology based on molecular marker-assisted selection has gradually developed. By detecting the close linkage characteristics between pigment content and molecular markers, the leaf color and pigment content of non-heading Chinese cabbage can be determined during the seed stage by detecting linked molecular markers, which can accelerate the breeding progress of green leaf trait in non-heading Chinese cabbage, shorten the breeding cycle, and can also serve as one of the methods for identifying the green leaf trait of different varieties of non-heading Chinese cabbage in the market. Summary of the Invention

[0004] This invention provides an application of the InDel molecular marker related to the pigment content of non-heading Chinese cabbage. Its main purpose is to provide a molecular marker that can identify non-heading Chinese cabbage varieties at various developmental stages and to breed offspring of varieties with high pigment content.

[0005] The technical solution of this invention is as follows:

[0006] The first objective of this invention is to provide an InDel molecular marker primer pair that is closely linked to the content of green leaf-related pigments in non-heading Chinese cabbage, as shown in SEQ ID NO.1 and SEQ ID NO.2, wherein the green leaf-related pigments are chlorophyll a, chlorophyll b, total chlorophyll, xanthophyll, carotene, and carotenoids.

[0007] SEQ ID NO.1: 5'-AGTCTTTCCTGATTTTCCACAC-3';

[0008] SEQ ID NO. 2: 5'-AGAGAGAGAGGAGAGACGC-3'.

[0009] A second objective of this invention is to provide the application of the aforementioned InDel molecular marker primer pair in identifying the content of green leaf-related pigments in non-heading Chinese cabbage.

[0010] Furthermore, the application includes the following steps:

[0011] (1) Extract total genomic DNA from the non-heading Chinese cabbage to be tested;

[0012] (2) The total genomic DNA of the non-heading Chinese cabbage to be tested was amplified by PCR using the InDel molecular marker primers shown in SEQ ID NO.1 and SEQ ID NO.2;

[0013] (3) Perform electrophoresis on the amplification products. If the amplification products contain only a 100bp band, they are high-pigment-content varieties; if they contain only a 102bp band, they are low-pigment-content varieties; if they contain both 100bp and 102bp bands, they are heterozygous individuals.

[0014] Furthermore, the PCR amplification reaction system in step (2) is as follows: the total PCR amplification system is 10 μl, including 0.5 μl each of forward and reverse primers, 5 μl of Taq enzyme, 1 μl (50 ng) of DNA, and 3 μl of ddH2O.

[0015] Furthermore, the PCR amplification reaction program in step (2) is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 10 s, 30 cycles; 72℃ extension for 10 min, and storage at 10℃.

[0016] Further, the specific operation of electrophoresis in step (3) is as follows: add bromophenol blue solution to the amplification product obtained in step (2) and mix well. Load 1.2 μl onto a 9% non-denaturing polyacrylamide gel and electrophores at a constant voltage of 120V for 1 h 30 min. Turn off the power, remove the gel, and perform silver staining.

[0017] Furthermore, the nucleotide sequence of the 100bp amplification product in step (3) is shown in SEQ ID NO.3, and the nucleotide sequence of the 102bp amplification product is shown in SEQ ID NO.4.

[0018] SEQ ID NO.3:

[0019] AGTCTTTCCTGATTTTCCACACCTTATCTCTCTCTCTCACTCTTCTCTAAACTATCCAACTTCATTCTCCATCTTCCTGGCGTCTCTCCTCTCTCT.

[0020] SEQ ID NO.4:

[0021] AGTCTTTCCTGATTTTCCACACCTTATCTCTCTCTCTCTCACTCTTCTCTAAACTATCCAACTTCATTCTCCATCTTCCTGGCGTCTCTCCTCTCTCT.

[0022] A third objective of this invention is to provide the application of the InDel molecular marker CHL-InDel1 in identifying the content of green leaf-related pigments in non-heading Chinese cabbage, wherein the nucleotide sequence of the InDel molecular marker CHL-InDel1 is shown in SEQ ID NO.3 or SEQ ID NO.4, and the green leaf-related pigments are chlorophyll a, chlorophyll b, total chlorophyll, xanthophyll, carotene, and carotenoids.

[0023] The fourth objective of this invention is to provide the application of the aforementioned InDel molecular marker primer pair or the aforementioned InDel molecular marker CHL-InDel1 in screening non-heading Chinese cabbage varieties with high content of green leaf-related pigments.

[0024] Furthermore, the application includes the following steps:

[0025] (1) Extract total genomic DNA from the non-heading Chinese cabbage to be tested;

[0026] (2) The total genomic DNA of the non-heading Chinese cabbage to be tested was amplified by PCR using the InDel molecular marker primers shown in SEQ ID NO.1 and SEQ ID NO.2;

[0027] (3) Perform electrophoresis on the amplification products. If the amplification products contain only a 100bp band (W type), they are high pigment content varieties; if they contain only a 102bp band (E type), they are low pigment content varieties; if they contain both 100bp and 102bp bands, they are heterozygous individuals.

[0028] Furthermore, the PCR amplification reaction system in step (2) is as follows: the total PCR amplification system is 10 μl, including 0.5 μl each of forward and reverse primers, 5 μl of Taq enzyme, 1 μl (50 ng) of DNA, and 3 μl of ddH2O.

[0029] Furthermore, the PCR amplification reaction program in step (2) is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 10 s, 30 cycles; 72℃ extension for 10 min, and storage at 10℃.

[0030] Further, the specific operation of electrophoresis in step (3) is as follows: add bromophenol blue solution to the amplification product obtained in step (2) and mix well. Load 1.2 μl onto a 9% non-denaturing polyacrylamide gel and electrophores at a constant voltage of 120V for 1 h 30 min. Turn off the power, remove the gel, and perform silver staining.

[0031] Furthermore, the nucleotide sequence of the 100bp amplification product in step (3) is shown in SEQ ID NO.3, and the nucleotide sequence of the 102bp amplification product is shown in SEQ ID NO.4.

[0032] SEQ ID NO.3:

[0033] AGTCTTTCCTGATTTTCCACACCTTATCTCTCTCTCTCACTCTTCTCTAAACTATCCAACTTCATTCTCCATCTTCCTGGCGTCTCTCCTCTCTCT.

[0034] SEQ ID NO.4:

[0035] AGTCTTTCCTGATTTTCCACACCTTATCTCTCTCTCTCTCACTCTTCTCTAAACTATCCAACTTCATTCTCCATCTTCCTGGCGTCTCTCCTCTCTCT.

[0036] Beneficial effects:

[0037] The molecular markers developed in this invention are used to detect the levels of chlorophyll-related pigments in non-heading Chinese cabbage. They can be used to identify chlorophyll content and predict leaf color in a large number of non-heading Chinese cabbage varieties at the seed stage. Compared with conventional breeding, the shorter the breeding time, the more accurate the identification. Attached Figure Description

[0038] Figure 1 A comparison diagram of the sequences of SEQ ID No. 3 and SEQ ID No. 4;

[0039] Figure 2 The image shows the electrophoretic pattern of CHL-InDel1 in 127 recombinant inbred line families. W represents the genotype that is the same as that of *Caulis Utatae*, and E represents the genotype that is the same as that of *Caulis Erqinge*.

[0040] Figure 3 The results of single-marker analysis of pigment content of CHL-InDel1 in 127 recombinant inbred line families are shown. W represents the same genotype as that of *Caulis Ulva*, E represents the same genotype as that of *Caulis Erqing*, * indicates significant difference (P<0.05), ** indicates extremely significant difference (P<0.01), and *** indicates significant difference (P<0.001).

[0041] Figure 4 The image shows the electrophoretic pattern of CHL-InDel1 in 52 inbred lines of non-heading Chinese cabbage. W represents the genotype with the same genotype as Wutacai, and E represents the genotype with the same genotype as Erqing.

[0042] Figure 5 The results of single-marker analysis of pigment content of CHL-InDel1 in 52 inbred lines of non-heading Chinese cabbage are shown. W represents the same genotype as Wutacai, E represents the same genotype as Erqing, * indicates significant difference (P<0.05), ** indicates extremely significant difference (P<0.01), and *** indicates significant difference (P<0.001). Detailed Implementation

[0043] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0044] Primers were developed by Beijing Qingke Biotechnology Co., Ltd., and the non-heading Chinese cabbage varieties used in the following examples were all from the Chinese cabbage systems biology laboratory of the College of Horticulture, Nanjing Agricultural University.

[0045] Example 1: Molecular markers related to the content of chlorophyll a, chlorophyll b, total chlorophyll, xanthophyll, carotene, and carotenoids in non-heading Chinese cabbage.

[0046] This invention provides an InDel molecular marker for identifying or assisting in the identification of chlorophyll a, chlorophyll b, total chlorophyll, xanthophyll, carotene, and carotenoid content in non-heading Chinese cabbage, named CHL-InDel1. This molecular marker uses non-heading Chinese cabbage genomic DNA as a template and is amplified by PCR using primer pair A1 to obtain the PCR product. The sequence of the product is SEQ ID No. 3 or SEQ ID No. 4. The sequence of primer pair A1 used to amplify this InDel molecular marker is as follows:

[0047] Forward primer: 5'-AGTCTTTCCTGATTTTCCACAC-3', as shown in SEQ ID No. 1;

[0048] Reverse primer: 5'-AGAGAGAGAGGAGAGACGC-3', as shown in SEQ ID No. 2.

[0049] 1. Using the genomic DNA of *Tatsoi*, which has high content of chlorophyll a, chlorophyll b, total chlorophyll, xanthophyll, carotene and carotenoids, and *Erqing*, which has low content of chlorophyll a, chlorophyll b, total chlorophyll, xanthophyll, carotene and carotenoids, as templates, PCR amplification was performed using primers labeled with this marker A1. The obtained PCR products were further detected by electrophoresis.

[0050] The PCR amplification reaction system is 10 μL, including:

[0051] (1) 0.5 μL of the forward amplification primer shown in SEQ ID No. 1 at a concentration of 10 μmol / L;

[0052] (2) 0.5 μL of the reverse amplification primer shown in SEQ ID No. 2 at a concentration of 10 μmol / L;

[0053] (3) 1 μL of DNA template with a concentration of 50 ng / μL;

[0054] (4) 5μL 2×Taq Mix

[0055] (5) 3μL ddH2O.

[0056] The PCR amplification procedure is as follows:

[0057] (1) Pre-denaturate at 94℃ for 5 min;

[0058] (2) Denaturation at 94℃ for 30 seconds,

[0059] (3) Anneal at 60℃ for 30 seconds.

[0060] (4) Extend at 72℃ for 10 seconds, repeat 30 times;

[0061] (5) Extend at 72℃ for 10 min;

[0062] (6) Store at 10℃.

[0063] 2. Separate 1.2 μl of PCR product containing bromophenol blue by electrophoresis in a 9% non-denaturing polyacrylamide gel at a constant voltage of 120 V for 1 h 30 min. Turn off the power, remove the gel, perform silver staining for analysis, and sequence the sample.

[0064] The results showed that the fragment length of the product obtained by PCR amplification using *Solanum tuberosum* genomic DNA as a template was 100 bp, as shown in SEQ ID No. 3, and the fragment length of the product obtained by PCR amplification using *Erythrina variegata* genomic DNA as a template was 102 bp, as shown in SEQ ID No. 4.

[0065] SEQ ID No. 3:

[0066] AGTCTTTCCTGATTTTCCACACCTTATCTCTCTCTCTCACTCTTCTCTAAACTATCCAACTTCATTCTCCATCTTCCTGGCGTCTCTCCTCTCTCT.

[0067] SEQ ID No.4:

[0068] AGTCTTTCCTGATTTTCCACACCTTATCTCTCTCTCTCTCACTCTTCTCTAAACTATCCAACTTCATTCTCCATCTTCCTGGCGTCTCTCCTCTCTCT.

[0069] The amplified bands of the Chinese cabbage were superior alleles with high contents of chlorophyll a, chlorophyll b, total chlorophyll, xanthophyll, carotene, and carotenoids. Therefore, if the band of the non-heading Chinese cabbage sample to be tested is 100bp, the sample to be tested contains alleles with high contents of chlorophyll a, chlorophyll b, total chlorophyll, xanthophyll, carotene, and carotenoids. If the band of the non-heading Chinese cabbage sample to be tested is 102, the sample to be tested contains alleles with low contents of chlorophyll.

[0070] 3. Comparison of SEQ ID No. 3 and SEQ ID No. 4 sequences revealed that samples with high levels of chlorophyll a, chlorophyll b, total chlorophyll, xanthophyll, carotene, and carotenoids had a 2bp nucleotide deletion at position 26bp, compared to samples with low levels of these same substances. The sequence alignment diagram is shown below. Figure 1 .

[0071] Example 2: Obtaining the CHL-InDel1 molecular marker

[0072] (1) Construct an F7:8 recombinant inbred line population containing 127 8-family lines.

[0073] Using *Caulis Amaranthus chinensis* as the female parent and *Caulis Erqingensis* as the male parent, after one generation of hybridization and eight generations of continuous self-pollination, a recombinant inbred line population containing 127 families was obtained.

[0074] (2) Planting and phenotypic determination of the population

[0075] In September 2019, the plant population was planted at the Baima Experimental Base of Nanjing Agricultural University in Nanjing, Jiangsu Province, the Experimental Base of Nanjing Agricultural University in Zhenjiang, Jiangsu Province, and the Experimental Base of Huzhou Academy of Agricultural Sciences in Huzhou, Zhejiang Province. The field trial adopted an amplified incomplete randomized block design, with three plots and six plants per family in each plot.

[0076] Mature leaves from three plants of similar growth in each cell line of each cell plot were sampled, ground, and chlorophyll was extracted by mixing anhydrous ethanol and acetone in a 1:1 ratio. After standing in the dark for 24 hours, the supernatant was centrifuged and the absorbance of the supernatant was measured at 470nm, 474nm, 485nm, 642.5nm, 649nm, and 665nm using an ELISA reader. The results were repeated three times. The mean values ​​of chlorophyll a, chlorophyll b, total chlorophyll, xanthophyll, carotene, and carotenoids in each family were calculated from the three cell lines.

[0077] (3) QTL positioning analysis

[0078] QTL mapping was performed using a multiple QTL model with the R / qtl package. Two QTL loci controlling chlorophyll content were identified, located at A07 and A09, respectively. The QTL located at A07 was named BcA07.1, with a LOD value of 7.209, an additive effect of 8.19, a dominant effect of 5.65, and a phenotypic contribution rate of 26.03%. It is located on chromosome 7 of non-heading Chinese cabbage, between 17044282 and 19453660. Further haplotype analysis narrowed this interval to 19258261 to 19396458.

[0079] (4) Development and synthesis of molecular markers

[0080] A search for candidate genes within the range of 19258261 to 19396458 revealed an InDel marker upstream of the BcGUN4 gene. A 100bp fragment containing this marker was extracted using SnapGene Viewer, and primers were designed for this fragment. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd., and their sequences are as follows:

[0081] Forward primer: 5'-AGTCTTTCCTGATTTTCCACAC-3', as shown in SEQ ID No. 1;

[0082] Reverse primer: 5'-AGAGAGAGAGGAGAGACGC-3', as shown in SEQ ID No. 2.

[0083] (5) 52 non-heading Chinese cabbage inbred lines were selected, as shown in Table 1.

[0084] Table 1: 52 inbred lines of non-heading Chinese cabbage

[0085]

[0086]

[0087]

[0088] Example 3: Application of Molecular Markers

[0089] To further verify the accuracy of applying this molecular marker to molecular marker-assisted selection breeding, 127 families of recombinant inbred lines obtained in Example 2 and 52 selected non-heading Chinese cabbage inbred lines were used for the next step of verification.

[0090] (1) Extraction of pigment content

[0091] The contents of chlorophyll a, chlorophyll b, total chlorophyll, xanthophyll, carotene and carotenoids were determined in 127 families and 52 inbred lines according to the method in Example 2.

[0092] (2) Extraction of genomic DNA from non-heading Chinese cabbage

[0093] Genomic DNA was extracted from 127 families and 52 inbred lines using the CTAB method.

[0094] (3) PCR amplification

[0095] The PCR amplification system and PCR procedure were established with reference to (1) in Example 1.

[0096] (4) Electrophoresis

[0097] Non-denaturing polyacrylamide gel electrophoresis was performed according to (2) in Example 1, and the obtained electrophoresis pattern is shown below. Figure 2 , Figure 4 .

[0098] (5) Results Analysis

[0099] The genotype of the non-heading Chinese cabbage to be tested was determined based on the size of the PCR amplification product after electrophoresis. The genotype with a size of 100 bp contained the same allele W as that of the Chinese cabbage, and the genotype with a size of 102 bp contained the same allele E as that of the Chinese cabbage.

[0100] Of the 127 recombinant inbred line families:

[0101] It contains 43 families with the same genotype as *Tatsoi*, with an average chlorophyll a content of 64.86±8.23 mg / 100g, chlorophyll b content of 22.05±2.66 mg / 100g, total chlorophyll content of 99.28±12.43 mg / 100g, xanthophyll content of 11.37±2.14 mg / 100g, carotene content of 9.42±0.77 mg / 100g, and carotenoid content of 21.11±2.32 mg / 100g;

[0102] It contains 82 families with the same genotype as Erqing, with an average chlorophyll a content of 52.95±10.32 mg / 100g, chlorophyll b content of 18.48±3.23 mg / 100g, total chlorophyll content of 81.70±15.10 mg / 100g, xanthophyll content of 8.34±2.45 mg / 100g, carotene content of 8.95±0.76 mg / 100g, and carotenoid content of 17.76±2.93 mg / 100g.

[0103] Further analysis of the significant differences in content among the groups yielded the following results: Figure 3 The results showed that the pigment content of lines with the same genotype as Wutacai was significantly higher than that of lines with the same genotype as Erqing, which indicates that this molecular marker is suitable for breeding and screening of non-heading Chinese cabbage varieties related to Wutacai and Erqing in terms of pigment content.

[0104] To further verify whether this marker is applicable to 52 non-heading Chinese cabbage inbred lines...

[0105] It contains 22 families with the same genotype as *Tatsoi*, with an average chlorophyll a content of 44.99±13.72 mg / 100g, chlorophyll b content of 20.00±11.05 mg / 100g, total chlorophyll content of 78.32±33.17 mg / 100g, xanthophyll content of 6.74±3.76 mg / 100g, carotene content of 9.80±5.39 mg / 100g, and carotenoid content of 17.30±3.94 mg / 100g;

[0106] It contains 30 families with the same genotype as Erqing, with an average chlorophyll a content of 32.16±9.14 mg / 100g, chlorophyll b content of 10.91±6.13 mg / 100g, total chlorophyll content of 48.80±19.46 mg / 100g, xanthophyll content of 5.61±2.69 mg / 100g, carotene content of 6.11±3.59 mg / 100g, and carotenoid content of 11.90±3.94 mg / 100g;

[0107] A significant difference analysis of pigment content between the two groups was performed, and the results are as follows: Figure 5 The analysis results showed that, apart from lutein, the pigment content of the strains with the same genotype as Wutachicai was significantly higher than that of the strains with the same genotype as Erqing. This further verifies that the marker is not only applicable to the screening of offspring of Wutachicai and Erqing breeding, but can also be widely used to identify the pigment content of other non-heading Chinese cabbage varieties.

[0108] In summary, this molecular marker is closely linked to the level of pigment content, allowing for the rapid identification of chlorophyll a, chlorophyll b, total chlorophyll, xanthophyll, carotene, and carotenoid content in non-heading Chinese cabbage. Furthermore, this marker can promote the application of this locus in non-heading Chinese cabbage breeding, facilitate molecular aggregation breeding with other desirable traits, and infer leaf color based on pigment content, thus playing a role in leaf color breeding. This method allows for the identification of chlorophyll a, chlorophyll b, total chlorophyll, xanthophyll, carotenoid, and carotene content at various growth and development stages of non-heading Chinese cabbage. It is highly efficient, simple, and rapid, making it suitable for large-scale use in the production and breeding of non-heading Chinese cabbage.

[0109] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of InDel molecular marker primer pairs in identifying the content of green leaf-related pigments in non-heading Chinese cabbage, wherein the InDel molecular marker is shown in SEQ ID NO.3 or SEQ ID NO.4, the primer pairs are shown in SEQ ID NO.1 and SEQ ID NO.2, and the green leaf-related pigments are chlorophyll a, chlorophyll b, total chlorophyll, xanthophyll, carotene, and carotenoids.

2. The application according to claim 1, characterized in that, The application includes the following steps: (1) Extract total genomic DNA from the non-heading Chinese cabbage to be tested; (2) The total genomic DNA of the non-heading Chinese cabbage to be tested was amplified by PCR using the InDel molecular marker primers shown in SEQ ID NO.1 and SEQ ID NO.2; (3) Perform electrophoresis on the amplification products. If the amplification products contain only a 100bp band, they are high-pigment-content varieties; if they contain only a 102bp band, they are low-pigment-content varieties; if they contain both 100bp and 102bp bands, they are heterozygous individuals. The pigment content of the heterozygous individuals is between that of high-pigment-content varieties and low-pigment-content varieties; the nucleotide sequence of the amplification product corresponding to the 100bp band is shown in SEQ ID NO.3, and the nucleotide sequence of the amplification product corresponding to the 102bp band is shown in SEQ ID NO.

4.

3. The application according to claim 2, characterized in that, The reaction system for PCR amplification in step (2) is as follows: the total PCR amplification system is 10 μl, including 0.5 μl each of forward and reverse primers, 5 μl of Taq enzyme, 1 μl of 50 ng DNA, and 3 μl of ddH2O.

4. The application according to claim 2, characterized in that, The PCR amplification reaction program in step (2) is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 10 s, 30 cycles; 72℃ extension for 10 min, and storage at 10℃.

5. The application according to claim 2, characterized in that, The specific operation of electrophoresis in step (3) is as follows: add bromophenol blue solution to the amplification product obtained in step (2) and mix well. Load 1.2 μl onto a 9% non-denaturing polyacrylamide gel and electrophores at a constant voltage of 120V for 1 h 30 min. Turn off the power, remove the gel, and perform silver staining.

6. The application of the InDel molecular marker CHL-InDel1 in identifying the content of green leaf-related pigments in non-heading Chinese cabbage, characterized in that, The InDel molecular marker CHL-InDel1 nucleotide sequence is shown in SEQ ID NO.3 or SEQ ID NO.4, and the green leaf-related pigments are chlorophyll a, chlorophyll b, total chlorophyll, xanthophyll, carotene, and carotenoids.

7. The application of the InDel molecular marker primer pair of claim 1 or the InDel molecular marker CHL-InDel1 of claim 6 in screening non-heading Chinese cabbage varieties with high content of green leaf-related pigments, characterized in that, The green leaf-related pigments are chlorophyll a, chlorophyll b, total chlorophyll, xanthophyll, carotene, and carotenoids.

Images