A gene for regulating grain shape of rice and application thereof

Abstract

The present application relates to a kind of genes for regulating rice grain shape and its application, it is related to the field of plant genetic engineering.A kind of genes for regulating rice grain shape, the gene is CRC gene, sequence as shown in SEQ ID NO:1.The gene is obtained by reverse genetics method, can be applied to regulate rice grain shape, growth period, not only enriches the molecular mechanism of rice grain shape regulation, also provides new genetic resources for the study of rice grain shape improvement, provides new material selection for rice design breeding, in rice knockout the gene can cultivate small grain shape rice variety, provides new selection for the improvement of rice grain shape.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering, and in particular to a gene that regulates rice grain shape and its application. Background Technology

[0002] Rice is a vital food crop in my country and the world, with over half the global population relying on it as their staple food. Rice yield is a complex agronomic trait controlled by multiple genes, primarily influenced by three factors: effective panicles per unit area, grains per panicle, and thousand-grain weight. Grain shape is a crucial agronomic trait directly related to rice yield and quality. On one hand, grain shape directly determines thousand-grain weight, a key factor in determining rice yield; on the other hand, grain shape is closely related to the appearance, processing quality, and cooking and eating quality of rice, making it a significant factor affecting rice quality. Therefore, discovering and utilizing new grain shape-regulating genes to improve rice grain shape is of great importance for increasing rice yield and improving rice quality.

[0003] High yield and high quality have long been the goals pursued in rice breeding. Rice grain shape is a complex quantitative trait controlled by multiple genes, which has an important impact on both rice yield and quality. It is not only an ideal trait for genetic regulation research, but also an important target for rice domestication and design breeding. Based on the important value of grain shape research in basic and applied research, it has increasingly become a hot topic in rice research. Summary of the Invention

[0004] To address the aforementioned problems, this invention provides a gene that regulates rice grain shape. This gene, obtained through reverse genetics, can be applied to regulate rice grain shape and growth period. It not only enriches the molecular mechanism of rice grain shape regulation but also provides new gene resources for studying rice grain shape improvement and offers new material choices for rice design breeding. Knocking out this gene in rice can breed small-grained rice varieties, providing a new option for improving rice grain shape.

[0005] To achieve the above objectives, the present invention provides a gene for regulating rice grain shape, the gene being... CRC The gene, with its sequence shown in SEQ ID NO: 1.

[0006] During their research, the inventors discovered that chromatin remodeling factors can regulate the interaction between DNA and nucleosomes in chromatin, thereby affecting chromatin conformation and regulating gene expression. Previous studies on plants have shown the function of Arabidopsis thaliana chromatin remodeling factors in growth, development, and nucleosome arrangement regulation, but there are no studies on the involvement of chromatin remodeling factors in regulating rice grain shape. The inventors discovered a rice chromatin remodeling factor gene using reverse genetics. CRC ( LOC_Os01g27040There is a high correlation between gene knockout and rice grain shape (including grain length and width), and gene knockout experiments have verified that knocking out gene knockout in wild-type rice is effective. CRC Genes can make rice grains significantly shorter and narrower; further research has found that... CRC The mutation significantly reduces the number of rice glume cells. The inventors provide a theoretical basis for its direct involvement as a chromatin remodeling factor in rice grain shape regulation, offering a new genetic resource for the genetic improvement of rice grain shape.

[0007] The present invention also provides an amino acid for regulating rice grain shape, which is encoded by the gene and the sequence of the amino acid is shown in SEQ ID NO: 2.

[0008] The present invention also provides the application of the gene or the amino acid in regulating rice grain shape or regulating rice grain growth period.

[0009] In one embodiment, adjusting the shape of rice grains includes shortening and / or narrowing the rice grains; The regulation of rice grain growth period includes extending the rice grain growth period.

[0010] In one embodiment, the adjustment of rice grain shape is achieved by reducing the number of rice grain cells.

[0011] In one embodiment, the application includes: a vector that targets and knocks out the gene, a transgenic cell line expressing the vector, and a recombinant bacterium expressing the vector, used in regulating rice grain shape or regulating rice grain growth period.

[0012] The present invention also provides a gene knockout vector, which is constructed using the CRISPR-Cas9 system with the sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4 as target sequences.

[0013] In one embodiment, the initial vector of the gene knockout vector includes a binary Agrobacterium vector, which includes pYLCRISPR-Cas9-MH or pMBIA1300-Cas9.

[0014] In one embodiment, the gene knockout vector includes a eukaryotic or prokaryotic selection tag gene.

[0015] By adding screening tag genes, it becomes easier to identify or screen transgenic plant cells or plants.

[0016] The present invention also provides a rice mutant, which is a rice mutant CRCThe gene has an insertion of base A between adjacent bases A and T in the sequence shown in SEQ ID NO: 3 of the first exon, and a deletion of adjacent bases T and C in the sequence shown in SEQ ID NO: 4 of the second exon.

[0017] The present invention also provides a method for preparing the rice mutant, comprising the following steps: Constructing a gene knockout vector: Using the CRISPR-Cas9 system, with the sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4 as target sequences, and the sequences shown in SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8 as primers, the corresponding nucleotide fragments were obtained, and the gene knockout vector was constructed. Preparation of rice mutants: The gene knockout vector was introduced into rice cells for targeted knockout. CRC Genes were used to obtain rice mutants.

[0018] The aforementioned rice mutants include rice varieties with smaller grains.

[0019] In one embodiment, the gene is introduced into the cells or tissues of a host plant via physical, chemical, or biological methods such as gene gun, protoplast-mediated, pollen tube channel, or Agrobacterium-mediated methods, wherein the host plant is preferably rice.

[0020] In one embodiment, the gene knockout vector is introduced into rice cells via an Agrobacterium-mediated transgenic method.

[0021] The present invention also provides a method for regulating the grain shape or growth period of rice grains, which is achieved by genetic engineering breeding or hybridization breeding, wherein the genetic engineering breeding method includes: obtaining a rice mutant using the preparation method described above; The hybridization breeding method includes: hybridizing the rice mutant with wild-type rice.

[0022] The above-mentioned hybridization breeding method specifically includes the following steps: using the rice mutant as the donor parent, hybridizing it with wild-type rice, selecting rice varieties that achieve the improvement target from the offspring, and thus realizing the targeted improvement of rice grain shape or growth period.

[0023] Compared with the prior art, the present invention has the following beneficial effects: This invention discloses a gene for regulating rice grain shape and its application. This gene is obtained through reverse genetics and can be applied to regulate rice grain shape and growth period. It not only enriches the molecular mechanism of rice grain shape regulation, but also provides new gene resources for the study of rice grain shape improvement, and provides new material selection for rice design breeding. Knocking out this gene in rice can breed small-grained rice varieties, providing new options for rice grain shape improvement. Attached Figure Description

[0024] Figure 1 In Example 1 CRC Knockout vector target crc Phenotypes of mutants and wild-type (japonica rice, Zhonghua 11); among them, Figure 1 A is CRC Knockout vector target, location, and mutation type; Figure 1 B represents wild-type and homozygous mutant plants. Figure 1 C represents a homozygous mutant plant. Figure 1 D represents the ear phenotype of wild-type and homozygous mutants; Figure 1 E, Figure 1 F represents the grain-shaped and rice-shaped mutants of wild type and homozygous mutant. WT represents wild type, and KO represents homozygous mutant.

[0025] Figure 2 In Example 2 crc Grain shape and slice images of the mutant and wild-type Zhonghua 11. Figure 2 A represents the spikelet phenotype of both the homozygous mutant and the wild type. Figure 2 B and 2C are cross-sectional views of spikelets from the homozygous mutant and the wild-type, respectively. Figure 2 In C, the upper part represents the homozygous mutant, and the lower part represents the wild type; Figure 2 D、 Figure 2 E, Figure 2 F represents the statistical graphs of spikelet circumference, cell number, and cell length for wild-type and homozygous mutants, respectively.

[0026] Figure 3 Wild-type Zhonghua 11 and crc Electron micrograph of the surface cells of mature grains of mutants. Figure 3 A, Figure 3 B represents medium-sized flower 11 and... crc Scan image of the mutagen's grain husk surface; Figure 3 C Figure 3 D and Figure 3 E represents 11 for medium-sized flowers and... crc Statistical diagram of cell length, cell width, and transverse cell number on the surface of mutant grain husk.

[0027] Figure 4 In Example 3 CRC A comparison of the chalky white grains of rice from homozygous mutants and wild-type genes. Detailed Implementation

[0028] To facilitate understanding of the present invention, a more complete description will be given below with reference to the accompanying drawings. Preferred embodiments of the invention are shown in the drawings. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the invention.

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0030] Unless otherwise specified, all reagents, materials, and equipment used in this embodiment are commercially available; unless otherwise specified, all experimental methods are conventional experimental methods in this field.

[0031] source: The pYLCRISPR-Cas9-MH vector is a commonly used gene knockout vector, provided by Academician Liu Yaoguang's research group at South China Agricultural University; Escherichia coli DH5α and Agrobacterium EHA105 are commonly used strains, which are preserved in conventional molecular biology laboratories; the rice variety is wild-type japonica rice Zhonghua 11 (a publicly used rice variety, commercially available).

[0032] Restriction endonucleases, Taq polymerase, T4 ligase, Pyrobest Taq polymerase, KOD, etc., were purchased from TAKARA (Dalian), Promega, NEB, ABM, and other biotechnology companies; plasmid miniprep kits and agarose gel extraction kits were purchased from Shanghai Jierui Biotechnology Co., Ltd.; culture media, agar powder, agarose, ampicillin (Amp), kanamycin (Kan), rifampin (Rif), and other antibiotics were purchased from Sigma; other chemical reagents used in the embodiments of this invention were imported or domestically produced analytical grade. The single-stranded primers used in the embodiments were synthesized by Riboxing Technology Co., Ltd., and sequencing was performed by Qingke and Tianyi Huiyuan.

[0033] Example 1 rice crc Analysis of mutant phenotypes and genetic effects.

[0034] During the research process, the inventors obtained [the following information] through reverse genetics. CRC The gene (LOC_Os01g27040) is a rice chromatin remodeling factor gene located on chromosome 1 of rice.

[0035] The above CRC The nucleotide sequence of the gene is shown below: The above CRC The amino acid sequence encoded by the gene is shown below:

[0036] In this embodiment, CRISPR-Cas9 gene knockout technology was used to knock out the chromatin remodeling factor gene in rice. CRC (LOC_Os01g27040) Each of the first and second exons selects a target sequence, as follows: Target sequence 1: GCCCCGGGGAGGGCGATGAGG (SEQ ID NO: 3); Target sequence 2: CTGAGAAAGCCAGGCTCAAGG (SEQ ID NO: 4).

[0037] The last three AGGs of each target sequence are PAM sequences. Combined with adapters, single-stranded primers are synthesized to construct the pYLCRISPR-Cas9-CRC knockout vector.

[0038] The primer sequences used to knock out target sequence 1 are shown below: T1F:ggcaGCCCCCGGGGAGGGCGATG (SEQ ID NO: 5); T1R:aaacCATCGCCCTCCCCGGGGGC (SEQ ID NO: 6); The primer sequences used to knock out target sequence 2 are shown below: T2F:ggcaCGTGAGAAAGCCAGGCTCA (SEQ ID NO: 7); T2R:aaacTGAGCCTGGCTTTCTCACG (SEQ ID NO: 8) Using Agrobacterium-mediated transgenic method, the above-mentioned pYLCRISPR-Cas9-CRC knockout vector was introduced into wild-type Zhonghua 11 cells, and targeted knockout was achieved in wild-type Zhonghua 11. CRC Gene, obtain a knockout homozygous mutant with one A base inserted at the first target site and two TC bases deleted at the second target site. crc ,like Figure 1 As shown in Figure A.

[0039] During the 11-month grain-filling stage of the wild-type, the wild-type and... crc The plants and spikelets of the homozygous mutant were photographed.

[0040] Phenotypes such as Figure 1 As shown in A~1D crc The homozygous mutant has a longer growth period and shorter ears compared to the wild type. Grain shape and rice grain shape were examined in both wild-type and homozygous mutants after harvest. Figure 1 (E and 1F), found that compared to the wild type, crc The grains of the homozygous mutant were significantly shorter and narrower.

[0041] Example 2 crc Cytological observation of spikelet sections of mutant and wild type.

[0042] For those that have completed development but have not yet flowered crc The spikelets of homozygous mutants and wild-type rice were cross-sectioned, sliced, and subjected to cytological observation.

[0043] The results are as follows Figure 2 As shown. crc The spikelets of the homozygous mutant were significantly shorter and narrower. Figure 2 A and 2B), the perimeter decreases ( Figure 2 D); Cell number and length analysis showed that: crc The number of glume cells in the homozygous mutant is significantly reduced. Figure 2 E), while cell length was essentially the same ( Figure 2 F).

[0044] Example 3 crc Electron micrographs of mutant and wild-type rice husks.

[0045] For mature crc Electron microscopy was performed on grain slides of homozygous mutant and wild-type rice to observe the size of cells on the surface of the husk.

[0046] The results are as follows Figure 3 As shown. Compared to the wild-type medium-flowered 11, crc The cell length on the surface of the grain husk in homozygous mutants did not change significantly. Figure 3 There were no significant differences in cell width (A~3C). Figure 3 (A, 3B, and 3D), while the number of transverse cells was significantly reduced ( Figure 3 (A, 3B, and 3E). Explanation crc The difference in grain size between the homozygous mutant and the wild-type Zhonghua 11 is due to changes in cell number, rather than differences in cell size.

[0047] Example 4 crc Appearance quality of mutant and wild-type rice grains.

[0048] Harvest after maturity crc The mutant and wild-type grains were milled into polished rice, and the differences in appearance and quality were observed.

[0049] The results are as follows Figure 4 As shown. crc The mutant rice grains are shorter and narrower than those of the wild type, and the grains are smaller; the chalky rice rate is significantly reduced, and it has better appearance quality.

[0050] In summary, the present invention CRC This gene regulates rice grain shape; mutations in this gene can shorten grain length, narrow grain width, extend the growth period, and improve the appearance and quality of the rice. By knocking out... CRC Genes can be used to genetically improve the shape and quality of rice grains.

[0051] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0052] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. The application of downregulation of a gene that regulates rice grain shape or downregulation of a protein that regulates rice grain shape in regulating rice grain shape or rice grain growth period; The gene that regulates rice grain shape is CRC The gene, with its sequence shown in SEQ ID NO: 1; The amino acids of the protein that regulates rice grain shape are encoded by the gene that regulates rice grain shape, and the sequence of the amino acids is shown in SEQ ID NO: 2; The regulation of rice grain shape involves shortening and / or narrowing the rice grains, which is achieved by reducing the number of rice grain cells; the regulation of rice grain growth period involves extending the rice grain growth period.

2. The application according to claim 1, characterized in that, The applications include: vectors that target and knock out the gene described in claim 1, transgenic cell lines expressing the vector, and recombinant bacteria expressing the vector, in regulating rice grain shape or regulating rice grain growth period.

3. The application of a gene knockout vector in regulating rice grain shape or rice grain growth period, characterized in that, The gene knockout vector was constructed using the CRISPR-Cas9 system with the sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4 as target sequences. The regulation of rice grain shape involves shortening and / or narrowing the rice grains, which is achieved by reducing the number of rice grain cells; the regulation of rice grain growth period involves extending the rice grain growth period.

4. The application of a rice mutant in regulating rice grain shape or rice grain growth period, characterized in that, This rice mutant CRC The gene has an insertion of an A base between adjacent A and T bases in the sequence shown in SEQ ID NO: 3 of the first exon, and a deletion of adjacent T and C bases in the sequence shown in SEQ ID NO: 4 of the second exon; the rice mutant described above. CRC The gene sequence is shown in SEQ ID NO: 1; The regulation of rice grain shape involves shortening and / or narrowing the rice grains, which is achieved by reducing the number of rice grain cells; the regulation of rice grain growth period involves extending the rice grain growth period.

5. The method for preparing the rice mutant according to claim 4, characterized in that, Includes the following steps: Constructing gene knockout vectors: Using the CRISPR-Cas9 system, with the sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4 as target sequences, and the sequences shown in SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8 as primers, the corresponding nucleotide fragments were obtained, and gene knockout vectors were constructed. Preparation of rice mutants: The gene knockout vector was introduced into rice cells for targeted knockout. CRC Genes were used to obtain rice mutants.

6. A method for regulating the growth period of rice grains by shortening and / or narrowing the grain size or extending the grain growth period, characterized in that, The genetic engineering breeding method or hybridization breeding method is used to downregulate the gene that regulates rice grain shape as described in claim 1 or the protein that regulates rice grain shape as described in claim 1, wherein the genetic engineering breeding method includes obtaining a rice mutant using the preparation method described in claim 5; The hybridization breeding method includes: hybridizing the rice mutant with wild-type rice.

Images