HLA-associated CMV pp65 epitope vaccine composition and application

Abstract

The present invention belongs to the field of biotechnology and specifically provides a CMV pp65 epitope vaccine composition and application associated with HLA. The pp65 epitope is one or more combinations of different specific short peptide epitopes, and the encoding nucleotide sequences of the specific short peptides are shown as pp65-EP1, pp65-EP2, pp65-EP3, pp65-EP4, pp65-EP5, pp65-EP6-1, pp65-EP6-2, pp65-EP7, pp65-EP8, or pp65-EP9. The present invention also provides corresponding pp65 epitope amino acid sequences, vectors containing the encoding nucleotide sequences, cells transduced with the amino acid sequences, nucleotide sequences, or vectors, and single or multiple pp65 epitope compositions. These compositions are used to prepare therapeutic vaccines for treating tumors, particularly with good therapeutic effects on brain gliomas and subcutaneous breast cancer tumors.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a human cytomegalovirus (CMV) pp65 short peptide epitope vaccine that is highly associated with human leukocyte antigen (HLA) and related applications. Background Art

[0002] CMV is a ubiquitous beta herpes virus with a high infection rate in the human population (Marshall M, et al., Viruses. 2020; 12(6): 683). It is latent in individuals with normal immune function and manifests as asymptomatic infection. However, in individuals with impaired immune function, such as patients receiving organ or stem cell transplants, HIV-infected people, and congenitally infected newborns, CMV will be reactivated, causing related serious diseases and threatening people's life and health (Liu Engerman P, et al., Clinical Infectious Diseases, 2017; 64(1): 87-911; Ulrich Gedman, et al., Molecular Therapy, 2013, 21(11): 2113-2121). In addition, CMV activation is associated with malignant tumors such as glioma and melanoma. In tumor tissue from patients with gliomas, the CMV-pp65 gene is expressed in approximately 86-90% of tissues; in melanoma patients, the expression rate of the CMV-pp65 gene in tumor tissue is approximately 69.7%, and it exhibits strong immunogenicity. Therefore, pp65 vaccines are universally applicable to these tumors. Research by VBI Vaccines in the United States has shown that vaccines targeting CMV pp65 can significantly prolong the survival of patients with gliomas (https: / / www.businesswire.com / ). Furthermore, CMV activation is closely associated with aging. CD4 CTLs from human skin specifically eliminate HCMV-senescent fibroblasts in an HLA-II-dependent manner, thereby delaying aging. Therefore, vaccines targeting CMV pp65 could be used to treat CMV-related infections, tumors, and aging.

[0003] The in vivo cellular immune response to the CMV pp65 epitope relies on: 1. CD8+ T cells recognizing and binding to the pp65 epitope presented by HLA molecules, with HLA-dependent antigenic specificity; and 2. Binding of the TCR on the CD8+ T cell membrane to the HLA-pp65 epitope complex activates its cytotoxic function. HLA, located on the short arm of chromosome 6, is one of the most researched regions in the human genome and is currently the most complex and polymorphic genetic system. Therefore, vaccines synthesizing single or multiple pp65 epitope combinations are crucial for the targeted treatment of patients with CMV-related diseases. Summary of the Invention

[0004] The purpose of the present invention is to provide a human HLA-associated CMV pp65 epitope vaccine and application technology, so that it can efficiently target tumor tissue and exert anti-tumor effects.

[0005] On the one hand, the present invention provides a specific short peptide of a CMV pp65 epitope associated with HLA, the encoding nucleotide sequence of the specific short peptide including at least one group selected from pp65-EP1, pp65-EP2, pp65-EP3, pp65-EP4, pp65-EP5, pp65-EP6-1, pp65-EP6-2, pp65-EP7, pp65-EP8 or pp65-EP9.

[0006] In a second aspect, the amino acid sequence of the specific short peptide provided by the present invention includes at least one group selected from pp65-EP1, pp65-EP2, pp65-EP3, pp65-EP4, pp65-EP5, pp65-EP6-1, pp65-EP6-2, pp65-EP7, pp65-EP8 or pp65-EP9.

[0007] In the present invention, italics (such as pp65-EP1) represent nucleotide sequences, and straight text (such as pp65-EP1) represents the corresponding amino acid sequence.

[0008] In a third aspect, the present invention provides a vector comprising one or more of the aforementioned coding nucleotide sequences, or one or more of the aforementioned amino acid sequences, or a nucleotide sequence encoding one or more of the aforementioned amino acid sequences.

[0009] In a fourth aspect, the present invention further provides a vector, which is a viral vector.

[0010] Specifically, the vector is a retroviral vector or a lentiviral vector.

[0011] In a fifth aspect, the present invention also provides a nucleic acid molecule comprising one or more of the above-mentioned coding nucleotide sequences.

[0012] In a sixth aspect, the present invention further provides a cell that transduces the amino acids corresponding to the above-mentioned encoding nucleotide sequence, the above-mentioned nucleic acid molecule or any of the above-mentioned vectors, and is capable of presenting them to T cells.

[0013] Specifically, the cells of the present invention are DC cells.

[0014] In a seventh aspect, the present invention also provides a pp65 DNA vaccine and / or RNA vaccine targeting brain glioma or breast cancer, wherein the vaccine contains one or more groups of the above-mentioned encoding nucleotide sequences.

[0015] Specifically, the present invention is to formulate the DNA or RNA into nanoparticles for delivery.

[0016] In an eighth aspect, the present invention also provides a pp65 polypeptide vaccine targeting brain glioma or breast cancer, wherein the vaccine contains one or more groups of the amino acid sequence described in claim 1.

[0017] In a ninth aspect, the present invention further provides a vaccine composition, which is prepared from a combination of one or more epitopes in the pp65 epitope, and the vaccine is a pp65 vaccine for treating tumors.

[0018] Specifically, the vaccine is a pp65 vaccine targeting brain glioma or breast cancer.

[0019] More specifically, the vaccine composition comprises a DNA vaccine and / or an RNA vaccine.

[0020] In a tenth aspect, the present invention provides the use of any of the above-mentioned pp65 epitope encoding nucleotides, the nucleic acid molecules, the cells, the vectors or any vaccine compositions in the preparation of tumor treatment vaccines.

[0021] Specifically, the tumor is glioma or breast cancer.

[0022] In an eleventh aspect, the present invention provides an isolated dendritic cell comprising any of the aforementioned pp65 epitope encoding nucleotides or one or more messenger RNA species transcribed in vitro from any of the nucleic acid vectors.

[0023] In a twelfth aspect, the present invention provides a dendritic cell vaccine composition comprising the above-mentioned isolated dendritic cells.

[0024] In a thirteenth aspect, the present invention provides a pharmaceutical composition comprising one or more pharmaceutically acceptable excipients, diluents and carriers of the aforementioned pp65 epitope encoding nucleotides, or the aforementioned isolated dendritic cells.

[0025] Specifically, the pharmaceutical composition is a drug for regulating the increase of CD8+ cytolytic T lymphocytes.

[0026] In a fourteenth aspect, the present invention further provides a method for preparing mature DC cells loaded with pp65 antigen epitopes, the method comprising the following steps:

[0027] (1) synthesizing the pp65 epitope antigen according to claim 1 for subsequent co-culture with DC cells;

[0028] (2) Collection of peripheral blood mononuclear cells: Mononuclear cells were purified from the collected peripheral blood using density gradient centrifugation with lymphocyte separation medium, and then washed with serum-free medium to obtain PBMCs with a purity of more than 90%;

[0029] (3) Culture of DC cells: Adjust the PBMC cell concentration with serum-free culture medium and incubate in an incubator to allow monocytes to adhere to the wall; wash away the suspended cells, add serum-free culture medium containing 500-1,000 U / ml recombinant human GM-CSF and 500 U / ml recombinant human IL-4 to the adherent cells, and culture in an incubator to induce monocytes to differentiate into DC cells; change half the medium every 2-3 days and replenish cytokines; on the 5th day of culture, add the tumor antigen obtained in step 2 to load the DC with antigen; on the 6th day of culture, add recombinant human TNF-α, IL-1b, IL-6 and PGE2 to induce DC cell maturation; on the 8th day of culture, harvest the DC cells loaded with the pp65 epitope.

[0030] The HLA-associated CMV pp65 epitope vaccine and its application in the present invention have the following advantages:

[0031] The present invention screened and obtained the pp65 epitope peptide sequence that is closely related to the HLA site. The pp65 epitope peptide sequence obtained by the present invention can more efficiently target and treat CMV-related tumors, reducing off-target risks and safety hazards.

[0032] The present invention introduces the pp65 epitope or its encoding nucleic acid sequence into DCs, enabling enhanced cellular immunity and triggering a killing response. The product or method of the present invention can be applied to the development of CMV pp65 epitope vaccines, which can induce cellular immunity and exert anti-tumor or anti-aging effects, representing a precise, efficient, and novel biotherapy.

[0033] The present invention provides a CMV pp65 epitope vaccine composition associated with Chinese HLA, as well as a pp65 epitope amino acid sequence, a nucleotide sequence encoding the pp65 epitope, a vector containing the nucleotide sequence, a cell transduced with the amino acid sequence or the nucleic acid sequence or the vector, and a single pp65 epitope or a composition of multiple epitopes, which are used to prepare therapeutic vaccines for treating tumors, and have good therapeutic effects, especially on brain gliomas and subcutaneous breast cancer tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0035] Figure 1 It is the sequence map of the HLA loci of the Chinese population related to the pp65 gene in each epitope map of pp65;

[0036] Figure 2 This is an ELISpot analysis of DC cells loaded with CMV pp65 epitope after co-culture with the blood of glioma patient A.

[0037] Figure 3 This is an ELISpot analysis of DC cells loaded with CMV pp65 epitope after co-culture with B blood of breast cancer patients.

[0038] Figure 4 Schematic diagram of the polypeptide vaccine of Example 4 of the present invention inhibiting the growth of brain glioma in mice.

[0039] Figure 5 This is a schematic diagram of the polypeptide vaccine of Example 4 of the present invention inhibiting the growth of breast cancer in mice. DETAILED DESCRIPTION

[0040] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0041] The present invention generally relates to vaccine design, specifically including: CMV pp65 epitopes (DNA, RNA, short peptides, proteins, cells) associated with Chinese HLA, vaccine compositions, and corresponding drugs. The present invention downloads all HLA loci of the Chinese population from a database and uses the online website DTU Health Tech (Bioinformatic Tools and Services - DTU Health Tech) to screen for pp65 epitope peptide sequences closely associated with HLA loci. This decomposes a large pp65 gene sequence into multiple sequences encoding pp65 epitope short peptides. The present invention obtains sequences that more effectively target CMV-related tumors, reducing off-target risks and potential safety hazards. This represents a precise, efficient, novel, and safe biotherapy.

[0042] As used in the present embodiments, the terms "nucleic acid," "nucleotide," "nucleic acid molecule," "nucleotide sequence," and the plural form are used interchangeably to refer to a variety of molecules, including single-stranded and double-stranded DNA and RNA molecules, cDNA sequences, and genomic DNA sequences including exons and introns. The nucleotides of the present invention may also include known analogs of naturally occurring nucleotides that have similar properties to the referenced naturally occurring nucleic acid.

[0043] The nucleotides of the present invention can be cloned, synthesized, altered, mutagenized, or a combination thereof. Standard recombinant DNA and molecular cloning techniques for isolating and modifying nucleic acids are known in the art. Site-specific mutagenesis for producing base pair changes, deletions, or small insertions is also known in the art.

[0044] The term "vector" as used in the present invention for the purpose of the specification and claims refers to a vehicle for introducing and expressing a desired gene product (e.g., an antigen) in a cell according to the present invention. As known to those skilled in the art, such vectors can be easily selected from plasmids, phages, viruses, and retroviruses. Typically, vectors compatible with the present invention will contain a selection marker, suitable restriction sites to facilitate cloning of the desired gene, and the ability to enter eukaryotic or prokaryotic cells and / or replicate in eukaryotic cells.

[0045] In the present invention, the term "viral vector" refers to a virus or viral particle that contains a polynucleotide to be delivered into a host cell in vivo, ex vivo or in vitro. According to experimental preference, the present invention uses a retroviral vector and a lentiviral vector, respectively.

[0046] In order to obtain an antigen-specific vaccine for enhancement, the present invention provides a CMV pp65 epitope associated with HLA, wherein the pp65 epitope is one or more combinations of 9 different specific short peptide epitopes.

[0047] The encoding nucleotide sequences of the different specific short peptides are as follows:

[0048] pp65-EP1:GTACTGGGTC CCATTTCGGG GCACGTGCTG AAAGCCGTGT TTAGTCGCGGCGATACGCCG GTGCTG(na 66)

[0049] pp65-EP2:CGACTCCTGC AGACGGGTAT CCACGTACGC GTGAGCCAGC CCTCGCTGATCCTGGTGTCG(na 60)

[0050] <h2 style=";text-align:left;direction:ltr">pp65-EP3:AGCCAAGAGC CCATGTCGAT CTATGTGTAC GCGCTGCCGC TCAAGATGCTGAACATCCCC AGCATCAACG TGCACCACTA C(na 81)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0051] <h2 style=";text-align:left;direction:ltr"> pp65-EP4:ACGGTCTCGG GACTGGCCTG GACGCGTCAG CAGAACCAGT GGAAAGAGCCCGACGTCTAC TACACGTCAG CGTTCGTGTT TCCCACCAAG GACGTGGCAC TG(na 102)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0052] <h2 style=";text-align:left;direction:ltr"> pp65-EP5:ATGACCCGCA ACCCGCAACC CTTCATGCGC CCCCACGAGC GCAACGGCTTTACGGTGTTG(na 60)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0053] <h2 style=";text-align:left;direction:ltr"> pp65-EP6-1:CTGTTGATGA ACGGGCAGCA AATCTTCCTG GAGGTACAAG CGATACGCGAGACCGTGGAA CTGCGT(na 66)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0054] <h2 style=";text-align:left;direction:ltr"> pp65-EP6-2:CAAGCGATAC GCGAGACCGT GGAACTGCGT CAGTACGATC CCGTGGCTGCGCTCTTCTTT TTCGATATCG ACTTGTTGCT G(na 81)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0055] <h2 style=";text-align:left;direction:ltr"> pp65-EP7:AGCGAGCACC CCACCTTCAC CAGCCAGTAT CGCATCCAGG GCAAGCTTGAGTACCGA(na 57)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0056] <h2 style=";text-align:left;direction:ltr"> pp65-EP8:CTGGCCCGCA ACCTGGGTGCC CATGGTGGCT ACGGTTCAGG GTCAGAATCT GAAG(na 54)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0057] <h2 style=";text-align:left;direction:ltr"> pp65-EP9:TTCTTCTGGG ACGCCAACGA CATCTACCGC ATCTTCGCCG AATTGGAAGGCGTATGGCAG CCCGCTGCGC AACCCAAA(na 78)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0058] The amino acid sequences of the different specific short peptides are as follows (pp65-EP1, pp65-EP2, pp65-EP3, pp65-EP4, pp65-EP5, pp65-EP6-1, pp65-EP6-2, pp65-EP7, pp65-EP8, pp65-EP9 containing italic characters in the present invention represent nucleotide sequences, and the pp65-EP1, pp65-EP2, pp65-EP3, pp65-EP4, pp65-EP5, pp65-EP6-1, pp65-EP6-2, pp65-EP7, pp65-EP8, pp65-EP9 corresponding to them are the corresponding amino acid sequences):

[0059] pp65-EP1:VLGPI SGHVL KAVFS RGDTP VL(aa 22)

[0060] pp65-EP2:RLLQT GIHVR VSQPS LILVS(aa 20)

[0061] pp65-EP3:SQEPM SIYVY ALPLK MLNIP SINVH HY(aa 27)

[0062] pp65-EP4:TVSGL AWTRQ QNQWK EPDVY YTSAF VFPTK DVAL(aa 34)

[0063] pp65-EP5:MTRNP QPFMR PHERN GFTVL(aa 20)

[0064] pp65-EP6-1:LLMNG QQIFL EVQAI RETVE LR(aa 22)

[0065] pp65-EP6-2:QAIRE TVELR QYDPV AALFF FDIDL LL(aa 27)

[0066] pp65-EP7:SEHPT FTSQY RIQGK LEYR(aa 19)

[0067] pp65-EP8:LARNL VPMVA TVQGQ NLK(aa 18)

[0068] pp65-EP9:FFWDA NDIYR IFAEL EGVWQ PAAQP K(aa 26)

[0069] The present invention also provides the use of nucleic acid molecules containing one or more groups of the above-mentioned encoding nucleotide sequences and vectors or vaccine compositions containing one or more groups of the above-mentioned encoding nucleotide sequences in the preparation of tumor therapeutic vaccines.

[0070] The term "vaccine composition" includes a composition (DNA, RNA, protein peptide) corresponding to any specific short peptide provided by the present invention, which encodes at least one target antigen requiring an immune response, and the target antigen comprises a target antigen and at least one specific short peptide that determines the processing and presentation of the antigen. The vaccine composition may optionally include a pharmaceutically acceptable carrier that can be used to induce an immune response in a host (subject). In some embodiments other than the examples of the present invention, the vaccines and vaccine compositions of the present invention can be provided as "multivalent vaccines". In certain embodiments in which the vaccine composition is in the form of an RNA vaccine, the RNA vaccine is obtained by in vitro transcription of a DNA vector.

[0071] In the present invention, the term "antigen" refers to a substance that can be recognized by the immune system and can induce an antigen-specific immune response by forming antibodies and / or antigen-specific T cells. Generally, an antigen can be a protein or polypeptide that contains at least one antigenic epitope and can be presented on the surface of T cells by the major histocompatibility complex (MHC). In the present invention, an antigen can be a product of mRNA translation or a product of DNA transcription and translation.

[0072] In an embodiment of the present invention, the present invention provides mRNA vaccines and mRNA-based cell vaccines. This includes delivering mRNA vaccines directly into human subjects, or transfecting mRNA into dendritic cells (DC), B cells, peripheral blood mononuclear cells and any other cell populations. The present invention also provides nucleic acid vaccines (DNA and RNA / mRNA) encoding specific short peptides of the present invention. Nucleic acid vaccines are vaccines containing antigens encoded by DNA or RNA (mRNA). In the present invention, nucleic acid vaccines are provided as vaccine compositions. For the polypeptide vaccines of the present invention, the peptides or polypeptides are expressed from the encoding nucleotides corresponding to any specific polypeptide described in the present invention and can be used in any method described in the present invention. All vaccines encoding infectious and pathological antigens designed by the present invention will produce translation products in the form of peptides and / or polypeptides in vivo. The vaccine preparation technology is known in the art, and the present invention provides specific short peptides of the above-mentioned amino acid sequences or specific short peptides of nucleotide sequences synthesized accordingly.

[0073] In an embodiment of the present invention, the present invention further provides a "cell", which contains the nucleic acid described in the first aspect, and the nucleic acid can be expressed and / or translated in the cell, thereby producing the specific short peptide described in the second aspect of the present invention.

[0074] In an embodiment of the present invention, the present invention further provides isolated dendritic cells comprising one or more messenger RNA (mRNA) species transcribed in vitro from any of the specific short peptides described herein or from the nucleic acid vectors described herein. Furthermore, the present invention provides a dendritic cell vaccine composition comprising the isolated dendritic cells described herein.

[0075] In an embodiment of the present invention, the present invention also provides a pharmaceutical composition that can provide one or more antigens (preferably immunogens) to a subject in need thereof for alleviating, relieving, delaying or curing a subject's condition or illness. Compared to a drug that provides an antigen alone, the pharmaceutical composition of the present invention has an enhanced, improved or strengthened immune capacity. The pharmaceutical composition of the present invention comprises at least one antigen or a nucleic acid encoding the antigen, and the nucleotides described in the first aspect or the amino acids described in the second aspect. Alternatively, other ingredients may also be included, such as a pharmaceutically acceptable carrier.

[0076] Example 1: Preparation of mature DC cells loaded with pp65 antigen epitopes

[0077] Synthesis of pp65 epitope antigens: pp65-EP1, pp65-EP2, pp65-EP3, pp65-EP4, pp65-EP5, pp65-EP6-1, pp65-EP6-2, pp65-EP7, pp65-EP8, and pp65-EP9 antigen peptides were synthesized at Sangon Biotech (Shanghai) Co., Ltd. for subsequent co-culture with DC cells.

[0078] Collection of peripheral blood mononuclear cells: First, 50-100 ml of peripheral blood was collected from patients A and B respectively, and the mononuclear cells (PBMC) were purified by density gradient centrifugation using lymphocyte separation medium. Then, the cells were washed twice with serum-free medium to obtain PBMC with a purity of more than 90%.

[0079] DC cell culture: adjust the PBMC cell concentration to 2x10 6 / ml, placed in a culture flask, and incubated in a 37°C, 5% CO2 incubator for 2 hours to allow the monocytes to adhere; the suspended cells were washed away, and serum-free culture medium containing recombinant human GM-CSF (500-1,000U / ml) and recombinant human IL-4 (500U / ml) was added to the adherent cells, and cultured in a 37°C, 5% CO2 incubator to induce monocyte differentiation into DC cells; half of the medium was replaced every 2-3 days, and cytokines were supplemented; on the 5th day of culture, 50 mg / ml of the tumor antigen obtained in step 2 was added to load the DC with antigen; on the 6th day of culture, recombinant human TNF-α (10ng / ml), IL-1b (10ng / ml), IL-6 (1000U / ml) and PGE2 (1mg / ml) were added to induce DC cell maturation; on the 8th day of culture, the pp65 epitope-loaded DC cells were harvested.

[0080] Example 2: Mature DC cells loaded with pp65 epitopes stimulate lymphocytes in the blood of glioma patient A to produce cytotoxic T lymphocytes

[0081] Autologous CD8+ T cell separation: Isolate peripheral blood mononuclear cells from glioma patient A, add an appropriate amount of pre-cooled cell sorting buffer to the PBMC to wash the PBMC, centrifuge at 300g for 8 minutes, discard the supernatant, add an appropriate amount of pre-cooled cell sorting buffer, and adjust the PBMC concentration to 10 8 cells / ml, ice bath for 5 minutes; add biotinylated antibody to PBMC at a ratio of 20 μL biotinylated antibody / ml PBMC, mix thoroughly and incubate at 4°C for 15 minutes; after incubation, add cell sorting buffer, centrifuge at 300g for 8 minutes, discard the supernatant, and adjust the PBMC concentration to 10 with cell sorting buffer. 8 / ml; add streptavidin magnetic beads to PBMC at a ratio of 20 μL magnetic beads / ml PBMC, mix well, and incubate at room temperature for 10 minutes; after incubation, add 2.5 ml cell separation buffer, mix well, and use a magnetic pole to magnetically attract for 3 minutes to remove the unattracted liquid, add an appropriate amount of pre-cooled cell sorting buffer to the collected cells, centrifuge at 300g for 8 minutes, discard the supernatant, and the resulting precipitate is the CD8+ T cell.

[0082] ELISPOT detection of the ability of CD8+ T cells to secrete IFN-γ: Day 1: Use sterile PBS to dilute the coated antibody 1-D1K to 15μg / ml (1.5μg / 100μL); take out the 96-well plate and add 15μL of 35% ethanol to each well for 2 minutes; wash the plate 5 times with sterile water (filtered with a 0.22μm filter), adding 200μL to each well each time; after the last wash, discard the liquid and gently dry it on sterile paper; add 100μL of diluted 1-D1K antibody solution to each well and incubate at 4-8℃ overnight. Day 2: Add 200μL of 1% BSA to each well and incubate at room temperature for 30min; remove the blocking solution and add 50μL of negative control, positive control and DC cells loaded with different antigens to the appropriate wells; add 50μL of cell culture medium to each well, 2*10 5 cell / mlCD8+T cells, tap the edge of the plate to spread the cells evenly, then place in an incubator, 37°C, 5% CO2 for 8 days. After that, remove the cells in the wells, wash with PBS+0.05% Tween-20 to completely remove the cells, add 100μL 7-B6-1-biotin detection antibody to each well, incubate at 37°C for 2h, wash; add 100μL streptavidin-HRP to each well, incubate at room temperature for 1h, wash; add substrate TMB, 100μL per well, until clear spots appear. Terminate the color development reaction with deionized water, remove excess liquid, protect from light overnight, and dry thoroughly. Observe using a plate reader. The results are as follows Figure 2 As shown in the results, DC cells loaded with pp65-EP1, EP2, EP3, EP4, EP5, EP6-1, EP6-2, EP7, EP8, and EP9 all stimulated CD8+ T cells to secrete IFN-γ to varying degrees, indicating that the surface of DC cells loaded with pp65 epitopes can normally express EP1, EP2, EP3, EP4, EP5, EP6-1, EP6-2, EP7, EP8, and EP9 antigen peptides, thereby being specifically recognized by CD8+ T cells in the patient's body and activated to produce cytotoxic T lymphocytes.

[0083] Example 3: Mature DC cells loaded with pp65 epitopes stimulate B lymphocytes in the blood of breast cancer patients to produce cytotoxic T lymphocytes

[0084] The specific operation steps of isolating B peripheral blood mononuclear cells from breast cancer patients, isolating autologous CD8+ T cells and detecting CD8+ T cell activation by ELISPOT are the same as those in Example 2. The ELISPOT results are as follows: Figure 3The results showed that pp65-EP1, EP2, EP3, EP4, EP5, EP6-1, EP6-2, EP7, EP8, and EP9-loaded DC cells could stimulate CD8+ T cells to secrete IFN-γ, indicating that pp65 epitope-loaded DC cells can normally stimulate CD8+ T cell immune activation in breast cancer patients.

[0085] Example 4: Preparation of polypeptide vaccine and treatment plan

[0086] 1. Establishment of human cell lines expressing peptides

[0087] The methods of Example 2 and Example 3 were used to establish a glioma-producing cytotoxic T lymphocyte line loaded with the pp65 epitope and a breast cancer-producing cytotoxic T lymphocyte line loaded with the pp65 epitope, and to construct a glioma model and a breast cancer model expressing the pp65 epitope cell line, respectively.

[0088] 2. Human immune reconstitution in NOD / SCID mice

[0089] Anticoagulated peripheral blood was collected from healthy volunteers, peripheral blood mononuclear cells (PBMC) were separated, and the cells were collected for use.

[0090] 200 NOD SCID mice were excluded from immune leakage, and 2×10 PBMCs were injected into each mouse intraperitoneally. 7 4 weeks after the successful immune reconstitution, mice were selected for inoculation into brain glioma and breast cancer models.

[0091] 3. Construction of glioma and breast cancer models

[0092] Established glioma and breast cancer models were cultured in DMEM supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin in an incubator at 37°C with 5% CO2. Tumor cells were harvested. Forty microliters of cell suspension were added to 10 microliters of 0.4% trypan blue for staining and microscopic counting. Appropriate dilutions were made to a concentration of 1×10 8 Cells / ml of tumor cell suspension were used to subcutaneously inoculate 100 μL of the tumor cell suspension into immune-reconstituted NOD / SCID mice. Following inoculation, the inoculation site was observed daily for infection and tumor growth. After 7 days, subcutaneous tumors approximately 4-7 mm in size were palpable in the mice, demonstrating successful establishment of NOD / SCID mouse models for subcutaneous glioma and breast cancer.

[0093] 5. Preparation of peptide vaccines

[0094] pp65-EP1, EP2, EP3, EP4, EP5, EP6-1, EP6-2, EP7, EP8, and EP9 polypeptides are synthesized and polypeptide vaccines are prepared. The preparation is completed by sending the polypeptides to external cooperative enterprises using existing technologies.

[0095] NOD / SCID mice with a subcutaneous glioma model that had been immune reconstituted for 4 weeks were randomly divided into 4 groups: an adjuvant group, an adjuvant + irrelevant peptide group, an adjuvant + pp65 peptide combination group (a combination of pp65-EP1, EP2, EP3, EP4, EP5, EP6-1, EP6-2, EP7, EP8, and EP9 synthesized in this application), and an adjuvant + pp65-EP8 peptide group, with 20 mice in each group. The initial immunization dose for the irrelevant peptide group and the peptide combination was 100 μl / mouse. After resuspending the above-mentioned peptide in PBS, it was mixed with 150 μl / mouse of Freund's complete adjuvant, adjusted to 300 μl / mouse with PBS, and injected subcutaneously at two points on the back. Two weeks later, the same dose was used for booster immunization (complete Freund's adjuvant was used for the first time, and incomplete Freund's adjuvant was used thereafter), for a total of 4 immunizations. After the injection, the vital signs of the mice were observed, and the tumor size was measured with a vernier caliper every 2 days. The average value of the test was taken and the results are shown in the attached instructions. Figure 4 .

[0096] The above method was used to continue the experiment on NOD / SCID mice, a breast cancer subcutaneous tumor model. The mice were randomly divided into four groups: an adjuvant group, an adjuvant + irrelevant peptide group, an adjuvant + pp65 peptide combination group (combinations of pp65-EP1, EP2, EP3, EP4, EP5, EP6-1, EP6-2, EP7, EP8, and EP9 synthesized by this application), and an adjuvant + pp65-EP7 peptide group, with 20 mice in each group. Tumor size was measured every two days with a vernier caliper. The average value of the test was calculated and the results are shown in the appendix of the instructions. Figure 5 .

[0097] The unrelated polypeptide group still uses the pp65 gene sequence, and the nucleotide sequence is pp65-EP10: AAACCGGGCAAGATCTCGCACATCATGCTGGATGTGGCTTTTACCTCACACG AGCATTTT. The amino acid sequence is pp65-EP10: KPGKI SHIML DVAFT SHEHF.

[0098] The results showed that compared with the polypeptide vaccine group and adjuvant group loaded with irrelevant polypeptides, the polypeptide vaccine group loaded with adjuvant + specific short peptides of the present invention or a combination of specific short peptides can significantly slow down the growth of mouse tumors and prolong the survival of mice.

[0099] Although preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they are aware of the basic inventive concepts. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the invention. Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the invention. Thus, the present invention is intended to include such changes and modifications as fall within the scope of the claims and their equivalents.

Claims

1. A short peptide specific for an HLA-associated CMV pp65 epitope, characterized in that: The specific short peptide is a polypeptide combination group formed by combining pp65-EP1 polypeptide, pp65-EP2 polypeptide, pp65-EP3 polypeptide, pp65-EP4 polypeptide, pp65-EP5 polypeptide, pp65-EP6-1 polypeptide, pp65-EP6-2 polypeptide, pp65-EP7 polypeptide, pp65-EP8 polypeptide and pp65-EP9 polypeptide. The nucleotide sequence encoding the pp65-EP1 polypeptide is the nucleotide sequence shown in SEQ ID No. 1, the nucleotide sequence encoding the pp65-EP2 polypeptide is the nucleotide sequence shown in SEQ ID No. 2, the nucleotide sequence encoding the pp65-EP3 polypeptide is the nucleotide sequence shown in SEQ ID No. 3, the nucleotide sequence encoding the pp65-EP4 polypeptide is the nucleotide sequence shown in SEQ ID No. 4, the nucleotide sequence encoding the pp65-EP5 polypeptide is the nucleotide sequence shown in SEQ ID No. 5, the nucleotide sequence encoding the pp65-EP6-1 polypeptide is the nucleotide sequence shown in SEQ ID The encoding nucleotide sequence of the pp65-EP6-2 polypeptide is the encoding nucleotide sequence shown in SEQ ID No. 7, the encoding nucleotide sequence of the pp65-EP7 polypeptide is the encoding nucleotide sequence shown in SEQ ID No. 8, the encoding nucleotide sequence of the pp65-EP8 polypeptide is the encoding nucleotide sequence shown in SEQ ID No. 9, and the encoding nucleotide sequence of the pp65-EP9 polypeptide is the encoding nucleotide sequence shown in SEQ ID No.

10.

2. A short peptide specific for an HLA-associated CMV pp65 epitope, characterized in that: The specific short peptide is a polypeptide combination group formed by combining pp65-EP1 polypeptide, pp65-EP2 polypeptide, pp65-EP3 polypeptide, pp65-EP4 polypeptide, pp65-EP5 polypeptide, pp65-EP6-1 polypeptide, pp65-EP6-2 polypeptide, pp65-EP7 polypeptide, pp65-EP8 polypeptide and pp65-EP9 polypeptide, the amino acid sequence of pp65-EP1 polypeptide is the amino acid sequence shown in SEQ ID No.11, the amino acid sequence of pp65-EP2 polypeptide is the amino acid sequence shown in SEQ ID No.12, the amino acid sequence of pp65-EP3 polypeptide is the amino acid sequence shown in SEQ ID No.13, the amino acid sequence of pp65-EP4 polypeptide is the amino acid sequence shown in SEQ ID No.14, the amino acid sequence of pp65-EP5 polypeptide is the amino acid sequence shown in SEQ ID No.15, the amino acid sequence of pp65-EP6-1 polypeptide is the amino acid sequence shown in SEQ ID No.16, the amino acid sequence of pp65-EP6-2 polypeptide is the amino acid sequence shown in SEQ ID The amino acid sequence of the pp65-EP7 polypeptide is shown in SEQ ID No. 17, the amino acid sequence of the pp65-EP8 polypeptide is shown in SEQ ID No. 19, and the amino acid sequence of the pp65-EP9 polypeptide is shown in SEQ ID No.

20.

3. A carrier, characterized in that The vector contains the coding nucleotide sequence according to claim 1, or contains the amino acid sequence according to claim 2, or contains a nucleotide sequence encoding the amino acid sequence according to claim 2.

4. The carrier according to claim 3, characterized in that The vector is a viral vector.

5. The carrier according to claim 3, characterized in that The vector is a retroviral vector or a lentiviral vector.

6. A nucleic acid molecule, characterized in that The nucleic acid molecule contains the coding nucleotide sequence according to claim 1.

7. A cell, characterized in that The cells transduce the amino acids corresponding to the encoding nucleotide sequence of claim 1, the amino acids of claim 2, or the vector of any one of claims 3-5, and are capable of presenting them to T cells; the cells are DC cells.

8. A pp65 DNA vaccine and / or RNA vaccine targeting brain glioma or breast cancer, characterized in that: The vaccine contains the encoding nucleotide sequence of claim 1.

9. A pp65 polypeptide vaccine targeting brain glioma or breast cancer, characterized in that: The vaccine contains the amino acid sequence according to claim 2.

10. A vaccine composition, characterized in that The vaccine composition is prepared from the specific short peptide of the CMV pp65 epitope according to claim 1, and the vaccine is a pp65 vaccine for treating tumors.

11. The vaccine composition according to claim 10, characterized in that The vaccine is a pp65 vaccine targeting brain glioma or breast cancer, and the vaccine composition comprises a DNA vaccine and / or an RNA vaccine.

12. Use of the nucleotide encoding the pp65 epitope of claim 1, the amino acid encoding the pp65 epitope of claim 2, the vector of any one of claims 3 to 5, the nucleic acid molecule of claim 6, the cell of claim 7, or the vaccine composition of any one of claims 10 to 11 in the preparation of a vaccine for treating a tumor, wherein the tumor is a glioma or breast cancer.

13. An isolated dendritic cell, characterized in that Comprising one or more messenger RNA species transcribed in vitro from the pp65 epitope encoding nucleotide sequence of claim 1 or the nucleic acid vector of any one of claims 3-5.

14. A dendritic cell vaccine composition, characterized in that: comprising the isolated dendritic cells according to claim 13.

15. A pharmaceutical composition, characterized in that Comprising one or more pharmaceutically acceptable excipients and carriers of the nucleotide encoding the pp65 epitope according to claim 1, or the isolated dendritic cell according to claim 13.

16. A method for preparing mature DC cells loaded with pp65 antigen epitopes, characterized in that: The method comprises the following steps: (1) synthesizing the specific short peptide of the CMV pp65 epitope according to claim 1 for subsequent co-culture with DC cells; (2) Collection of peripheral blood mononuclear cells: Purify mononuclear cells from the collected peripheral blood using density gradient centrifugation with lymphocyte separation medium, and then wash with serum-free medium to obtain PBMCs with a purity of more than 90%; (3) Culture of DC cells: Adjust the PBMC cell concentration with serum-free culture medium and incubate in an incubator to allow monocytes to adhere to the wall; wash away the suspended cells, add serum-free culture medium containing 500-1000U / ml recombinant human GM-CSF and 500U / ml recombinant human IL-4 to the adherent cells, and culture in an incubator to induce monocytes to differentiate into DC cells; change half the medium every 2-3 days and replenish cytokines; on the 5th day of culture, add the tumor antigen obtained in step 2 to load the DC with antigen; on the 6th day of culture, add recombinant human TNF-α, IL-1b, IL-6 and PGE2 to induce DC cell maturation; on the 8th day of culture, harvest the DC cells loaded with the pp65 epitope.

Images