Method for preparing cat-induced pluripotent stem cells

A method for preparing feline induced pluripotent stem cells (iPSCs) using electroporation transfection with a combination of piggyBac transposon system and specific transcription factors was successfully developed. This method solves the problems of low efficiency and poor safety in the preparation of feline iPSCs in existing technologies, and enables efficient and safe preparation and differentiation of feline iPSCs.

CN118389596BActive Publication Date: 2026-07-21SHANXI AGRI UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANXI AGRI UNIV
Filing Date
2024-04-25
Publication Date
2026-07-21

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently and safely prepare feline induced pluripotent stem cells, and the use of heterologous reprogramming factors and viral vectors poses safety risks.

Method used

Using the piggyBac transposon system, combined with four feline factors OCT4, SOX2, KLF4, and c-MYC, and two feline or porcine factors NANOG and LIN28, as well as monkey kidney virus SV40 LT as a reprogramming factor, feline fetal fibroblasts were transfected via electroporation, and clones that conformed to the characteristics of embryonic stem cells were selected and passaged.

Benefits of technology

We have successfully obtained feline induced pluripotent stem cells (ESCs), which have high reprogramming efficiency, strong safety, and good differentiation potential. They are suitable for studying the in vitro culture conditions and disease mechanisms of feline ESCs and support the breeding of cloned and genetically modified cats.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118389596B_ABST
    Figure CN118389596B_ABST
Patent Text Reader

Abstract

The application discloses a preparation method of cat induced pluripotent stem cells, which comprises the following steps: constructing piggyBac transposon plasmids carrying cat source OCT4, SOX2, KLF4 and c-MYC four factors in series, piggyBac transposon plasmids carrying cat source or pig source NANOG and LIN28 two factors in series and piggyBac transposon plasmids carrying monkey kidney virus SV40LT plasmids, and transfecting the plasmids into cat fetal fibroblasts; picking up cloned cells with embryonic stem cell morphologies, and carrying out subculture of cell clones meeting the characteristics of embryonic stem cells through identification and screening, so that the cat induced pluripotent stem cells are obtained. The preparation method of the cat induced pluripotent stem cells is safe, efficient and has good differentiation potential, lays a scientific foundation for researching in-vitro culture conditions of feline ESCs and establishment of feline iPSCs, and lays a scientific foundation for further cultivating cloned cats and gene modified cats and researching in related disease mechanisms, screening drugs and regeneration and repair.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This invention claims priority to Chinese Patent Application No. 2023104638025, filed on April 26, 2023, entitled "Cat Induced Pluripotent Stem Cells and Preparation Method Thereof", the entire contents of which are incorporated herein by reference. Technical Field

[0002] This invention belongs to the field of stem cell technology, and more specifically, this invention relates to a method for preparing cat induced pluripotent stem cells using cat autologous transcription factors. Background Technology

[0003] In 2006, Takahashi and Yamanaka transfected mouse fibroblasts with a viral vector using a combination of the classic reprogramming four factors OSKM (OCT4, SOX2, KLF4, c-MYC), thus discovering for the first time the reprogramming capability of somatic cells. The resulting stem cells were named induced pluripotent stem cells (iPSCs). iPSCs are not only morphologically similar to embryonic stem cells (ESCs), but also very similar in gene expression, pluripotency maintenance mechanisms, and epigenetic patterns. Theoretically, iPSCs can proliferate indefinitely, forming embryoid bodies in vitro and differentiating into the three germ layers and all cell types. Because iPSCs are obtained through somatic cell reprogramming and can be derived from autologous cells, they do not raise issues of immune rejection or ethical concerns. Therefore, they are considered a good alternative to ESCs in scientific research, clinical applications, and practical use.

[0004] Since the establishment of iPSC lines in mice and humans, studies on establishing iPSCs in other animals through reprogramming have been reported. Different species have varying requirements regarding the types and quantities of reprogramming factors and the reprogramming system required for inducing iPSCs. For example, humans and mice can obtain excellent clones using the four-factor OSKM, but this may not be the case for other species. Sheep can be induced to produce iPSCs using the six-factor (OSKM+NL) method, and adding four more factors further improves the results. However, other species may not be able to induce iPSCs using these six or ten factors from sheep. Therefore, methods for inducing iPSCs in different species cannot be directly copied.

[0005] Cats are popular pets, and the development of cloned cats and the improvement of feline health are increasingly anticipated. Furthermore, cats are excellent biomedical model animals. The establishment of feline iPSCs is a prerequisite for cloning and genetically modified cats, a crucial foundation for further research into disease mechanisms and drug screening at the cellular and animal levels, and a key step in regenerating and repairing damaged feline tissues.

[0006] Current research on the establishment of feline iPSCs is scarce, and the two few reports that exist involve the introduction of heterologous reprogramming factors (mouse OSKM four factors, or human OSKM four factors combined with NANOG factor) into feline fetal fibroblasts via retroviral or lentiviral vectors for induction. Initial clones are formed in 14-18 days, a relatively long cycle. Furthermore, the use of heterologous reprogramming factors and viral vector-mediated induction poses certain safety risks for later applications. Another report also utilizes human OSKM four factors combined with NANOG factor, introduced via retroviral vectors to induce feline adipose-derived fibroblasts. Initial clones are formed in 7-10 days, but the resulting clones differ from other reported feline pluripotent stem cell characteristics, failing to express SSEA4. Therefore, the safety and reprogramming efficiency / effectiveness of feline iPSC induction systems require further improvement. Summary of the Invention

[0007] Based on this, the purpose of this invention is to provide a method for preparing feline induced pluripotent stem cells. Using the preparation method of this invention, feline induced pluripotent stem cells can be successfully obtained by reprogramming feline autologous transcription factors, with high reprogramming efficiency and good differentiation potential.

[0008] The specific technical solutions for achieving the above-mentioned objectives are as follows.

[0009] This invention provides a method for preparing cat induced pluripotent stem cells, comprising the following steps:

[0010] (1) The piggyBac transposon plasmid carrying the four cat-derived factors OCT4, SOX2, KLF4 and c-MYC in tandem, the piggyBac transposon plasmid carrying the two factors NANOG and LIN28 in tandem, and the piggyBac transposon plasmid carrying the monkey kidney virus SV40 LT plasmid were constructed and transfected into cat fetal fibroblasts by electroporation.

[0011] (2) Select clone-like cells with similar morphology to embryonic stem cells, and passage them through identification and screening to obtain the desired cells.

[0012] The present invention has the following beneficial effects:

[0013] In this invention, based on extensive research experience in preparing induced pluripotent stem cells (iPSCs), the inventors, after numerous experiments, ultimately selected four factors—cat-derived OCT4, SOX2, KLF4, and c-MYC—two factors—cat-derived or porcine-derived NANOG and LIN28, and monkey kidney virus SV40 LT—as a combination of reprogramming factors, successfully obtaining feline induced pluripotent stem cells. The method for preparing feline induced pluripotent stem cells in this invention is highly safe, efficient, and exhibits good differentiation potential. It not only lays a scientific foundation for studying the in vitro culture conditions of feline ESCs and the establishment of iPSC lines, but also for further breeding cloned and genetically modified cats, researching disease mechanisms, screening drugs, and preventing and treating feline tissue damage. Attached Figure Description

[0014] Figure 1 This is a morphological diagram of cat fetal fibroblasts isolated in Example 1 of the present invention.

[0015] Figure 2 This is a morphological diagram of the cell clone formation process in Example 1 of the present invention.

[0016] Figure 3 This is a morphological diagram of cells after clone selection and passage culture in Example 2 of the present invention.

[0017] Figure 4 This is a diagram showing the alkaline phosphatase staining results of cat induced pluripotent stem cells in Example 3 of the present invention.

[0018] Figure 5 The mRNA expression levels of the cat induced pluripotent stem cell genes OCT4, SOX2, and NANOG in Example 3 of this invention.

[0019] Figure 6 This is a karyotype analysis diagram of cat induced pluripotent stem cells in Example 3 of the present invention.

[0020] Figure 7 The results show the expression of OCT4, SOX2, and SSEA4, the pluripotency-specific proteins of cat induced pluripotent stem cells, in Example 3 of this invention.

[0021] Figure 8 This is a diagram showing the embryoid body formed from cat induced pluripotent stem cells and the results of in vitro differentiation in Example 3 of the present invention.

[0022] Figure 9 The results show the expression of trigerm-specific proteins after differentiation of cat induced pluripotent stem cells in Example 3 of this invention.

[0023] Figure 10 This is a comparison of the results before and after optimization of the electroporation transfection conditions in Experiment Example 1 of this invention.

[0024] Figure 11This is a graph showing the transfection efficiency when different combinations of heterologous transcription factors are used for reprogramming in Experiment Example 2 of this invention.

[0025] Figure 12 The figure shows the result of reprogramming using the pOSKM+pNL+hRL combination in Experiment Example 3 of this invention.

[0026] Figure 13 This is the observation result of the clonal status of cat stem cells after reprogramming using different combinations of transcription factors in Experiment Example 3 of the present invention.

[0027] Figure 14 The initial number of clones induced by the seven factors cOSKM+pNL+SV40LT and cOSKM+cNL+SV40LT in Experimental Example 3 of this invention. Detailed Implementation

[0028] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0029] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.

[0030] Unless otherwise specified, experimental methods in the following examples were performed under standard conditions, such as those described in Green and Sambrook et al., *Molecular Cloning: A Laboratory Manual* (2013), or as recommended by the manufacturer. All commonly used chemical reagents used in the examples are commercially available products.

[0031] Based on years of research experience in induced pluripotent stem cells, the inventors of this invention have discovered that when using a combination of heterologous (such as sheep or pig) transcription factors to reprogram fetal fibroblasts, it is difficult to form embryonic stem cell-like clones and thus impossible to obtain feline induced pluripotent stem cells. Building upon this foundation, the inventors further utilized the piggyBac transposon system as a vector to reprogram feline fetal fibroblasts using various combinations of feline transcription factors, feline-human transcription factors, feline-porcine transcription factors, and feline-porcine-human transcription factors. After transfection, cell clone morphology and passage culture results were observed. It was found that only by using a tandem combination of four feline factors (OCT4, SOX2, KLF4, and c-MYC), two tandem feline or porcine factors (NANOG and LIN28), combined with monkey kidney virus SV40 LT as a reprogramming factor combination, feline fetal fibroblasts could be successfully reprogrammed, establishing stably passageable feline induced pluripotent stem cells (iPSCs). The combination of six feline factors with SV40 LT resulted in a higher number of stem cell clones and better reprogramming efficiency. The cat iPSCs obtained using the preparation method of this invention have normal morphology, high nucleoplasm-to-cytoplasm ratio, clear margins, and are positive for alkaline phosphatase staining. Immunocytochemistry confirms the expression of pluripotency proteins, and qRT-PCR confirms the expression of pluripotency genes. They can form embryoid bodies and differentiate in vitro, and positively express trigerm layer marker proteins. In vitro passages have exceeded 20 generations.

[0032] In some embodiments of the present invention, a method for preparing cat induced pluripotent stem cells is disclosed, comprising the following steps:

[0033] (1) The piggyBac transposon plasmid carrying the four cat-derived factors OCT4, SOX2, KLF4 and c-MYC in tandem, the piggyBac transposon plasmid carrying the two factors NANOG and LIN28 in tandem, and the piggyBac transposon plasmid carrying the monkey kidney virus SV40 LT plasmid were constructed and transfected into cat fetal fibroblasts by electroporation.

[0034] (2) Select clone-like cells with similar morphology to embryonic stem cells, and passage them through identification and screening to obtain the desired cells.

[0035] In some embodiments, the NANOG and LIN28 factors are either feline NANOG and LIN28 factors or porcine NANOG and LIN28 factors, preferably feline NANOG and LIN28 factors.

[0036] In some embodiments, the four feline factors OCT4, SOX2, KLF4, and c-MYC mentioned in step (1) are all linked to the two feline factors NANOG and LIN28 via 2A linker peptides.

[0037] In some embodiments, the feline OCT4 and SOX2 are linked in series via a P2A linker peptide, the feline SOX2 and c-MYC are linked in series via a T2A linker peptide, the feline c-MYC and KLF4 are linked in series via an E2A linker peptide; and / or, the feline NANOG and LIN28 are linked in series via an F2A linker peptide; and / or, the porcine NANOG and LIN28 are linked in series via an F2A linker peptide.

[0038] In some embodiments, the nucleotide sequences of the tandem feline OCT4, SOX2, KLF4, and c-MYC four factors are shown in SEQ ID NO:1, the nucleotide sequences of the tandem feline NANOG and LIN28 two factors are shown in SEQ ID NO:2, and the nucleotide sequences of the tandem porcine NANOG and LIN28 two factors are shown in SEQ ID NO:3.

[0039] SEQ ID NO:1

[0040] GAATTCATGGCGGGACACCTGGCTCCGACTTGGCCTTCTCGCCCCCGCCAGGCGGTGG

[0041] AGGCGATGCGCCGGGAGGGCCGGAGCCCGGCTGGGTTGACCCTCGGACCTGGCTGAGC

[0042] TTCCAAGGCCCTCCCGGCGGGTCAGGAATCGGGCCCGGGGTTGGGCCGGGCGCTGAGG

[0043] TGTGGGGGATTCCCCGTGCCCCCCGCCGTATGAGTTCTGCGGGGGGATGACGTACTGT

[0044] GGGCCTCAGGTTGGAGTGGGGCTGGTGCCCCAAGGCGGCCTGGAGACCTCTCAGCCAG

[0045] AGGGCGAAAGGGGAGCCGGGGTGGAGAGCAACTCCGAGGGGGCCTCCCCTGAGCCCT

[0046] GCGCTGCCCCACCTGGGGCTGTGAAGCCGGACAAGGAGAAGCTGGAGCAAAACACCG

[0047] AGGAGTCCCAGGACATCAAAGCTCTGCAGAAAGACCTGGAACAATTTGCCAAACTCCT

[0048] GAAGCAGAAGGATCACCCTGGGATATACTCAGGCCGATGTGGGGCTCACCCTGGGGG

[0049] GTTCTCTTTGGGAAGGTGTTCAGCCAAACAACCATCTGCCGTTTTGAGGCTTTGCAGCT

[0050] CAGTTTCAAGAACATGTGTAAGCTGCGACCCCTGCTGCAGAAGTGGGTGGAGGAAGCT

[0051] GACAACAACGAAATCTGCAGGAGATATGCAAAGCAGAGACACTTGTGCAGGCCCGAA

[0052] AGAGAAAGCGAACAAGTATCGAGAACCGAGTGAGAGGCAACCTGGAGAACATGTTCCT

[0053] GCAGTGCCCGAAACCCACCCTGCAGCAGATCAGCCACATTGCCCAGCAGCTCGGGCTG

[0054] GAGAAGGATGTGGTCCGAGTGTGGTTCTGCAATCGTCGCCAGAAGGGCAAACGATCAA

[0055] GCAGTGACTATTCGCAACGAGAGGATTTTGAGGCTGCTGGGTCCCCTTTCTCAGGGGCA

[0056] CCAGTATCCTTTCCTCTGGCACCAGGCCCCATTTTGGTACCCCAGGCTATGGAAGCCCT

[0057] CACTTCACTACACTGTACTCCTCAGTCCCTTTCCCTGAGGGTGAAGCCTTTCCCTCTTGTG

[0058] TCTGTTACCACTCTGGGCTCTCCCATGCATTCAAACGCTAGCGGCAGCGGCGCCACAAA

[0059] CTTCTCTCTGCTAAAGCAAGCAGGTGATGTTGAAGAAAACCCCGGGCCTGCATGCATGT

[0060] ACAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGCAGCAAACTTCGGGGGGCG

[0061] GCGGCGGCGGCGGCGGCGGCAACTCCACCGCGGCAGCGGCGGGCGGCAACCAGAAGA

[0062] ACAGCCCGGACCGCGTCAAGCGGCCCATGAACGCCTTCATGGTGTGGTCCCGCGGGCA

[0063] GCGGCGCAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAGCGC

[0064] CTGGGCGCCGAGTGGAAACTTTTGTCGGAGACGGAGAAGCGGCCGTTCATCGACGAGG

[0065] CCAAGCGGCTGCGAGCGCTGCACATGAAGGAGCACCCGGATTATAAATACCGGCCCCGG

[0066] CGGAAAACCAAGACGCTCATGAAGAAGGATAAGTACACACTGCCCGGCGGGCTGCTGG

[0067] CTCCGGGCGGCAACAGCATGGCGAGCGGGGTCGGGGTGGGCGCCGGCCTGGGCGCGG

[0068] GCGTGAACCAGCGCATGGACAGCTACGCGCACATGAACGGCTGGAGCAACGGCAGCTA

[0069] CAGCATGATGCAGGACCAGCTGGGCTACCCGCAGCACCCGGGCCTCAACGCGCACGGC

[0070] GCCGCGCAGATGCAGCCCATGCACCGCTACGACGTGAGCGCCCTGCAGTACAACTCCAT

[0071] GACCAGCTCGCAGACCTACATGAACGGCTCGCCCACCTACAGCATGTCCTACTCGCAGC

[0072] AGGGCACTCCTGGCATGGCGCTTGGCTCCATGGGCTCGGTGGTCAAGTCCGAGGCCAG

[0073] CTCCAGCCCCCCCGTGGTTACCTCTTCCTCCCACTCCAGGGCGCCCTGCCAGGCCGGGG

[0074] ACCTCCGGGACATGATCAGCATGTACCTCCCCGGCGCCGAGGTGCCGGAGCCCGCCGCC

[0075] CCCAGCAGACTTCACATGTCCCAGCACTACCAGAGCGGCCCGGTGCCCGGCACGGCCAT

[0076] TAACGGCACACTGCCCCTCTCGCACATGGCATGCGGCTCCGGCGAGGGCAGGGGAAGT

[0077] CTTCTAACATGCGGGGACGTGGAGGAAAATCCCGGCCCACTCGAGATGCCCCTCAACGT

[0078] CAGCTTCGCCAACAGGAACTATGACCTCGACTACGACTCGGTGCAGCCCTATTTCTACTG

[0079] CGACGAGGAGGAGAACTTCTACCAGCAGCAGCAGCAGAGCGAGCTGCAGCCGCCGGC

[0080] GCCCAGCGAGGATATCTGGAAGAAATTCGAGCTGCTGCCCACCCCGCCGCTGTCCCCGA

[0081] GCCGCCGCTCGGGGCTCTGCTCGCCCTCCTACGTCGCCTTCGCGTCCTTCTCCCCCCGGG

[0082] GGGACGACGACGGCGGCGGCGGCAGCTTTTCCACGGCCGACCAGTTGGAGATGGTGAC

[0083] CGAGCTGCTGGGAGGAGACATGGTGAATCAGAGCTTCATCTGCGACCCGGACGACGAG

[0084] ACCTTCATCAAAAACATCATCATCCAGGACTGCATGTGGAGCGGCTTCTCGGCCGCCGC

[0085] CAAGCTCGTCTCGGAGAAGCTAGCCTCCTACCAGGCTGCGCGCAAAGACAGCGGCAGC

[0086] CCGAGCCCCGCCCGCGGGCCCGGAGGCTGCCCCACCTCCAGCTTGTACCTGCAGGACC

[0087] TGACCGCCGCCGCCTCCGAGTGCATCGACCCCTCCGTGGTCTTCCCCTACCCGCTCAAC

[0088] GACAGCAGCTCGCCCAAGCCCTGCGCCTCCCCCGACTCCGCCGCCTTCTCCCCGTCCTC

[0089] GGACTCTCTGCTCTCCTCGGCGGAGTCCTCCCCGCGGGCCAGCCCCGAGCCCCTGGCGC

[0090] TCCACGAGGAGACACCGCCCACCACCAGCAGCGACTCTGAGGAAGAACAAGAGGAAG

[0091] AAGAAGAAATTGATGTCGTTTCTGTGGAGAAAAGGCAGCCCCCTGCCAAAAGGTCGGA

[0092] ATCGGGGTCACCCTCTGCCTCTGCCGGAGGCCACAGCAAACCTCCTCACAGCCCGCTGG

[0093] TCCTTAAGAGATGCCACGTGCCCACCCACCAGCACAATTACGCAGCGCCCCCCTCCACT

[0094] AGGAAGGACTACCCAGCCGCCAAGAGGGCTAAGTTGGACAGTGGCAGGGTCCTGAAA

[0095] CAGATCAGCAACAACCGCAAATGTATCAGCCCCAGGTCTTCGGACACGGAGGAGAACG

[0096] ACAAGAGGCGGACGCACAACGTCTTGGAACGCCAGAGGAGAAACGAGCTGAAACGGA

[0097] GCTTTTTTGCCCTGCGCGACCAGATCCCAGAGTTGGAAAACAACGAAAAGGCCCCCAA

[0098] GGTGGTGATCCTTAAAAAGGCCACCGCGTACATCCTGTCCGTCCAAGCAGGGGAGCAA

[0099] AAGCTCATTTCGGAAAAGGACCTGTTGAGGAAGCGACGAGAACAGTTGAAACACAAA

[0100] CTTGAACAGCTAAGGAACTCTTGTGCACTCGAGGGCTCGGGCCAGTGTACTAATTATGC

[0101] TCTCTTGAAATTGGCTGGAGATGTTGAGAGCAACCCAGGTCCCGGCGCGCCTATGAGGC

[0102] AGCCACCTGGTGAGTCTGACATGGCTGTCAGCGACGCACTACTCCCGTCCTTCTCCACG

[0103] TTCGCGTCCGGCCCGGCGGGAAGGGAGAAGACACTGCGTCCAGCAGGTGCCCCGAATA

[0104] ACCGCTGGCGGGAGGAGCTCTCCCACATGAAGCGACTTCCCCCCGTGCTTCCCGGCCGC

[0105] CCCTACGACCTGGCGGCGGCGACCGTGGCCACCGACCTGGAAAGTGGCGGAGTCGGTG

[0106] CGGCTTGCGGCGGCAACAACCCAGCTCTCCTACCCCGGAGGGAGACGGAGGAGTTCAA

[0107] CGATCTCCTGGACCTGGACTTTATCCTCTCCAACTCACTGTCCCATCAGGAGTCAGTGGC

[0108] CGCCACCGTGTCCTCGTCGGCATCAGCCTCATCCTCGTCCTCGCCGTCGAGCAGCGGTC

[0109] CTGCCAGTGCGCCCTCCACCTGCAGCTTCAGCTATCCGATCCGGGCCGGAGGCGACCCG

[0110] GGCGTGGCGCCAGGCAGCACGGGCGGCGGCCTCCTCTATGGCCGGGAGTCTGTGCCTC

[0111] CTCCCACAGCTCCCTTCAACCTGGCGGACATCAACGACGTGAGCCCCTCGGGCGGCTTC

[0112] GTGGCCGAGCTCCTTCGGCCTGAATTGGACCCAGTGTATATTCCGCCGCAGCAGCCGCA

[0113] GCCGCCAGGTGGCGGGCTGATGGGCAAGTTTGTGTTGAAGGCGTCGCTGAGTGCCCCT

[0114] GGCAGCGAGTACGGCAGCCCGTCGGTCATCAGTGTTGGCAAAGGCAGTCCGGACGGCA

[0115] GCCACCCGGTCGTAGTGGCGCCCTACAGTGGCGGGCCACCGCGCATGTGCCCCAAGATC

[0116] AAGCAGGAGGCGGTCTCCTCATGCACCGTCGGTCGGCCCCTAGAGGCCCACATGGGCA

[0117] CTGGACCCCCTCTCAGCAATGGCCACCGGCCGCCAGCCCACGACTTCCCCCTGGGGCG

[0118] GCAGCTCCCCAGCAGGACTACCCCGACCCTGGGTGCCGAGGAACTGCTGAGCAGCAGG

[0119] GACTGTCATCCTGCCCTACCGCTCCCCCCAGGTTTCCATCCCCACCCTGGGCCCAACTAC

[0120] CCACCCTTTTTGCCTGACCAGATGCAGCCACAGGTGCCACCGCTCCATTACCAAGAGCT

[0121] CATGCCACCTGGTTCCTGCATGCCGGAGGAGCAGAAACCAAAGAGGGGGAGAAGGTCG

[0122] TGGCCGCGGAAAAGGACAGCCACTCACACTTGTGACTATGCGGGCTGCGGCAAAACCT

[0123] ACACGAAGAGTTCTCATCTCAAGGCACACCTGCGAACCCACACAGGTGAGAAGCCTTA

[0124] CCACTGTGACTGGGATGGCTGCGGGTGGAAATTTGCCCGCTCTGACGAACTGACCAGG

[0125] CATTACCGGAAACACACCGGGCACCGCCCCTTTCAGTGCCAGAAGTGCGACCGGGCCT

[0126] TCTCCAGGTCGGACCACCTCGCCTTACACATGAAGAGGCACTTTTAAGCGGCCGC

[0127] SEQ ID NO:2

[0128] GAATTCATGAATACGGATCCAGCTCAGCCCCAATGCCCGCCTTGCCCCGAAGCGCCCGA

[0129] TTCTAGGGACTCTTCTCCAGTGCCTGAGATTGATGGGCCTGAAGAAAATTATGCACCCTT

[0130] GCGAATGTCATCCGCTGAGACCCCCCACACGGAGACCGTCTCTCCTCTTCCTTCCTGCAT

[0131] GGATCTACTTGCTCAGGGCAGCCCCGATTCTTCCACCAGCCCCAGAGTAAAAGTGCTGC

[0132] CCACTTCTGCAGAGGAGATCACCGCGAAGAAGGACGATCCAGCTCAGGGCAAGAAACA

[0133] GAAGATCAGAACCGTCTTCTCTCAGACCCAGCTATATGTACTCAATGATAGATTTCAGAG

[0134] GCAGAAATACCTCAGTCTCCAGCAGATGCAAGAACTTTCCAACATTCTGAACCTTAGCTA

[0135] TAAGCAGGTTAAGACCTGGTTCCAGAACCAGAGAATGAAATGCAAGAGGTGGCAAAAA

[0136] AACAACTGGCCAAAGAATAACAACACTGTGTCTCAGAACAGCTCTGCAAATCCAGAAT

[0137] ACCCAGGCTTCTATTCCTATCACCAGGGATACCTGATGAACACTTCCGGAAACCTTCCAA

[0138] TATGGGGCAACCAGACCTGGAACAGCCAGTCGTGGAGCAACCAGACCTGGAACAGCCA

[0139] GTCGTGGAGCAACCAGACCTGGAACAGTCAGTCGTGGAGCAACCAGACCTGGAACAG

[0140] TCAGACCTGGTGCCCCCAAGCCTGGAATGGCCAGGGCTGGAACAGCCAGCTGCACGAC

[0141] TGTGGAGAGGAATCCCCGCAGCCCCAGATACAGTTACAGCAAAATTCTGTCAGCGATTT

[0142] GCAGTCCATCTTAGAAACGACTGGGGAAAGCCACAGTGTGATACAGCAAACGGCCAAG

[0143] TATTTTAGTGCCCAGCAAATAATGGATTTATTCCCAAACTACCCTGAACATACAGCCTCTA

[0144] GTAAAATTGTCGCTCCTGTCAAACAAACTCTTAACTTTGATTTACTCAAACTGGCTGGGG

[0145] ATGTAGAAAGCAATCCAGGTCCAGGATCCATGGGCTCTGTGTCAAACCAGCAGTTCGCA

[0146] GGTGGCTGCGCCAAGGCGCCGGAGGAGGCGCCGGAGGACGCCGCCCGGGCGGCCGAG

[0147] GAGCCGCAGCTGCTGCACGGTGCCGGCATCTGTAAGTGGTTCAACGTGCGCATGGGGTT

[0148] CGGCTTCCTGTCCATGACCGCCCGCGCCGGGGTCGCGCTTGACCCCCCAGTGGATGTCT

[0149] TTGTGCACCAGAGCAAGCTGCACATGGAGGGCTTCCGGAGCCTGAAGGAGGGTGAGGC

[0150] CGTGGAGTTCACCTTTAAGAAGTCTGCTAAGGGCCTGGAATCTATCCGGGTCACGGGCC

[0151] CCGGTGGGGTGTTCTGTATTGGGAGCGAGAGGCGGCCCAAAGGGAAGAACATGCAGAA

[0152] GCGCAGATCAAAGGGAGACAGGTGCTACAACTGTGGAGGTCTAGACCACCATGCCAAG

[0153] GAATGCAAGCTGCCACCCCAGCCTAAGAAGTGCCACTTCTGCCAGAGCATCAGCCACAT

[0154] GGTGGCCTCGTGTCCACTGAAAGCCCAGCAGGCCCCCAGCTCACAGGGAAAGCCAGCC

[0155] TACTTTCGGGAGGAGGAAGAAGAAGAGATCCATAGCCCTGCCCTGCTCCCAGAGGCCC

[0156] AGAATTGAGCGGCCGC

[0157] SEQ ID NO:3

[0158] GAATTCATGAGTGTGGATCCAGCTTGTCCCCAAAGCCTGCTTTGCCCCGAAGCATCCATT

[0159] TCCAGCGAATCTTCACCAATGCCTGAGGTTTATGGGCCTGAAGAAAATTATGCCTCCTTG

[0160] CAGATGTCATCTGCTGAGACCCTCGACACCGAGACTGTCTCTCCTCTTCCTTCCTCCATG

[0161] GATCTGCTTATTCAGGACAGCCCTGATTCTTCCACAAGCCCCAGAGTAAAACCACTGCC

[0162] CACATCTGCAGAGAAGAGCACAGAGAAGGAGGAAAAGGTCCCAGTCAAGAAGCAGAA

[0163] GATCAGAACTGTGTTCTCGCAGACCCAGCTCTGTGTCCTCAACGACAGATTTCAGAGGC

[0164] AGAAGTACCTCAGCCTCCAGCAGATGCAAGAACTTTCCAACATCCTGAACCTTAGCTAC

[0165] AAACAGGTTAAAACCTGGTTCCAGAACCAGCGAATGAAATGTAAGAGGTGGCAGAAAA

[0166] ACCACTGGCCAAGGAATAGCAACAGTGTGATTCAGGGCTCAGCCAGTACAGAATACCCG

[0167] GGCTTCTATTCCTACCACCAAGGATGCCTGGTGAACGCTTCTGGAAACCTGCCCGTGTG

[0168] GGGTAATCAGAGCTGGAGTAACCCAACCTGGAGCAACCAGACCTGGAACAGCCAGTCT

[0169] TGGAGCAACCAAACCTGGAACAGCCAGACCTGGTGCCCCCAAGCCTGGAATAACCAGA

[0170] CTTGGAATAGCCAGCTCAACAACTATGTTGAGGAATTCCTGCAGCCCCAGCTCCAGTTT

[0171] CAGCAAAATTCTATCAGTGATTTGGAGGCCGTCTTGGAAACTGCTGGGGAAAATCATAA

[0172] TGTAATACAGCAGACTTCAAAGTACTGCGGTACCCAGCAGCAAATCATGGATTTATTCCC

[0173] AAATTACTCCATGAACATACAGCCTGAAGATATGTCTAGTAAAATTGTCGCTCCTGTCAA

[0174] ACAAACTCTTAACTTTGATTTACTCAAACTGGCTGGGGATGTAGAAAGCAATCCAGGTC

[0175] CAGGATCCATGGGCTCTGTGTCAAACCAGCAGTTTGCAGGTGGCTGCGCCAAGGCGCC

[0176] GGAGGAGGCGCCGGAGGACGCGGCCCGAGCAGCCGAGGAGCCGCAGCTGCTCCACGG

[0177] TGCCGGCATCTGTAAATGGTTCAACGTGCGCATGGGGTTCGGCTTCCTGTCCATGACCGC

[0178] CCGCGCCGGGGTCGCGCTCGACCCCCCAGTGGACGTCTTTGTGCACCAGAGTAAGCTG

[0179] CACATGGAGGGCTTCCGGAGCCTGAAGGAGGGTGAGGCTGTGGAGTTCACCTTTAAGA

[0180] AGTCTGCTAAGGGCTTGGAATCTATCCGAGTCACTGGCCCTGGTGGGGTGTTCTGCATTG

[0181] GGAGCGAGAGACGGCCCAAGGGGAAGAATATGCAGAAACGCAGATCCAAGGGAGACA

[0182] GGTGCTACAACTGTGGAGGTCTAGACCATCATGCCAAGGAATGCAAACTGCCACCCCAG

[0183] CCCAAGAAGTGCCACTTCTGCCAGAGCATCAACCATATGGTGGCTGCGTGTCCACTGAA

[0184] GGCCCAGCAAGCTCCCAGCTCACAGGGAAAGCCAGCCTACTTTCGGGAAGAAGAAGA

[0185] AGAGATCCATAGCCCTGCCATGCTCCCAGAGGCTCAGAATTGAGCGGCCGC

[0186] In some embodiments, the electroporation buffer used in step (2) is DMEM / F12, and the final concentration of the piggyBac transposon plasmid is 20 μg / 100 μL to 25 μg / 100 μL; the electroporation procedure is: voltage 300V to 400V, 1 to 2 pulses, duration 10ms to 15ms; preferably, the electroporation transfection system is 100 μL, and the transfected cells are 1×10⁶ cells / 10⁶ cells / 100 μL. 6 The electroporation solution used was DMEM / F12, and the piggyBac transposon plasmid content was 25 μg. The electroporation transfection procedure was as follows: voltage 300V, 2 electroporations (10s interval between each), duration 10ms.

[0187] In some embodiments, the feline fetal fibroblasts described in step (2) are prepared by peeling off feline fetal skin tissue and chopping it into pieces of 0.1–0.5 mm. 3 The tissue fragments were adhered to the cell wall using the tissue adhesion method, and the cells were cultured in M10 medium.

[0188] In some embodiments, in step (2), feline fetal fibroblasts of passage 2-3 with a cell confluence of 80%-90% are selected for electroporation transfection.

[0189] In some embodiments, the cell clone that conforms to the characteristics of embryonic stem cells in step (3) is a cell clone that simultaneously expresses the genes OCT4, SOX2 and NANOG, and the clone can form an embryoid body and differentiate in vitro to express trigerm layer-specific proteins.

[0190] In some embodiments, the passage culture in step (3) includes the following steps: passage cell clones that conform to the characteristics of embryonic stem cells into pre-coated mouse fibroblast feeder cells at a ratio of 1:10 to 20, and culturing the cells using M15 medium; and / or the preparation method of the mouse fibroblast feeder cells includes the following steps: culturing mouse embryonic fibroblasts using M10 medium, and when the cell density reaches 85 to 90%, treating them with 8 μg / mL to 12 μg / mL mitomycin C solution for 2.5 to 3 hours, discarding the mitomycin C solution, digesting the cells with trypsin, and seeding them into gelatin-pretreated cell culture dishes, and continuing to culture them using M10 medium.

[0191] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0192] Example 1: Method for preparing cat induced pluripotent stem cells

[0193] This embodiment prepared cat induced pluripotent stem cells, specifically including the following steps:

[0194] 1. Isolation and culture of feline fetal fibroblasts

[0195] The uterus of a pregnant cat, which was accidentally discovered during surgery by a veterinarian at a pet store, was placed in saline solution containing PS (penicillin-streptomycin mixture) to rinse away surface blood. It was then placed in a dissecting tray sterilized with 75% alcohol. The uterus was cut open and dissected, and then transferred to the cellular compartment in saline solution for the next step of the procedure.

[0196] The fetus was transferred to PBS containing 1% penicillin and antibiotics for washing, then immersed in 75% alcohol for 30 seconds before being quickly transferred to PBS containing 1% penicillin and antibiotics for washing twice. It was then placed on a dissecting tray. The skin tissue was removed using sterile ophthalmic forceps and a scalpel (as cleanly as possible), quickly washed twice with PBS, and then placed in the laminar flow hood of the cell culture room. It was washed twice with PBS containing 1% penicillin and antibiotics, and the skin tissue was then chopped into pieces of 0.1-0.5 mm using a scalpel. 3 Fragments of tissue (the smaller the better).

[0197] Tissue fragments were resuspended and transferred to cell culture dishes (treated with 0.1% gelatin) supplemented with M10 medium (MEM 88%, FBS 10%, NEAA 1%, PS antibiotics 1%) and cultured for 3–4 days. On the second day of culture, the cells were observed for contamination and adherence (the culture dishes should not be moved during observation to prevent newly adhered tissue from shifting). Cells then emerged from the tissue (i.e., feline fetal fibroblasts). When the cell density reached 90%, the cells were progressively cooled and cryopreserved, finally stored in liquid nitrogen for subsequent experiments. Figure 1 ).

[0198] 2. Construction of PB-TRE-cOSKM and PB-TRE-cNL / PB-TRE-pNL expression vectors

[0199] (1) Synthesis of feline four-factor (cOSKM) and feline two-factor (cNL) / porc two-factor (pNL) sequences

[0200] The feline OCT4 gene, with its stop codon removed, was linked with three different dipeptides: P2A, T2A, and E2A.

[0201] (NM_001173441, with the EcoR I restriction site GAATTC added to the front of the start codon), feline SOX2 gene

[0202] The CDS regions of the feline c-MYC gene (NM_001173447), feline c-MYC gene (NM_001173446), and feline KLF4 gene (NM_001173444) (with stop codons removed); the stop codon TAA and the Not I restriction site GCGGCCGC are added to the end of the tandem sequence; the sequence of the tandem feline four-factor (cOSKM) is shown in SEQ ID NO:1;

[0203] The feline NANOG gene (NM_001173442 with the stop codon removed and the EcoR I restriction site GAATTC added to the front of the start codon) and the feline LIN28 gene (NM_001173445 with the stop codon TGA) were linked together using a dipeptide F2A; the Not I restriction site GCGGCCGC was added to the end of the tandem sequence; the sequence of the tandem feline two-factor (cNL) is shown in SEQ ID NO:2;

[0204] A dipeptide F2A was used to link the porcine NANOG gene (NM_001129971.1 with the stop codon removed and the EcoR I restriction site GAATTC added to the front of the start codon) and the porcine LIN28 gene (NM_001123133.1 with the stop codon TGA); a Not I restriction site GCGGCCGC was added to the end of the tandem sequence; the sequence of the tandem porcine two-factor (pNL) is shown in SEQ ID NO:3;

[0205] After the sequences were designed, they were sent to Shanghai Sangon Biotech Co., Ltd. to synthesize the PUC-SP-cOSKM vector (hereinafter referred to as the four-factor vector) and PMV-cNL / PMV-pNL (hereinafter referred to as the two-factor vector).

[0206] (2) Double digestion of piggyBac transposon backbone vector, four-factor vector and two-factor vector

[0207] The PUC-SP-cOSKM vector (four-factor vector), PMV-cNL / PMV-pNL (two-factor vector), and PB-TRE-hRL vector (piggyBac transposon backbone vector, donated by Professor Liu Pengtao's laboratory at the University of Hong Kong) were subjected to double enzyme digestion. The enzyme digestion system was prepared according to the system in Table 1 (reagents in Table 1 were added to 200 μL EP tubes in descending order of volume), mixed well, and then placed in a water bath at 37°C for 30 min.

[0208] Table 1

[0209]

[0210]

[0211] (3) Agarose gel electrophoresis and gel recovery

[0212] Add the digested products of PUC-SP-cOSKM, PMV-cNL / PMV-pNL, and PB-TRE-hRL, along with the DNA marker, to the sample wells. Adjust the electrophoresis apparatus voltage to 120V, start the power supply, and run the gel. After electrophoresis, immediately place the gel in an automated gel imaging system for observation. Under UV light, quickly cut the correctly sized cOSKM, cNL / pNL, and PB-TRE fragments with a blade for recovery. Store the recovered DNA at -20°C for later use.

[0213] (4) Connection of target segments

[0214] The target fragment ligation system is shown in Table 2. The reaction system was prepared according to Table 2, and the recycled gel products were ligated overnight at 16°C.

[0215] Table 2

[0216] cOSKM / cNL / pNL 12 PB-TRE 5 10×T4 DNA ligase buffer 2 T4 DNA ligase 1

[0217] (5) Plasmid transformation

[0218] Under a clean bench, prepare LB solid medium (5g, 5g, 2.5g, and 7.5g of peptone, sodium chloride, yeast extract, and agar powder dissolved in 500mL of distilled water in a 2:2:1:3 ratio). While still warm to the touch, add ampicillin (50-100μg / mL), shake well, and quickly pour onto a plate. Add 2μL of the ligation product and 20μL of LE.coli DH5α to a centrifuge tube, gently tap to mix, and place on ice for 30min. Then, heat shock in a 42℃ water bath, followed by an ice bath for 2min. After the ice bath, add an appropriate amount of LB liquid medium (without ampicillin, but without agar powder, otherwise the same as the solid medium), incubate for about 1 hour, and then centrifuge. Under a clean bench, discard the medium. Resuspend the medium in 25μL, inoculate evenly into a petri dish lined with solid medium, let stand, and finally incubate overnight in a biochemical incubator. Under a clean bench, use a small pipette tip to pick up single clones and place them into centrifuge tubes or Erlenmeyer flasks containing an appropriate amount of LB liquid medium (containing ampicillin); incubate overnight in a shaker; add bacterial culture and glycerol at a ratio of 8:1, mix thoroughly, and store at -20℃.

[0219] (6) Plasmid extraction

[0220] Take the overnight cultured E. coli solution, add it to a centrifuge tube, and collect the bacteria by centrifugation at room temperature.

[0221] According to the instructions of the plasmid extraction kit (Tiangen Biotech Co., Ltd.), add equilibration buffer and centrifuge (centrifugation speed for all steps below is 8000 rpm); add P1 to the bacterial pellet, then shake to suspend the bacterial pellet; add P2 according to the instructions, gently invert to lyse the bacterial cells, and incubate at 25°C for a few minutes until the bacterial solution is no longer turbid; add P4 solution, gently invert 10 times to allow P4 and the above solution to react fully until flocculent white precipitate appears in the solution. Then incubate at 25°C for a few minutes to allow the precipitate to gather at the bottom and centrifuge to remove the white precipitate to the bottom of the tube. Collect the supernatant and filter it into CS1; add 0.3 times the volume of isopropanol to the filtrate collected in the previous step, shake well, and transfer it to the adsorption column in 3 portions for centrifugation; after filtering all the solution through the adsorption column, add wash buffer PW and centrifuge. To remove the wash buffer completely, repeat the centrifugation; then add anhydrous ethanol to the adsorption column and centrifuge; centrifuge again for several minutes to remove the remaining wash buffer. Open the cap and let it stand at room temperature for a few minutes to allow the washing buffer to evaporate. Add elution buffer to the CP6 adsorption column to elute the DNA from the adsorption membrane. Let it stand at room temperature for a few minutes before centrifuging. To improve the recovery rate, add the filtrate back into the column, let it stand, and then centrifuge. Finally, pipette the solution into centrifuge tubes and store at -20°C.

[0222] (7) Plasmid enzyme digestion identification

[0223] The extracted plasmid DNA was identified by double digestion with EcoRI and NotI, yielding two bands of approximately 5068bp or 1654bp / 1630bp and 4707bp, indicating that the PB-TRE-cOSKM and PB-TRE-cNL / PB-TRE-pNL vectors were successfully constructed and can be used for subsequent experiments.

[0224] 3. Electroporation transfection

[0225] Third-generation feline fetal fibroblasts were resuscitated and passaged when the cells reached approximately 90% confluence. When the passaged cells reached approximately 90% confluence, they were trypsinized and collected, and counted. The collected cells were resuspended in 2 mL L PBS, washed twice, and centrifuged at 1200 g for 5 min. After centrifugation, the cells were resuspended in DMEM / F-12 medium to a concentration of 1 × 10⁶ cells / mL. 6 Fibroblasts in fetal cats.

[0226] In a 1.5 mL centrifuge tube, add the cOSKM four-factor vector (PB-TRE-cOSKM), cNL two-factor vector (PB-TRE-cNL), or pNL two-factor vector (PB-TRE-pNL) constructed in step 2, as well as the PB-EF1a-transposase, PB-CAG-rTTA, and PB-TRE-SV40 LT plasmids previously constructed and preserved in the inventor's laboratory or donated by Professor Liu Pengtao's laboratory at the University of Hong Kong (all plasmids were constructed using conventional methods and purified after extraction). Dilute the plasmid concentration to approximately 3 μg / μL, and add 1×10⁻⁶ LT of the plasmids. 6 Mix 100 μL DMEM / F12 (GIBCO) per cell and transfer to a 4 mm electroporation cuvette, taking care to avoid air bubbles. Place the cuvette in the electroporation tank. Set the electroporation program as follows: voltage 300V; pulse duration: 10ms; number of pulses: 2; pulse interval: 10s. Click "pluse" to run, and wait 1 minute before the next electroporation. After electroporation, let the cells stand at room temperature for about 5 minutes, then resuspend them in culture medium. Add the cell suspension to feeder cells that have been revived one day in advance, and replace the medium with M15 medium (83% DMEM / Gulta, 15% FBS, 1% NEAA, 1% PS, 0.1mM β-ME, 10ng / mL LIF, 10ng / mL bFGF, 50μg / mL LVc, 1μg / mL LDox, reagents purchased from GIBCO, SIGMA, and Sinocare). Incubate in an incubator.

[0227] The cell culture medium was changed on the second day, and then changed every other day thereafter for observation; around the seventh day, iPSC-like clones could be observed to form. Figure 2 In the diagram, A and B represent the result of a reprogramming factor combination containing both porcine pNL and feline cNL factors. Once the clones have grown to a certain size, they are manually picked up with a pipette, digested with trypsin, resuspended in a 24-well plate pre-coated with feeder cells, and then cultured and observed.

[0228] The method for preparing feeder cells in this step is as follows:

[0229] SNL cells (a mouse embryonic fibroblast cell line established by Bradley et al.) were retrieved from the liquid nitrogen tank and revived. The cells were thawed in a 37°C water bath until only a small ice crystal remained, then transferred to a 15mL centrifuge tube. 4mL of M10 medium was added, and the tube was centrifuged at 1200g for 5 minutes. After centrifugation, the supernatant was discarded, and the cells were resuspended in fresh medium. After mixing thoroughly by pipetting, the cells were seeded into cell culture dishes pretreated with 0.1% gelatin (M10 medium) and incubated at 37°C in a 5% CO2 incubator. When the density reaches approximately 90%, passage the cells. When the passaged SNL cells reach approximately 90% density, discard the culture medium and wash with preheated PBS. Add 4 mL of prepared 10 μg / mL mitomycin C solution to a 100 mm culture dish (avoid light during operation) and incubate for 2.5-3 hours, observing the cell status during this period. When the cells become thin and short, stop the process, recover the mitomycin C solution, and wash with PBS approximately three times. Add 0.05% trypsin for digestion, add culture medium to stop digestion, collect the cell suspension, and centrifuge at 1200g for 5 minutes. After centrifugation, discard the supernatant, add pre-prepared cryopreservation solution (90% FBS, 10% DMSO), and finally store in a liquid nitrogen tank.

[0230] Example 2: Passaging of feline induced pluripotent stem cells

[0231] The morphology of the feline induced pluripotent stem cell (iPSC) clones obtained in Example 1 was observed. Passage was performed in approximately 3-4 days, with feeder cells revived the day before passage. The feline iPSCs were removed from the incubator, the culture medium was discarded, and the cells were washed with DPBS followed by digestion with 0.25% trypsin. After cell detachment, an equal volume of M15 culture medium was added to terminate digestion. The cell suspension was collected and centrifuged at 1200g for 5 minutes. The supernatant was discarded, and the cells were resuspended in an appropriate amount of culture medium, gently pipetting until single cells were formed. These cells were then seeded onto pre-reviveed feeder cells (using M15 culture medium), shaken well, and incubated at 37°C in a 5% CO2 incubator. The cell morphology was as shown in the image. Figure 3 The A (reprogrammed factor combination is cat four-factor (cOSKM) + cat two-factor (cNL) + SV40LT) and Figure 3 The B in the figure (the reprogramming factor combination is a four-factor cat (cOSKM) + two-factor pig (pNL) + SV40LT) is shown.

[0232] Example 3: Pluripotency Identification of Cat Induced Pluripotent Stem Cells

[0233] Representative feline induced pluripotent stem cells (iPSCs) from the 5th generation were subjected to the following further tests to determine whether they possessed stem cell characteristics. The identification was mainly based on the following aspects: alkaline phosphatase staining, qRT-PCR detection of stem cell pluripotency gene expression levels, immunocytochemical detection of stem cell pluripotency-specific protein expression, embryomorphic body formation ability, and potential for differentiation into three germ layers.

[0234] 1. Alkaline phosphatase staining

[0235] The revived and passaged iPSCs were removed from the CO2 incubator, the culture medium was discarded, and the cells were washed with PBS and fixed with 4% paraformaldehyde. Working solution was prepared according to the alkaline phosphatase (AP) staining kit instructions, mixed thoroughly, and stored at 4°C in the dark. The fixative was discarded, the cells were washed with PBS, and the pre-prepared AP working solution was added. Staining was carried out at room temperature in the dark for approximately 2 hours. The staining solution was discarded, excess stain was washed with PBS, and the cells were observed and photographed using a fluorescence microscope. Results are as follows: Figure 4 As shown, from Figure 4 As can be seen, the vast majority of clones are uniformly blue-purple, indicating that AP is positive and the cells are pluripotent.

[0236] 2. qRT-PCR detection of pluripotency-related gene mRNA expression

[0237] (1) RNA extraction

[0238] Remove cells from the incubator, discard the culture medium, wash with PBS, add 0.25% trypsin to digest and discard the feeder layer cells, then add 1 mL of Trizol to lyse the cells. Perform repeated pipetting and lysis under light-protected conditions until complete lysis. Collect the lysate and place it on an ice pack to prevent RNA degradation. Centrifuge the tube at 12000g, 4°C for 5 min in a high-speed refrigerated centrifuge. Add an appropriate amount of chloroform to the supernatant according to the instructions, vortex to mix, and incubate on ice for 5 min before centrifuging. After centrifugation, carefully transfer the supernatant to a new centrifuge tube. Add an appropriate amount of isopropanol, shake well, incubate on ice, and centrifuge. Discard the supernatant, add an appropriate amount of 75% ethanol, shake well, centrifuge at 7500g for 5 min, discard the supernatant, open the cap and air dry, dissolve in DEPC in water and mix well, ready for reverse transcription.

[0239] (2) Reverse transcription

[0240] DNA removal reaction: Prepare Master Mix according to Table 3 below.

[0241] Table 3

[0242] 5×gDNAEraserBuffer 2 gDNAEraser 1 TotalRNA 5 <![CDATA[RNaseFreedH2O]]> upto10

[0243] All operations were performed on ice. After adding all the above reagents, the mixture was centrifuged on a micro-shaker and then incubated at 42°C for 2 min and 4°C for 2 min on a PCR instrument. The reaction was immediately placed on ice after completion. Then, the reverse transcription reaction was performed, and the reaction system is shown in Table 4. All operations were also performed on ice. The reaction was carried out at 37°C for 15 min, 85°C for 5 s, and 4°C for 2 min on a PCR instrument. The reaction was immediately placed on ice after completion, and the products were stored at -20°C for later use.

[0244] Table 4

[0245] The reaction solution in step (2) 10 PrimerScriptRTEnzymeMixI 1 RTPrimerMix 1 5×PrimerScriptBuffer 4 <![CDATA[RNaseFreedH2O]]> 4

[0246] (3) Real-time quantitative PCR (qRT-PCR)

[0247] The CDS sequence of the gene to be tested was found on the NCBI website. Primers were designed using Primer-BLAST according to the principles of primer design, and the specificity of each primer was tested. Primer information is shown in Table 5 below. The sequences were synthesized by Shanghai Sangon Biotech.

[0248] Table 5 Primer sequences

[0249]

[0250]

[0251] The expression of pluripotency genes was detected using qRT-PCR. The reaction system is shown in Table 6. The reaction conditions were: pre-denaturation at 95℃ for 2 min; 95℃ for 30 sec; 65℃ for 34 sec for a total of 40 cycles. The results showed that, compared with fibroblasts (CFFs), cat iPSCs expressed high levels of the pluripotency genes OCT4, SOX2, and NANOG. Figure 5 ).

[0252] Table 6

[0253] TBGreenPremixExTaqII(2X) 5 PCRForwardPrimer (10μM) 0.4 PCRReversePrimer (10μM) 0.4 cDNA solution 1 <![CDATA[ddH2O]]> 3.2

[0254] 3. Karyotype analysis

[0255] Cat iPSCs were treated with 0.1% μg / mL colchicine for 2.5 h, washed with PBS, digested with 0.25% trypsin, centrifuged, resuspended in 0.075M KCl solution, and incubated at 37°C for about 30 min. Freshly prepared fixative was added and fixed for 10 min. This centrifugation and fixation were repeated three times, leaving 0.3 mL of fixative. Cells were gently dispersed with a pipette, dropped onto slides, air-dried, stained with Giemsa, air-dried, and mounted. Observation was performed under a microscope, and chromosome analysis was conducted using software. The cat iPSCs cells had 19 pairs of chromosomes and a normal karyotype. Figure 6 ).

[0256] 4. Immunocytochemical detection of pluripotency protein expression

[0257] The antibodies used in the immunocytochemical assay were purchased from Cell Signaling Technology.

[0258] Remove cells, discard waste liquid, and wash with PBS; fix with fixative (4% paraformaldehyde) for about 15 min, wash three times with PBS, about 3 min each time; use 300 μL of permeabilizing agent (Trtion). After incubating the samples with X-100 for 20 min, wash three times with PBS for about 3 min each time; add 300 μL of diluted blocking buffer (5% BSA) to evenly cover the cells, and incubate at room temperature with shaking for 1 h; after blocking, discard the blocking buffer (do not wash), add diluted primary antibody (1:200 dilution), and incubate overnight at 4°C; the next day, remove the cell culture plate from 4°C and let it sit at room temperature for 20 min, then aspirate and recover the primary antibody, wash three times with PBS for about 3 min each time; add secondary antibody diluted with fluorescent antibody dilution buffer (goat anti-mouse or anti-rabbit, 1:500), and incubate in the dark for 1 h; aspirate the secondary antibody in the dark, wash three times with PBS for about 3 min each time; add 300 μL of LDAPI staining solution, let it sit at room temperature for 5 min, then discard the solution, wash three times with PBS for about 3 min each time; observe and photograph under a fluorescence microscope. Results are as follows. Figure 7 As shown, cat iPSCs express pluripotency proteins OCT4, SOX2, and SSEA4, indicating that the cells possess stem cell characteristics.

[0259] 5. Identification of specific markers for the three germ layers in the embryoid body

[0260] (1) Formation of embryoid body

[0261] Remove the grown cells from the incubator, digest them with 0.25% trypsin, remove the feeder layer, resuspend the cells in EB medium (88% DMEM-Gulta, 10% FBS, 1% NEAA, 1% PS, 0.1mM β-ME), count the cells, and dilute the cell concentration to 1.0 × 10⁻⁶ cells with culture medium. 5 Cells / mL; pipette 20-30 μL of cell suspension and add it to the lid of a culture dish. Quickly invert the lid onto the dish, and add PBS to the bottom; after 2-3 days, a white granular substance visible to the naked eye will form at the bottom of each droplet, which is the embryoid body (EB); transfer the embryoid bodies to a culture dish lined with gelatin for adherent differentiation. Figure 8 ).

[0262] (2) Cell immunochemical detection of trigerm layer-specific proteins

[0263] Select three germ layer-specific markers and perform cellular immunochemical detection according to step 4 of this embodiment.

[0264] Two weeks after embryoid culture and differentiation, the expression of marker proteins of the three germ layers was identified as follows: Figure 9 As shown. Figure 9 The results showed that the endoderm marker protein AFP (alpha-fetoprotein), the mesodermal marker protein α-SMA (α-smooth muscle actin), and the ectoderm marker protein β-III Tubulin were expressed positively.

[0265] Experiment Example 1: Effects of electroporation transfection conditions on cell viability and transfection efficiency

[0266] Good somatic cell growth and high cell survival and transfection efficiency are prerequisites for obtaining induced pluripotent stem cells. In order to improve the cell survival and transfection efficiency of feline fetal fibroblast electrotransfection, the following parameters were optimized in this experiment: electroporation buffer, pulse voltage, pulse duration, plasmid content, and number of pulses.

[0267] The original electroporation transfection conditions were: DPBS as the electroporation buffer, parameters set to 250V, one electroporation cycle, duration 15ms, and a total plasmid amount of 10μg DNA. Under these electroporation conditions, fibroblasts died extensively and transfection efficiency was low (see...). Figure 10 (Before optimization)

[0268] (1) Under transfection conditions of 250V, one electroporation, duration of 15ms, and a total plasmid amount of 10μg DNA, the effects of DPBS (GIBCO), DMEM (GIBCO), DMEM (VivaCell, original BI), MEM (VivaCell, original BI), DMEM / F12 (GIBCO) powder, and DMEM / F12 (GIBCO) as buffer on transfection efficiency and survival rate in electroporation were compared. The results showed that DMEM / F12 powder (GIBCO) and DMEM / F12 (GIBCO) were significantly more effective than other buffers. Specifically, when DMEM / F12 was used as buffer, the transfection efficiency and survival rate were 15.7% and 92.0%, respectively, which were higher than those when DMEM / F12 powder was used as buffer (12.2% and 90.6%). Therefore, DMEM / F12 is the optimal buffer for electroporation.

[0269] (2) Under the transfection conditions of DMEM / F12 as the electroporation buffer, one electroporation pulse lasting 10 ms, and a total plasmid amount of 10 μg DNA, the effects of different pulse voltages (250, 300, 350, and 400 V) on the transfection efficiency and survival rate of electroporation were compared. During the experiment, it was clearly observed that the electroporation efficiency increased with increasing voltage, while the survival rate gradually decreased. Compared with the transfection efficiency (24.8%) and survival rate (70.3%) at 350 V, although the transfection efficiency at 300 V was lower (15.2%), its survival rate was higher (93.3%). To ensure a sufficient cell number, 300 V was selected as the optimal voltage for the electroporation experiment.

[0270] (3) Under the transfection conditions of DMEM / F12 as electroporation buffer, 300V, one electroporation, and a total plasmid amount of 15 μg DNA, the effects of different pulse durations (5, 10, 15, and 20 ms) on the transfection efficiency and survival rate were compared. The transfection efficiency increased with increasing pulse duration. Compared with the 15 ms transfection efficiency (25.1%) and survival rate (81.9%), although the 10 ms transfection efficiency was slightly lower (23.6%), the survival rate was higher (88.6%). Therefore, 10 ms was selected as the optimal pulse duration.

[0271] (4) Under the transfection conditions of DMEM / F12 as electroporation buffer, 300V, one electroporation, and a duration of 10ms, the effects of different plasmid DNA contents (10, 15, 20, 25 μg / 100 μL) on the transfection efficiency and survival rate were compared. The transfection efficiency increased with increasing DNA content. Compared with 20 μg, which showed a slightly lower survival rate (78.8%) and a higher transfection efficiency (31.9%), 25 μg yielded the best transfection results. Therefore, a DNA content of 25 μg resulted in the best transfection effect.

[0272] (5) Under the transfection conditions of DMEM / F12 as the electroporation buffer, 300V, duration of 10ms, and a total plasmid amount of 25μg DNA, the effects of different pulse numbers (one and two) (pulse interval of 10s) on electroporation were compared. Compared with the transfection efficiency (31.9%) and survival rate (78.8%) of one pulse, two pulses resulted in a significant increase in transfection efficiency (67.8%) and a decrease in survival rate (64%). Considering all factors, two pulses are the better choice.

[0273] Therefore, DMEM / F12 was used as the electroporation buffer, with parameters set to 300V, two electroporations (10s pulse interval, 10ms duration each), and a total plasmid amount of 25μg DNA for electrotransfection of fetal fibroblasts. Under these electrotransfection conditions, the transfection efficiency was increased to 67.8%, while maintaining 64% cell viability. Figure 10 (After optimization). Example 2: Comparison of reprogramming effects of heterogeneous reprogramming factor combinations.

[0274] This experiment used a combination of four different species of heterologous reprogramming factors to reprogram feline fetal fibroblasts (the method and steps are the same as in Example 1). The four different combinations of reprogramming factors are as follows:

[0275] ①sOSKM+sNL+hRL group (300V)

[0276] ②sOSKM+sNL+hRL group (400V)

[0277] ③ pOSKM+pNL+hRL group (300V)

[0278] ④ pOSKM+pNL+hRL group (400V)

[0279] The reprogramming result is as follows Figure 11 As shown, from Figure 11 It was found that using a combination of four different species of heterologous transcription factors to reprogram fetal fibroblasts resulted in good transfection efficiency at both 300V and 400V. However, observation after culture revealed that no embryonic stem cell-like clones were formed. Figure 12 Therefore, the above-mentioned combinations of heterologous reprogramming factors from different species cannot be used to prepare cat induced pluripotent stem cells.

[0280] Experiment 3: Reprogramming effect of cOSKM combined with different reprogramming factors

[0281] Based on the results of Example 1, the inventors constructed a feline four-factor cOSKM tandem vector and reprogrammed feline fetal fibroblasts (using the same method and steps as in Example 1). The results showed that transfection with only feline four-factor cOSKM did not produce clonal cells. Building on this, the inventors further experimented with combining cOSKM with transcription factors from different species or different feline transcription factors, comparing the resulting cell clonal morphology. The specific reprogramming factor combinations are as follows:

[0282] ①cOSKM+hRL six-factor group

[0283] ②cOSKM+hRL+SV40 LT seven-factor group

[0284] ③ cOSKM+pNL+SV40 LT seven-factor group

[0285] ④ cOSKM+pNL+SV40 LT+hRL+hTERT ten-factor group

[0286] ⑤ cOSKM+cNL+SV40 LT seven-factor group

[0287] ⑥ cOSKM+cNL+SV40 LT+hRL+hTERT ten-factor group

[0288] ⑦ cOSKM+cNL+SV40 LT+hRL nine-factor group

[0289] ⑧ cOSKM+cNL+SV40 LT+hTERT eight-factor group

[0290] The results are as follows Figure 12 As shown, the iPSC clonal morphology of groups ①, ②, ③, ⑤, ⑥, ⑦, and ⑧ is not significantly different; they are all basically the same, characterized by raised cell clones with clear and rounded edges, large nuclei, and a high nucleocytoplasmic ratio. Among them, groups ③ and ⑤ produce more clones, which are more evenly distributed, and the individual cell morphology is clearer, appearing to be more viable. Although group ④ produces clonal-like cell clusters with clear edges, there are fewer clones and the cell condition is not very good, with the nucleus not clearly visible.

[0291] After culturing cell clones with different morphologies separately, it was found that only clones formed in groups ③ and ⑤ exhibited normal cell morphology after subculturing and could be stably subcultured (the subculturing results for group ③ are shown in...). Figure 3 The propagation results for group B and group ⑤ are shown in [reference needed]. Figure 3 In group A), clones from other groups could not be stably passaged.

[0292] Therefore, considering the morphology of cell clones and the results of passage culture after transfection with different factor combinations, the cOSKM+pNL+SV40 LT seven-factor combination and the cOSKM+cNL+SV40 LT seven-factor combination can achieve reprogramming, forming cat induced pluripotent stem cell clones and achieving stable passage. In comparison, the fifth group, cOSKM+cNL+SV40 LT seven-factor combination, produced a larger number of clones and had higher reprogramming efficiency. Figure 14 ).

[0293] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0294] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A method for preparing cat induced pluripotent stem cells, characterized in that, Includes the following steps: (1) Construct a four-factor model carrying tandem feline OCT4, SOX2, KLF4 and c-MYC. piggyBac Transposon plasmids carrying tandem porcine NANOG and LIN28 factors piggyBac Transposon plasmids and those carrying monkey kidney virus SV40 LT plasmid piggyBac Transposon plasmids were transfected into feline fetal fibroblasts via electroporation; the electroporation buffer used was DMEM / F12. piggyBac The final concentration of the transposon plasmid is 20 μg / 100 μL to 25 μg / 100 μL; the electroporation transfection program is: voltage 300 V to 400 V, 1 to 2 pulses, duration 10 ms to 15 ms; (2) Select clone-like cells with similar morphology to embryonic stem cells, and passage them through identification and screening to obtain the desired cells.

2. The method for preparing cat induced pluripotent stem cells according to claim 1, characterized in that, The four cat-derived factors OCT4, SOX2, KLF4 and c-MYC, and the two porcine-derived factors NANOG and LIN28 in step (1) are all linked by 2A-linked peptides.

3. The method for preparing cat induced pluripotent stem cells according to claim 2, characterized in that, Cat-derived OCT4 and SOX2 are linked together via P2A linker peptides, cat-derived SOX2 and c-MYC are linked together via T2A linker peptides, and cat-derived c-MYC and KLF4 are linked together via E2A linker peptides; porcine-derived NANOG and LIN28 are linked together via F2A linker peptides.

4. The method for preparing cat induced pluripotent stem cells according to claim 1, characterized in that, The nucleotide sequences of the tandem feline OCT4, SOX2, KLF4 and c-MYC four factors are shown in SEQ ID NO:1; the nucleotide sequences of the tandem porcine NANOG and LIN28 two factors are shown in SEQ ID NO:

3.

5. The method for preparing cat induced pluripotent stem cells according to any one of claims 1 to 4, characterized in that, In step (1), the piggyBac The final concentration of the transposon plasmid was 25 μg / 100 μL. The electroporation transfection procedure was as follows: 300 V voltage, 2 electroporations, 10 s interval between each electroporation, and 10 ms duration for each electroporation.

6. The method for preparing cat induced pluripotent stem cells according to any one of claims 1 to 4, characterized in that, The fetal fibroblasts mentioned in step (1) were prepared by the following method: fetal skin tissue was peeled off and chopped into pieces of 0.1~0.5 mm. 3 The tissue fragments were adhered to the cell wall using the tissue adhesion method, and the cells were cultured in M10 medium.

7. The method for preparing cat induced pluripotent stem cells according to any one of claims 1 to 4, characterized in that, In step (1), fetal fetal fibroblasts of passage 2-3 with a cell confluence of 80%-90% are selected for electroporation transfection.

8. The method for preparing cat induced pluripotent stem cells according to any one of claims 1 to 4, characterized in that, The cell clone that meets the characteristics of embryonic stem cells in step (2) is a cell clone that simultaneously expresses the genes OCT4, SOX2 and NANOG, and the clone can form an embryoid body and differentiate in vitro, expressing trigerm layer-specific proteins.

9. The method for preparing cat induced pluripotent stem cells according to any one of claims 1 to 4, characterized in that, The passage culture described in step (2) includes the following steps: cell clones that conform to the characteristics of embryonic stem cells are passaged into pre-coated mouse fibroblast feeder cells at a ratio of 1:10~20, and the cells are cultured using M15 medium; the preparation method of the mouse fibroblast feeder cells includes the following steps: mouse embryonic fibroblasts are cultured using M10 medium, and when the cell density reaches 85~90%, they are treated with 8 μg / mL~12 μg / mL mitomycin C solution for 2.5~3 hours. After discarding the mitomycin C solution, the cells are digested with trypsin and seeded into gelatin-pretreated cell culture dishes, and cultured using M10 medium.

Citation Information

Patent Citations

  • CN102433308A

  • CN102653774A

  • CN116064660A