Lactobacillus johnsonii and its application in alleviating intestinal damage caused by plateau hypoxia

Abstract

The invention discloses Lactobacillus johnsonii and application thereof in alleviating intestinal damage caused by plateau hypoxia. The composite bacterial agent of the composition of Lactobacillus johnsonii YH1136 and Bacillus subtilis BS01 provided by the invention can effectively prevent, treat and alleviate intestinal damage caused by plateau hypoxia exposure. The composite bacterial agent can increase the expression levels of tight junction proteins such as Claudin‑1, Occludin and ZO‑1, and restore the intestinal barrier function damage caused by plateau hypoxia exposure; restore the expression level of intestinal pro-inflammatory cytokines; reduce the level of harmful bacteria Escherichia coli, and increase the level of beneficial bacteria Lactobacillus; improve diarrhea; and maintain body weight. The composite bacterial agent provided by the invention can be used to prepare a medicine for alleviating intestinal damage caused by plateau hypoxia exposure and a composition thereof, can also be used as an auxiliary product of existing therapeutic drugs and treatment methods, and can also be used as a microecological preparation in medicines or health products, and has a very broad application prospect.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to Lactobacillus johnsonii and application thereof in alleviating intestinal damage caused by plateau hypoxia. Background Art

[0002] The natural environment in the plateau is complex and special. Compared with the plains, its main feature is the lower air pressure and oxygen level. As the altitude of the plateau gradually increases, the atmospheric pressure level continues to decrease, resulting in a continuous decrease in the oxygen partial pressure in the atmosphere. For example, at an altitude of 5,000 meters, the oxygen partial pressure is only half of that at sea level. Therefore, even if the relative proportion of oxygen in the atmosphere remains unchanged, the thin atmosphere will lead to hypoxic exposure, which is a huge challenge to the normal respiratory function of the human body. The amount of oxygen intake during normal breathing is reduced, which affects the normal physiological health of the human body. In addition, high-altitude exposure (i.e., low pressure, low oxygen and low temperature conditions) can lead to acute or chronic altitude sickness due to the lack of compensatory ability. The impact of the low oxygen environment of the plateau on the human body is mainly manifested in the decline of labor capacity, appetite, weight, physical strength, memory and other abilities. Severe impacts may lead to plateau intestinal stress and induce altitude sickness (including high-altitude pulmonary edema, high-altitude cerebral edema, high-altitude heart disease, etc.). In the plateau hypoxic exposure environment, gastrointestinal dysfunction is a typical manifestation. Hypoxic exposure not only leads to abnormalities in gastrointestinal digestion and secretion, but also causes pathological damage to the gastrointestinal mucosa, thereby affecting the composition of intestinal flora.

[0003] Therefore, a method without side effects to alleviate intestinal damage caused by high altitude hypoxia exposure is urgently needed. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the prior art, provide Lactobacillus johnsonii and its application in alleviating intestinal damage caused by plateau hypoxia, the composite bacterial agent of the composition of Lactobacillus johnsonii YH1136 and Bacillus subtilis BS01 provided by the present invention can effectively prevent and alleviate intestinal damage caused by plateau hypoxia exposure, the composite bacterial agent can increase the expression levels of tight junction proteins such as Claudin-1, Occludin and ZO-1, restore the intestinal barrier function damage caused by plateau hypoxia exposure; restore the expression level of intestinal pro-inflammatory cytokines; reduce the level of harmful bacteria Escherichia coli, increase the level of beneficial bacteria Lactobacillus; improve diarrhea; maintain body weight; the composite bacterial agent provided by the present invention can be used to prepare a medicine and a composition thereof for alleviating intestinal damage caused by plateau hypoxia exposure, can also be used as an auxiliary product of existing therapeutic drugs and treatment methods, can also be used as a microecological preparation in medicines or health products, and has a very broad application prospect.

[0005] In order to achieve the above technical effects, the following technical solutions are adopted:

[0006] Application of a Lactobacillus johnsonii composite bacterial agent in the preparation of a drug for alleviating intestinal damage caused by plateau hypoxia, wherein the Lactobacillus johnsonii composite bacterial agent is formed by combining a Lactobacillus johnsonii YH1136 strain and a Bacillus subtilis BS01 strain;

[0007] The Lactobacillus johnsonii YH1136 strain has a deposit number of CCTCC NO: M 20221116, a deposit date of July 15, 2022, a depository of the China Center for Type Culture Collection, and a deposit address of Wuhan University, Wuhan, China, with a postal code of 430072.

[0008] The Bacillus subtilis BS01 strain has a deposit number of CCTCCNO: M 2012485, a deposit date of November 28, 2012, a depository of the China Center for Type Culture Collection, and a deposit address of Wuhan University, Wuhan, China, with a postal code of 430072.

[0009] The number of Lactobacillus johnsonii YH1136 strains is 1-2×10 9 CFU / mL;

[0010] The number of the Bacillus subtilis BS01 strain is 1-2×10 9 CFU / mL;

[0011] The ratio of the number of the Lactobacillus johnsonii YH1136 strain to the number of the Bacillus subtilis BS01 strain is 1-2:1.

[0012] Furthermore, the composite bacterial agent of the Lactobacillus johnsonii YH1136 strain and the Bacillus subtilis BS01 strain is a powder or an aqueous solution.

[0013] Furthermore, the drug also contains a pharmaceutically acceptable carrier.

[0014] Furthermore, the application method is to administer the compound bacterial agent by gavage or orally to obtain the medicine, pharmaceutical composition, functional food or health product prepared by the compound bacterial agent.

[0015] Furthermore, the method for alleviating intestinal damage caused by plateau hypoxia exposure includes at least one of (a)-(e):

[0016] (a) Restore the decreased expression level of tight junction proteins caused by high altitude hypoxia exposure in mammals and restore intestinal barrier function;

[0017] (b) Resurgence of pro-inflammatory cytokines in the mammalian intestine;

[0018] (c) reducing the level of harmful bacteria Escherichia coli in mammals and increasing the level of beneficial bacteria Lactobacillus;

[0019] (d) improving diarrhea in mammals;

[0020] (e) maintaining body weight in a mammal.

[0021] Furthermore, the mammals include humans; and the tight junction proteins in the ileum include Claudin-1, Occludin and ZO-1.

[0022] The invention discloses Lactobacillus johnsonii and application thereof in alleviating intestinal damage caused by plateau hypoxia. The composite bacterial agent of the composition of Lactobacillus johnsonii YH1136 and Bacillus subtilis BS01 provided by the invention can effectively prevent, treat and alleviate intestinal damage caused by plateau hypoxia exposure. The composite bacterial agent can increase the expression levels of tight junction proteins such as Claudin-1, Occludin and ZO-1, and restore the intestinal barrier function damage caused by plateau hypoxia exposure; restore the expression level of intestinal pro-inflammatory cytokines; reduce the level of harmful bacteria Escherichia coli, and increase the level of beneficial bacteria Lactobacillus; improve diarrhea; and maintain body weight. The composite bacterial agent provided by the invention can be used to prepare a medicine for alleviating intestinal damage caused by plateau hypoxia exposure and a composition thereof, can also be used as an auxiliary product of existing therapeutic drugs and treatment methods, and can also be used as a microecological preparation in medicines or health products, and has a very broad application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. The drawings in the following description are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0024] Figure 1 This is a graph showing the effects of hypoxia exposure and different bacteria supplementation on Claudin-1 mRNA levels in the ileum of mice in an embodiment of the present invention;

[0025] Figure 2 This is a graph showing the effects of hypoxia exposure and supplementation with different bacteria on the ileum Occludin mRNA level in mice in an embodiment of the present invention;

[0026] Figure 3 This is a graph showing the effects of hypoxia exposure and different bacteria supplementation on the ileum ZO-1 mRNA level in mice in an embodiment of the present invention;

[0027] Figure 4 This is a comparative diagram of the immunoslice of Claudin-1 in the ileum of mice exposed to hypoxia and supplemented with different bacteria in the embodiment of the present invention;

[0028] Figure 5 This is a comparative diagram of the immunoslice of occludin in the ileum of mice exposed to hypoxia and supplemented with different bacteria in the embodiment of the present invention;

[0029] Figure 6 This is a comparative diagram of the immunoslice of the effects of hypoxia exposure and different bacteria supplementation on ZO-1 in the ileum of mice in the embodiment of the present invention;

[0030] Figure 7 This is a graph showing the effects of hypoxia exposure and different bacteria supplementation on the mRNA level of IL-1β in the ileum of mice in an embodiment of the present invention;

[0031] Figure 8 This is a graph showing the effects of hypoxia exposure and supplementation with different bacteria on the mRNA level of TGF-β in the ileum of mice in an embodiment of the present invention;

[0032] Fig. 9 This is a comparative diagram of the immunoslice of IL-1β in the ileum of mice exposed to hypoxia and supplemented with different bacteria in the embodiment of the present invention;

[0033] Fig.10 This is a comparative diagram of immunoslice of the effects of hypoxia exposure and different bacteria supplementation on TGF-β in mouse ileum in the embodiment of the present invention;

[0034] Fig.11 This is a graph showing the effects of hypoxia exposure and different bacteria supplementation on the Log10 DNA gene copy number level of mouse ileum Escherichia coli in an embodiment of the present invention;

[0035] Fig.12 1 is a graph showing the effects of hypoxia exposure and different bacterial supplementation on the Log10 DNA gene copy number level of Lactobacillus ileum in mice in an embodiment of the present invention;

[0036] Fig.13 This is a graph showing the effects of hypoxia exposure and different bacteria supplementation on the diarrhea score of mice on the 15th day in an embodiment of the present invention;

[0037] Fig.14 This is a graph showing the effects of hypoxia exposure and different bacteria supplementation on the total diarrhea score of mice for 15 days in an embodiment of the present invention;

[0038] Fig.15 This is a graph showing the effects of hypoxia exposure and different bacteria supplementation on the weight change rate of mice after 15 days in an embodiment of the present invention. DETAILED DESCRIPTION

[0039] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0040] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0041] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations and / or combinations thereof.

[0042] Example

[0043] The Lactobacillus johnsonii YH1136 involved in the present invention was isolated and screened from the feces of a healthy Tibetan girl in Bange County, Nagqu Prefecture, Tibet Autonomous Region (at an altitude of about 5000m). The preservation number of the Lactobacillus johnsonii YH1136 strain is: CCTCC NO: M 20221116, the preservation date is July 15, 2022, the preservation unit is the China Center for Type Culture Collection, and the preservation address is Wuhan University, Wuhan, China, with a zip code of 430072.

[0044] The Bacillus subtilis BS01 strain involved in the present invention is isolated and screened from soil. The deposit number of the Bacillus subtilis BS01 strain is: CCTCC NO: M 2012485, the deposit date is November 28, 2012, the deposit unit is China Center for Type Culture Collection, the deposit address is Wuhan University, Wuhan, China, and the postal code is 430072.

[0045] Initial screening of Lactobacillus johnsonii YH1136 strain:

[0046] Weigh 0.5 g of feces and place it in a 100 mL conical flask. Add 49.5 mL of sterile saline and sterile small glass beads (the saline and glass beads were sterilized in a high-pressure steam sterilizer at 120°C for 15 min in advance). Place it on an air shaker at room temperature and shake at 150 rpm / min for 30 min to fully homogenize the feces sample to obtain 10 -2 Then draw 1 mL of the homogenate from the conical flask and add it to a test tube containing 9 mL of sterile saline solution and shake to mix well to obtain 10 -3 Diluent, dilute to 10 -7. Take 100 μL and spread it on MRS solid culture medium, culture at 37℃ for 24h, pick colonies with typical lactobacillus characteristics (colonies are white and round, with smooth surface, slightly raised and neat edges) for Gram staining microscopy, and select Gram-positive rod-shaped bacteria for streaking pure culture. Then pick the single colonies obtained by streaking and expand them in MRS broth culture medium, and select 30 single colonies with lactobacillus characteristics, named Lactobacillus YH1121-YH1150.

[0047] Tolerance of Lactobacillus johnsonii YH1136 strain:

[0048] The expanded cultured lactobacilli YH1121-YH1150 were inoculated at a 2% inoculum size into sterile MRS liquid culture medium (10 g peptone, 8 g beef powder, 4 g yeast powder, 20 g glucose, 2 g dipotassium hydrogen phosphate, 2 g diammonium hydrogen citrate, 5 g sodium acetate, 0.2 g magnesium sulfate, 0.04 g manganese sulfate, 1 g Tween 80, pH 5.7±0.2) with a pH of 3.0 and a cow bile salt concentration of 0.3%, and cultured at 37°C for 12 h. The changes in the number of viable bacteria in the culture medium were detected at 0 h and 12 h, respectively, and the survival rate of the test bacteria at the end of the culture was calculated (the number of viable bacteria at 12 h / the number of viable bacteria at 0 h, and the counting result was calculated as the logarithm with base 10). The results showed that 10 strains of bacteria, including YH1122, YH1125, YH1128, YH1130, YH1136, YH1137, YH1140, YH1143, YH1144, and YH1147, could maintain a high survival rate after 12 hours of culture under the conditions of pH=3.0 and bile salt concentration of 0.3%, indicating that these 10 strains of bacteria have good tolerance and possess the basic characteristics of probiotics. Next, antibacterial experiments were conducted on these 10 strains to explore their ability to inhibit common pathogens.

[0049] Table 1 Acid and bile resistance test of lactobacillus YH1120-YH1150 (survival rate %)

[0050]

[0051]

[0052]

[0053] Antibacterial ability of Lactobacillus johnsonii YH1136 strain:

[0054] Activate enterotoxigenic Escherichia coli (ETEC), Staphylococcus aureus, and Salmonella pathogens stored in the laboratory using LB medium, and then dilute the viable count of these pathogens to 10 with sterile saline. 5CFU / mL, take 100μL of pathogenic bacteria liquid and evenly spread it on the LB solid culture medium with a coating rod. Then use a 6mm diameter puncher to evenly punch three holes on the LB plate, and the depth of the holes is about 3mm. Use a pipette to add 200μL of the supernatant of the test bacteria into the hole (the test bacteria are inoculated into the MRS broth culture medium at a 2% inoculation amount, and after culturing at 37℃ for 24h, use a 15mL centrifuge tube to take an appropriate amount of mixed bacterial liquid and place it in a high-speed centrifuge, 8000r / min high-speed centrifuge for 10min, and the supernatant is the supernatant required for the experiment). At the same time, use a culture medium with a hole but no supernatant as a control group, place it in a constant temperature incubator at 37℃ for 10h and then take it out. If the supernatant of the test bacterial solution has the ability to inhibit the growth of pathogens, a blank circle without pathogen growth will appear around the punch hole. Observe and record the size of the inhibition circle, and use a vernier caliper to measure the diameter of the inhibition circle. During the measurement, the same inhibition circle is measured from three different positions, and the average value is taken as the measured value. The antibacterial ability of the test strains can be evaluated by analyzing the size of the inhibition circle of all the test strains. The results showed that the supernatants of 5 strains of bacteria, including YH1122, YH1130, YH1136, YH1140, and YH1144, have strong antibacterial ability. These 5 strains were selected for the subsequent cholesterol-lowering ability test.

[0055] Table 2 Determination of antibacterial ability of lactobacillus (diameter of inhibition zone, mm)

[0056]

[0057]

[0058] Determination of cholesterol degradation ability of Lactobacillus johnsonii YH1136 strain:

[0059] The activated 5 strains of lactobacillus were inoculated into MRS-CHO (MRS liquid medium with a cholesterol concentration of 0.1 mg / mL) at a 2% inoculation rate. After culturing at 37°C for 24 hours, the mass fraction of cholesterol in the bacterial supernatant, washing liquid and bacterial cell crushing liquid was determined according to the national standard GB5009.128-2016 "Determination of cholesterol in food". At the same time, the MRS-CHO medium without lactobacillus inoculation was used as a control, and the degradation rate of cholesterol in the culture medium was calculated according to the cholesterol content in the supernatant. The specific method is as follows: 1. Weigh 0.10g (accurate to 0.1mg) of cholesterol standard, dissolve it with glacial acetic acid and dilute to 100mL to prepare a cholesterol standard stock solution, and store it at 4°C. 2. Take 10mL of cholesterol standard stock solution and dilute to 100mL with glacial acetic acid, and prepare it now. 3. Weigh 4.463g of ammonium ferric sulfate [FeNH4(SO4)2·H2O] in 100mL of phosphoric acid (dissolve thoroughly, perform ultrasonic treatment to promote dissolution if necessary) to prepare a stock solution, and store it at room temperature for later use. Pipette 10mL of the stock solution and dilute to 100mL with concentrated sulfuric acid to obtain the ammonium ferric sulfate colorimetric solution, and store it in a dry container for later use. 4. Draw a standard curve: Pipette 2mL of 0, 0.5, 1.0, 1.5, and 2.0mL of the cholesterol standard working solution into a 10mL test tube, add glacial acetic acid to each tube to make the total volume reach 4mL, add 2mL of ammonium ferric sulfate colorimetric solution along the tube wall, mix well, and compare colors at a wavelength of 560-575nm within 15-90min. Use the cholesterol standard concentration as the horizontal axis and the absorbance as the vertical axis to make a standard curve to obtain the regression equation. 5. Determine the cholesterol concentration of the test bacterial solution: Take 2 mL of the supernatant, washing solution and bacterial cell disruption solution of the test bacterial solution respectively, add glacial acetic acid to make the total volume 4 mL, slowly add 2 mL of ammonium ferric sulfate colorimetric solution along the tube wall, mix well, leave at room temperature for 15 minutes, use an ELISA instrument to compare the color at a wavelength of 560 nm, obtain the corresponding absorbance OD value, and calculate the cholesterol concentration based on the OD value. 6. Calculation of cholesterol degradation rate:

[0060] Degradation rate (%) = (C blank - C determination) / C blank;

[0061] C blank = cholesterol concentration of the supernatant fermentation broth of the blank control group;

[0062] C determination = cholesterol concentration of supernatant fermentation broth in the determination group;

[0063] The results showed that Lactobacillus johnsonii YH1136 had the best cholesterol degradation rate. Next, the strain of Lactobacillus johnsonii YH1136 was identified.

[0064] Table 3 Determination of cholesterol degradation ability of lactobacillus (degradation rate %)

[0065] strains Supernatant Washing liquid Bacteria disruption liquid YH1122 20.75±1.43％ 15.33±1.47％ 10.03±1.20％ YH1130 30.17±2.32％ 22.69±1.33％ 15.57±0.77 YH1136 37.65±1.25％ 30.09±0.78％ 25.75±1.79％ YH1140 28.68±1.86％ 22.96±1.06％ 18.61±1.23％ YH1144 25.96±2.66％ 21.96±0.98％ 17.36±1.55％

[0066] Identification of Lactobacillus johnsonii strain YH1136:

[0067] YH1136 genomic DNA was extracted using Rapid Bacterial Genomic DNA Isolation Kit (Shanghai Sangon Biotechnology Co., Ltd.). The full length of its 16S rRNA was then amplified using universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-TACGACTTAACCCCAATCGC-3'). The amplification system was 25 μL: 1 μL DNA template, 1 μL of upstream and downstream primers (10 nmol / L), 12.5 μL 2×TapPCR Master Mix, and the rest was filled with deionized water. PCR amplification reaction program: 95℃ pre-denaturation for 5 min; 94℃ for 1 min, 58℃ for 30 s, 72℃ for 1 min, for a total of 30 cycles; 72℃ extension for 10 min. The PCR product was detected with 1.5% agarose gel, and then the amplified product was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the BLAST homology sequence on the NCBI (National Center for Biotechnology Information, https: / / www.ncbi.nlm.nih.gov / ) website. The results showed that YH1136 had the highest homology with Lactobacillus johnsonii 15QC3AN (99.79%), so YH1136 was identified as Lactobacillus johnsonii and named Lactobacillus johnsonii YH1136. After the identification, its 16S rRNA gene sequence was uploaded to the Genbank database of NCBI with the accession number OP049985.1.

[0068] Example

[0069] Animal Experiment Design:

[0070] For a more concise description later, the experimental groups are defined as follows:

[0071] contrl (control), HA (plateau exposure group), HA5 (0.1ml Lactobacillus johnsonii YH1136 + plateau exposure group), HA4 (0.1ml Bacillus subtilis BS01 + plateau exposure group), HA3 (0.2ml Lactobacillus johnsonii YH1136 + plateau exposure group), HA2 (0.2ml Bacillus subtilis BS01 + plateau exposure group), HA1 (0.1ml Lactobacillus johnsonii YH1136 + 0.1ml Bacillus subtilis BS01 + plateau exposure group).

[0072] (1) Animal experiments and model establishment:

[0073] Mice were used as research subjects. The low oxygen environment at high altitudes was simulated in a low-pressure oxygen chamber, and probiotics were supplemented by gavage during the experiment.

[0074] 42 C57BL / 6J mice (purchased from Beijing Sibeifu Biotechnology Research Institute) were randomly divided into 7 groups. Before the formal experiment began, all mice were on a normal diet for one week to stabilize the initial physiological state of the mice. During the experiment, all mice were kept in a room with a temperature of 20-22°C and a humidity of 40-60%, with a day and night cycle of 12 hours, from 8 am to 8 pm. During the experiment, the HA and HA1-HA5 groups were always exposed to a hypoxic oxygen chamber simulating an altitude of 4000m. The pressure of the hypoxic oxygen chamber was set to 60-65kPa, and the air pressure of the control group was maintained at 94.5kPa. The hypobaric oxygen chamber was opened for about 1 hour every day for gavage and replenishment of drinking water and food.

[0075] The HA3 group was intragastrically administered with 0.2 mL of 10 9 The HA2 group was gavaged with 0.2 mL of 10 CFU / mL suspension of Lactobacillus johnsonii YH1136 every day. 9 CFU / mL of Bacillus subtilis BS01 suspension, HA1 was intragastrically administered 0.1 mL per day at a concentration of 10 9 CFU / mL of Lactobacillus johnsonii YH1136 suspension and 0.1mL of 10 9 The HA4 group was intragastrically administered with 0.1 mL of a 10 CFU / mL suspension of Bacillus subtilis BS01 every day. 9 CFU / mL of Bacillus subtilis BS01 suspension, HA5 group was gavaged with 0.1mL of 10 9 CFU / mL suspension of Lactobacillus johnsonii YH1136 was administered to the HA group and the control group with the same dose of saline. 9 The preparation method of the bacterial suspension of Lactobacillus johnsonii YH1136 with a CFU / mL is as follows: according to the live bacterial count result of the Lactobacillus johnsonii YH1136 seed liquid placed in a sterile MRS liquid medium at 37°C for 24 hours, the bacterial cells are prepared into 10 CFU / mL suspension using a PBS buffer with a concentration of 1X and a pH of 7.0. 9 CFU / mL of bacterial solution was stored at 4°C for future use. A vortex was used to mix the bacterial suspension before intragastric administration. Fresh bacterial solution was prepared once a week on average. 9 The preparation method of the bacterial suspension of Bacillus subtilis BS01 with a concentration of 10 CFU / mL is as follows: according to the viable bacterial count result of Bacillus subtilis BS01 seed liquid placed in a sterile LB liquid medium at 37°C for 24 hours, the bacterial cells are prepared into 10 CFU / mL suspension using a PBS buffer with a concentration of 1X and a pH of 7.0. 9CFU / mL of bacterial solution was stored at 4°C for future use. A vortex instrument was used to mix the bacterial suspension before gavage. Fresh bacterial solution was prepared once a week on average.

[0076] The experiment lasted for 14 days. On the 15th day, 6 mice were randomly selected from each group for sampling. The eyeballs were first removed to collect blood and serum for the determination of physiological and biochemical indicators. Then, the mice were killed by dislocation of the neck. The ileum fragments of the mice were collected, washed with ice-cold DEPC water, and stored in liquid nitrogen for subsequent qPCR experiments to analyze mRNA expression. Finally, a small empty ileum fragment was cut and fixed with 4% paraformaldehyde for the preparation of sections for immunohistochemistry and immunofluorescence analysis.

[0077] (2) Index determination method:

[0078] 1) RT-qPCR analysis of the relative expression level of mRNA of the target gene: Use the EZNA kit according to the instructions to extract RNA from the mouse ileum, and measure its absorbance at 260nm and 280nm, and calculate the ratio to determine the quality and concentration of RNA. Use agarose gel electrophoresis to analyze the integrity of RNA. Then use a reverse transcription kit to reverse transcribe RNA into cDNA for detecting the mRNA expression of the target gene. Inflammation-related factors (TGF-β and IL-β) and tight junction proteins (ZO-1, Occludin and Claudin-1) were detected in the ileum. PCR system: 1μL template, 1μL upstream and downstream primers each, 5μL SYBR Mix and 2μL ddH2O. The relative expression of mRNA was calculated using the 2ΔΔCt method.

[0079] 2) Immunohistochemical analysis: The fixed ileum tissue was rinsed with water, and then dehydrated, transparent, waxed, embedded and sectioned in sequence to prepare paraffin sections. The prepared sections were placed in a repair box of citric acid antigen extraction buffer (pH 6.0) in a microwave oven, boiled and incubated for antigen extraction. The sections were then placed in a 3% H2O2 solution and incubated for 25 minutes at room temperature in the dark. The sections were then placed in PBS (pH 7.4) and shaken on a shaker three times for 5 minutes each. 3% BSA was then added to evenly cover the tissue and blocked at room temperature for 30 minutes. The blocking solution was gently discarded and incubated with rabbit polyclonal anti-Occludin (1:200), rabbit polyclonal antibody Claudin-1 (1:2000) and rabbit polyclonal anti-ZO-1 (1:200) antibodies at 4°C overnight. The sections were taken out again and washed with PBS, and then HRP-labeled goat anti-rabbit IgG (1:200) was added dropwise and incubated at room temperature for 50 minutes. Finally, cells and nuclei were stained with DAB chromogen and hematoxylin, respectively, from the histochemistry kit. The beads were washed three times in PBS for 5 minutes each time. The sections were dried, AEC color development solution was added, incubated in culture medium for 10–25 minutes under light-protected conditions, and color development was terminated by washing with tap water. Nuclei were counterstained with hematoxylin for 3 minutes. After nuclear microscopy, the sections were placed in pure water, slightly dried, sealed with glycerol gelatin, and then naturally air-dried.

[0080] 3) Immunofluorescence analysis: Paraffin sections of embedded ileum tissue approximately 5 μm thick were prepared for immunofluorescence analysis. The sections were subjected to heat-induced antigen retrieval in 10 mM sodium citrate buffer (pH 6.0) at 121°C for 10 minutes. The sections were blocked with 8% skim milk in TBST at 37°C for 40 minutes, and then immunostained with primary antibodies against IL-1β (1:200) and TGF-β (1:200) at 4°C. The sections were washed and incubated with secondary fluorescent antibodies at 37°C for 60 minutes. The secondary antibody CY3 goat anti-rabbit IgG (1:300) was imaged using a Nikon Eclipse C1 fluorescence microscope (Nikon, Tokyo, Japan). All the above reagents were purchased from Wuhan Sai De Biotechnology Co., Ltd., China.

[0081] 4) qPCR quantitative determination of intestinal microbial content:

[0082] A) DNA was extracted using the EZNATM stool DNA isolation kit (Omega Bio-Tek, Doraville, CA, USA), and the final elution volume was 200 μL. The concentration was measured using a spectrophotometer (Beckman Coulter DU 800, Fullerton, CA, USA).

[0083] B) qPCR was performed using the CFX ConnectTM Real-Time System (Bio-Rad, Hercules, CA, USA) and SYBRR PremixEx Taq II (TaKaRa, Dalian, Liaoning, China):

[0084] B1. Primers: Escherichia coli (F:CATTGACGTTACCCGCAGAAGAAGC; R:CTCTACGAGACTCAAGCTTGC; Tm(C):62.5); Lactobacillus (F:AGCAGTAGGGAATCTTCCA; R:CACCGCTACACATGGAG; Tm(C):64.5).

[0085] B2. PCR cycle conditions: initial denaturation at 95°C for 1 min; denaturation at 95°C for 40 times for 5 s; annealing at 58-61°C for 25 s.

[0086] C) The amplified product was cloned into the pMD19-T (TaKaRa) vector and transformed into DH5α (TianGen, Beijing, China) for amplification. The plasmid was extracted using the EZNATM plasmid mini kit (Omega Bio-Tek), and the DNA concentration was determined using a spectrophotometer (Beckman Coulter DU800). The plasmid containing the 16S rRNA gene sequence was used as the standard for related bacterial detection. A standard curve was generated using three-fold diluted plasmid DNA. The target population copy number for each reaction was calculated based on the standard curve.

[0087] 5) Diarrhea observation and scoring: Place mice in a mouse cage lined with clean filter paper, 1 per cage. Hard stools and normal stools were scored as 0 points; mild, slightly wet stools or soft stools were scored as 1 point; moderate, wet stools, unformed stools and unclean perianal area were scored as 2 points; severe, loose stools and severe unclean perianal area were scored as 3 points. During the experimental period, the feces of mice were observed and scored every day. The diarrhea score on day 15 (D15 diarrhea score, Mean ± SEM) and the total diarrhea score (sum of 15-day diarrhea scores, Mean ± SEM) were recorded.

[0088] 6) Body weight detection and body weight change rate: During the experimental period, the mice were weighed every day, and the body weight change rate was calculated on the 15th day. Body weight change rate = (detected body weight - initial body weight) / initial body weight × 100%.

[0089] Experimental results:

[0090] 1) RT-qPCR analysis of the relative expression levels of target genes (Claudin-1, Occludin and ZO-1): Claudin-1, Occludin and ZO-1 are tight junction proteins that have a protective effect on the intestinal barrier. The relative expression level of mRNA is proportional to the intestinal barrier function.

[0091] Therefore, from Figure 1-Figure 3 It can be seen that: in terms of the relative expression levels of the three tight junction proteins Claudin-1, Occludin and ZO-1 mRNA, compared with the control group, the relative expression level of tight junction protein mRNA in the HA group was significantly reduced, indicating that exposure to high-altitude hypoxic environment can lead to barrier function damage in mice; there was no significant difference between the HA2 group, HA3 group, HA4 group, HA5 group and the HA group, indicating that the probiotic single bacterial suspension could not significantly improve the barrier function of mice; the relative expression level of tight junction protein mRNA in the HA1 group was significantly higher than that in the HA group, and significantly higher than that in the HA2 group, HA3 group, HA4 group, HA5 group, and close to that in the control group, indicating that the probiotic mixture bacterial suspension has a significant improvement effect on the spatial memory ability of mice.

[0092] In summary, Figure 1-Figure 3 The results showed that exposure to high-altitude hypoxic environment can lead to impaired intestinal barrier function in mice, which is mainly manifested by decreased levels of tight junction proteins such as Claudin-1, Occludin and ZO-1. While being exposed to high-altitude hypoxia, supplementing with the probiotic composite bacterial suspension provided by the present invention at a dose of 0.1+0.1ml can synergistically restore the intestinal barrier function of mice. Among the five groups using probiotic bacterial suspensions, the group (HA1) using a bacterial suspension made of Lactobacillus johnsonii YH1136 and Bacillus subtilis BS01 in a fixed ratio (1:1) had the best effect.

[0093] 2) Immunohistochemical analysis:

[0094] The junction proteins Claudin-1, ZO-1, and Occludin are mainly located at the edge of epithelial cells, at the top of the cell membrane, and evenly and continuously distributed along the bottom of the villi, expressing as brown linear signals. Figure 4-Figure 6 The results showed that compared with the control group, the brown-yellow linear signals of the intestinal epithelium of the mice in the HA group were significantly weakened, indicating that exposure to the plateau hypoxic environment caused damage to the intestinal barrier function of the mice. Among the five groups using probiotics (HA1-HA5), the brown-yellow linear signals of the intestinal epithelium of the HA1 group were the strongest and distributed continuously. Figure 1-Figure 3The results of immunohistochemistry showed that the levels of tight junction proteins Claudin-1, ZO-1 and Occludin were reduced in the HA group, and the compound probiotics could reverse this result. The group (HA1) with a bacterial suspension made of Lactobacillus johnsonii YH1136 and Bacillus subtilis BS01 in a fixed ratio had the best effect.

[0095] 3) RT-qPCR analysis of the relative mRNA expression levels of target genes (IL-1β, TGF-β): IL-1β and TGF-β are common inflammatory cytokines. Figure 7-Figure 8 The results showed that after high-altitude hypoxia exposure modeling, the level of inflammatory factors in the HA group was significantly reduced compared with the control group, indicating intestinal immunosuppression. Among the five groups using probiotics (HA1-HA5), the inflammatory cytokines in the HA1 group increased significantly, and the level of inflammatory factors was significantly higher than that in the HA1, HA2, HA3, and HA4 groups, and close to the control group. In summary, Figure 7-Figure 8 The results showed that exposure to high-altitude hypoxic environment can lead to inhibition of intestinal immune function in mice, which is mainly manifested as a decrease in the levels of inflammatory factors such as IL-1β and TGF-β. While being exposed to high-altitude hypoxia, supplementing with the probiotic suspension provided by the present invention at a dose of 0.1+0.1ml can synergistically restore the intestinal barrier function of mice. The bacterial suspension group (HA1) prepared with a fixed ratio of Lactobacillus johnsonii YH1136 and Bacillus subtilis BS01 had the best effect.

[0096] 4) Immunofluorescence analysis: Fig. 9 and Fig.10 The results of immunofluorescence showed that the protein levels of inflammatory factors IL-1β and TGF-β decreased in the HA group, and the level of intestinal inflammatory factors in the HA1 group was the highest, close to that in the control group. Fig. 9 and Fig.10 Verified Figure 8 and Fig. 9 The results showed that exposure to high-altitude hypoxic environment can lead to inhibition of intestinal immune function in mice, which is mainly manifested by a decrease in the levels of inflammatory factors such as IL-1β and TGF-β. While being exposed to high-altitude hypoxia, supplementing with the probiotic suspension provided by the present invention at a dose of 0.1+0.1ml can synergistically restore the intestinal barrier function of mice. The bacterial suspension group (HA1) made of Lactobacillus johnsonii YH1136 and Bacillus subtilis BS01 in a fixed ratio (1:1) had the best effect.

[0097] 5) qPCR quantitative determination of intestinal microbial content:

[0098] Escherichia coli is a common harmful bacteria in the intestine, and Lactobacillus is a common beneficial bacteria in the intestine. Fig.11 and Fig.12The results showed that in terms of the levels of E. coli and Lactobacillus, after high-altitude hypoxia exposure modeling, the E. coli level in the HA group was significantly increased, and the Lactobacillus level was significantly decreased compared with the control group; the E. coli content in the HA1 group was significantly lower than that in the HA2-HA5 group, and the Lactobacillus content was significantly higher than that in the HA2-HA5 group, and both levels were close to the control group. In summary, Fig.11 and Fig.12 The results show that exposure to plateau hypoxia can lead to intestinal flora disorder in mice, which is mainly manifested by a decrease in the content of harmful bacteria such as intestinal Escherichia coli and an increase in the content of beneficial bacteria such as Lactobacillus. While being exposed to plateau hypoxia, supplementing the probiotic suspension provided by the present invention with a dosage of 0.1+0.1ml can increase the number of beneficial bacteria such as Lactobacillus in the intestine of mice, reduce harmful bacteria such as Escherichia coli, and relieve intestinal disorder. The bacterial suspension group (HA1) made of Lactobacillus johnsonii YH1136 and Bacillus subtilis BS01 in a fixed ratio (1:1) has the best effect.

[0099] 6) Diarrhea observation and scoring:

[0100] According to the diarrhea scoring standard, the higher the score, the more severe the diarrhea. Fig.13 and Fig.14 It can be seen that: whether it is the second day after the end of the experiment (day 15 diarrhea score, Fig.13 ), or during the experiment (total diarrhea score over the past 14 days, Fig.14 ), the diarrhea scores of the HA group were significantly higher than those of the control group; in the five groups using probiotic suspension (HA1-HA5), the diarrhea scores of the HA1 group were significantly lower than those of the HA2-HA5 groups, and close to those of the control group. In summary, Figure 13-Figure 14 The results showed that exposure to plateau hypoxia can cause intestinal abnormalities in mice, mainly manifested as diarrhea in mice. While being exposed to plateau hypoxia, supplementing the probiotic suspension provided by the present invention with a dosage of 0.1+0.1ml can improve the intestinal health level of mice and relieve diarrhea. The bacterial suspension group (HA1) made of Lactobacillus johnsonii YH1136 and Bacillus subtilis BS01 in a fixed ratio (1:1) has the best effect.

[0101] 7) Weight detection and weight change rate: The plateau environment will damage the intestinal health of the body, reduce appetite, and affect the body's weight level. Fig.15 It can be seen that: HA group lost weight, which was significantly different from the control group; HA1-HA5 groups all gained weight, among which HA1 group had the highest weight gain, which was significantly higher than HA1-HA4 groups and close to the control group. Overall, Figure 13-Figure 14The results showed that exposure to high altitude hypoxia can lead to abnormal weight of mice, mainly manifested as weight loss. While being exposed to high altitude hypoxia, supplementing with the probiotic suspension provided by the present invention at a dosage of 0.1+0.1ml can increase the weight of mice, and the bacterial suspension group (HA1) made of Lactobacillus johnsonii YH1136 and Bacillus subtilis BS01 in a fixed ratio (1:1) has the best effect.

[0102] In summary, the present invention discloses Lactobacillus johnsonii and its application in alleviating intestinal damage caused by plateau hypoxia. The composite bacterial agent of the composition of Lactobacillus johnsonii YH1136 and Bacillus subtilis BS01 provided by the present invention can effectively prevent, treat and alleviate intestinal damage caused by plateau hypoxia exposure. The composite bacterial agent can increase the expression levels of tight junction proteins such as Claudin-1, Occludin and ZO-1, and restore the intestinal barrier function damage caused by plateau hypoxia exposure; restore the expression level of intestinal pro-inflammatory cytokines; reduce the level of harmful bacteria Escherichia coli, and increase the level of beneficial bacteria Lactobacillus; improve diarrhea; and maintain body weight. The composite bacterial agent provided by the present invention can be used to prepare drugs and compositions thereof for alleviating intestinal damage caused by plateau hypoxia exposure, and can also be used as auxiliary products of existing therapeutic drugs and treatment methods, and can also be used as microecological preparations in medicines or health products, and has a very broad application prospect.

[0103] At this point, those skilled in the art recognize that, although the embodiments of the present invention have been shown and described in detail herein, many other variations or modifications that conform to the principles of the present invention can still be directly determined or derived based on the contents disclosed in the present invention without departing from the spirit and scope of the present invention. Therefore, the scope of the present invention should be understood and recognized as covering all such other variations or modifications.

Claims

1. The use of a Lactobacillus johnsonii composite bacterial agent in the preparation of a drug for alleviating intestinal damage caused by plateau hypoxia, characterized in that: The Lactobacillus johnsonii composite bacterial agent is formed by combining the Lactobacillus johnsonii YH1136 strain and the Bacillus subtilis BS01 strain; The deposit number of the Lactobacillus johnsonii YH1136 strain is: CCTCC NO: M 20221116, the deposit date is July 15, 2022, the deposit unit is China Center for Type Culture Collection, the deposit address is Wuhan University, Wuhan, China, and the postal code is 430072; The deposit number of the Bacillus subtilis BS01 strain is: CCTCC NO: M 2012485, the deposit date is November 28, 2012, the deposit unit is China Center for Type Culture Collection, the deposit address is Wuhan University, Wuhan, China, the postal code is 430072; The number of Lactobacillus johnsonii YH1136 strains is 1×10 9 CFU / mL -2×10 9 CFU / mL; The number of the Bacillus subtilis BS01 strain is 1×10 9 CFU / mL -2×10 9 CFU / mL; The ratio of the number of the Lactobacillus johnsonii YH1136 strain to the number of the Bacillus subtilis BS01 strain is 1-2:1; The method for alleviating intestinal damage caused by high altitude hypoxia exposure comprises at least one of (a) to (e): (a) Restore the decreased expression level of tight junction proteins caused by high altitude hypoxia exposure in mammals and restore intestinal barrier function; (b) upregulation of pro-inflammatory cytokines in the mammalian intestine; (c) reduce the level of harmful bacteria Escherichia coli in mammals and increase the level of beneficial bacteria Lactobacillus; (d) improving diarrhea in mammals; (e) Maintaining body weight in mammals.

2. The use as claimed in claim 1, characterized in that The composite bacterial agent of the Lactobacillus johnsonii YH1136 strain and the Bacillus subtilis BS01 strain is in the form of powder or aqueous solution.

3. The use as claimed in claim 1, characterized in that The drug also contains a pharmaceutically acceptable carrier.

4. The use as claimed in claim 1, characterized in that The mammals include humans; the tight junction proteins include Claudin-1, Occludin and ZO-1.

Images