SNP (Single Nucleotide Polymorphism) molecular marker related to duck cervical vertebra length and application thereof

Abstract

The invention relates to an SNP molecular marker related to duck cervical vertebra length and application thereof, and belongs to the technical field of molecular biology. According to the research, the SNP locus related to the cervical vertebra length character of the meat duck exists on the NC040050.1 chromosome of the reference genome PBH1.5 version of the melanmen duck for the first time by utilizing whole genome association analysis, the locus obviously influences the cervical vertebra length of the 10-week-old melanmen duck, and the CC genotype shows an excellent genotype. Therefore, the invention provides a pair of upstream and downstream primers for amplifying the flanking sequence of the molecular marker, performing genetic typing on the molecular marker through the flanking sequence, and implementing molecular marker-assisted selection according to the typing result. A reliable way is provided for breeding or cultivating local sheldrake varieties with longer cervical vertebra length, and the breeding process of meat ducks is accelerated.

Description

Technical Field

[0001] The invention relates to a SNP molecular marker related to duck cervical vertebra length and application thereof, belonging to the technical field of molecular biology. Background Art

[0002] Loumen duck is famous for its excellent meat quality. It is a fast-growing variety among dual-purpose ducks and has great prospects for development and utilization. In addition to duck meat, other parts of ducks, such as duck necks, are also important processing raw materials. The processing efficiency of cooked duck necks is generally related to the length of the duck neck. The longer the cervical vertebrae, the higher the efficiency. Therefore, quickly increasing the length of the duck neck of Loumen duck is an effective way to increase the income of Loumen duck by-products. At present, the conventional breeding method is to calculate the breeding value through pedigree and phenotype, and select and match according to the size of the breeding value. This method has a certain effect in breeding practice, but at a certain stage of selection and breeding, the genetic progress will gradually decrease, and the breeding effect will gradually deteriorate. At present, with the development of molecular biology technology, individuals can be genotyped at the genome level, and molecular markers that significantly affect specific phenotypes can be mined in combination with phenotypes. These important molecular markers can be used in breeding, combined with pedigree and phenotypic values ​​for molecular marker-assisted selection to improve the selection effect. For specific varieties and specific traits, it is necessary to find molecular markers that have a significant impact on the phenotype and can be quickly identified. Summary of the invention

[0003] The purpose of the present invention is to address the defects of the prior art, propose a SNP molecular marker related to the length of duck cervical vertebrae and its application, and provide a reliable way for breeding or cultivating local shelduck varieties with longer cervical vertebrae.

[0004] The present invention first provides a SNP molecular marker associated with the length of duck cervical vertebrae, the nucleotide sequence of the molecular marker is shown in SEQ ID NO: 3 or SEQ ID NO: 4, the SNP molecular marker is a T→C single nucleotide polymorphism (SNP) mutation, located at the 15321792 position on the chromosome of the Loumen duck reference genome PBH1.5 version NC_040050.1, the base is T or C, and the genotype is TT, TC or CC. The mutation site significantly affects the length of the cervical vertebrae of Loumen ducks, wherein the cervical vertebrae length of individuals with CC genotype is significantly longer than that of individuals with TT genotype and TC genotype.

[0005] The present invention determines the cervical vertebra length of the Loumen duck population at market age (10 weeks old), collects blood from each individual, resequencing the genome, and uses the GWAS method to find molecular markers significantly associated with cervical vertebra length. Statistical analysis of the molecular markers and phenotypes shows that the cervical vertebra length at this site varies significantly between different genotypes.

[0006] The present invention further provides an application of a SNP molecular marker associated with duck cervical vertebra length, wherein the detection method comprises the following steps: Step 1, extracting the total DNA of the duck genome to be tested; Step 2: using the total genomic DNA of the duck to be tested as a template, and using the duck DNA specific primers shown in SEQ ID NO: 1 and SEQ ID NO: 2 to perform PCR amplification to obtain an amplified product; Step 3: Sanger sequencing of the PCR product; Step 4: Determine the SNP molecular marker genotype based on the sequencing peak graph.

[0007] In step 1, the final concentration of the reaction system is calculated as follows based on 25 μl: Duck DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl.

[0008] The sequence of the upstream primer F is shown in SEQ ID NO: 1, and the sequence of the downstream primer R The sequence is shown in SEQ ID NO: 2; The reaction conditions of the PCR amplification are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 56°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; and storage at 20°C.

[0009] In step 4, the judgment standard is the cervical length of individuals with CC genotype at the SNP site. The cervical vertebra length of individuals with TT and TC genotypes was significantly higher than that of individuals with TT and TC genotypes.

[0010] The above method can be applied to the breeding of Loumen duck varieties. The breeding of Loumen duck varieties is the breeding of Loumen duck core groups. The Loumen duck core group is a group of individuals in the Loumen duck variety that participate in the breeding and measure the performance phenotype values ​​related to the breeding goals and are ranked in the top 20%.

[0011] The present invention uses genome-wide association analysis to find for the first time that there is a SNP site (T / C) on chromosome NC_040050.1 of Loumen duck that is associated with the trait of cervical vertebra length of meat ducks. This site significantly affects the cervical vertebra length of Loumen ducks at 10 weeks of age, and the CC genotype is an excellent genotype. Therefore, the present invention provides a pair of upstream and downstream primers (SEQ ID NO: 1 and SEQ ID NO: 2) for amplifying the molecular marker flanking sequence (SEQ ID NO: 3 or SEQ ID NO: 4), genotyping the molecular marker through the flanking sequence, and implementing molecular marker-assisted selection according to the typing results, which has the beneficial effect of being able to quickly identify the cervical vertebra length of ducks, providing a reliable way for selecting or cultivating local shelduck varieties with longer cervical vertebra lengths, and accelerating the breeding process of meat ducks. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is a Manhattan plot of genome association analysis. The horizontal axis is chromosome, showing that a site on chromosome NC_040050.1 is significantly correlated with cervical vertebra length at 10 weeks of age.

[0013] Figure 2 These are the peak graphs for three genotypes: TT, TC and CC. DETAILED DESCRIPTION

[0014] Example Identification of SNP molecular markers The cervical vertebra length of 500 10-week-old Loumen ducks was measured, and genomic DNA was extracted after blood was collected from the wing vein. The whole genome was resequenced using Illumina's HiSeq X-Ten sequencing platform, and the sequencing depth of each individual was 10×. After the data was quality controlled, BWA and GATK software were used for sequence alignment and genotype extraction. Combined with the 10-week-old cervical vertebra length and genotyping data, rMVP software was used for GWAS analysis of mixed linear models. The results are shown in the figure. Figure 1 As shown, the 15321792 site (T to C mutation) of chromosome 5 (NC_040050.1) was significantly associated with the cervical vertebra length of Loumen ducks at 10 weeks of age, among which the cervical vertebra length of the TT genotype was 21.58±1.63 cm, the cervical vertebra length of the TC genotype was 21.82±1.39 cm, and the cervical vertebra length of the CC genotype was 23.21±1.66 cm. The cervical vertebra length of the CC genotype was significantly higher than that of the TT genotype (P<0.05). The number of individuals with TT genotype, TC genotype and CC genotype were 150, 248 and 102, respectively, which was in line with the Hardy-Weinberg equilibrium law (P value was close to 1).

[0015] Primer design for identification of nucleotide polymorphism of NC_040050.1:15321792: According to the whole genome sequencing results, primers for identifying the nucleotide polymorphism of the NC_040050.1:15321792 site on the duck genome were designed as follows: Upstream primer: CCAAACTTTACGACAGCGGC (SEQ ID NO: 1) Downstream primer: GGACAGCAGATTGCAAACCC (SEQ ID NO: 2) The amplified product bands are: CCAAACTTTACGACAGCGGCTCTTGACCCCACAATCTCTAAAAGTATCAACTTTAAATCAGGAGAATAATTAGCAATGCTCTTAAGCCCTGACAGCTGCGAAGGTTTCCCAGTGCAGTTTTCCTTAGCGCAGGATGCGTTTTGGTAATG GGGAGAAGTGCAAACACGGCAGAATATCCATTCCCAGTCTCTGTGCTCCCGATATTTCTGCTCCAGAATTCCCTGGCAGGAAGGTAACACCCAACATTTCGCTGAGAAATGAGCTCGAGTTAAAAGGGTTTGCAATCTGCTGTCC (SEQID NO:3) CCAAACTTTACGACAGCGGCTTCTTGACCCCACAATCTCTAAAAGTATCAACTTTAAATCAGGAGAATAATTAGCAATGCTCTTAAGCCCTGACAGCTGCGAAGGTTTCCCAGTGCAGTTTTCCTTAGCGCAGGATGCGTTCTGGTA ATGGGGAGAAGTGCAAACACGGCAGAATATCCATTCCCAGTCTCTGTGCTCCGATATTTCTGCTCCCAGAATTCCCTGGCAGGAAGGTAACACCCAACATTTCGCTGAGAAATGAGCTCGAGTTAAAAGGGTTTGCAATCTGC (SEQ IDNO:4) Note: The 141st base is a mutant base.

[0016] Genotyping verification of Loumen duck population Experimental materials: Groups other than those used for genome resequencing at Kunshan Loumen Duck Conservation Farm (a total of 600 ducks) The first step is to obtain the genotype of each individual 1. Measure the cervical vertebra length of 600 ducks at 10 weeks of age; 2. Blood sample collection: Use EDTA2K vacuum blood collection tube to collect blood from each duck's wing vein and store it at -20℃ for later use; 3. Whole blood genomic DNA extraction; 4. Genotype determination: Take the genomic DNA of each duck to be tested as a template and use the primers designed in Example 2 for PCR amplification. The obtained product is sequenced by Sanger sequencing to obtain the following sequence: Figure 2 The peak graphs of the three genotypes, TT, TC and CC, are used to determine the genotype of each individual.

[0017] Step 2: SNP site and phenotype association analysis verification 1. Grouping with different typing information: The genotypes of the mutation sites were checked according to the sequence information, and the genotypes were divided into TT genotype group, TC genotype group and CC genotype group, with 182, 303 and 115 people in each group, respectively. The genotype distribution conformed to the Hardy-Weinberg equilibrium law (P value was 0.5568).

[0018] 2. The cervical vertebra lengths of the TT, TC, and CC genotype groups at 10 weeks of age were 20.93±1.59 cm, 20.79±1.82 cm, and 23.47±1.77 cm, respectively. A variance analysis of the cervical vertebra lengths of different genotype groups at 10 weeks of age showed that genotype differences were significantly correlated with cervical vertebra lengths at 10 weeks of age, among which the cervical vertebra lengths of the CC genotype group at 10 weeks of age were significantly higher than those of the TT and TC genotype groups. The C allele is an excellent allele that can significantly increase the cervical vertebra length of Loumen ducks at 10 weeks of age.

[0019] In addition to the above implementations, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. A SNP molecular marker associated with duck cervical vertebra length, Features: The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 3 or SEQ ID NO:

4. The SNP molecular marker is located at position 15321792 on chromosome NC_040050.1 of the Loumen duck reference genome PBH1.5 version, the base is T or C, and the genotype is TT, TC or CC.

2. The use of the SNP molecular marker associated with duck cervical vertebra length according to claim 1, Features: Used for molecular detection of cervical vertebra length of 10-week-old Loumen duck breed, the nucleotide sequence of duck DNA specific primer pair required for molecular marker detection is shown as SEQ ID NO: 1 and SEQ ID NO: 2, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO: 3 or SEQ ID NO:

4.

3. The use of the SNP molecular marker associated with duck cervical vertebra length according to claim 2, Features: The detection method comprises the following steps, Step 1, extracting the total DNA of the duck genome to be tested; Step 2: using the total genomic DNA of the duck to be tested as a template, and using the duck DNA-specific primers shown in SEQ ID NO: 1 and SEQ ID NO: 2 to perform PCR amplification to obtain an amplified product; Step 3: Sanger sequencing of the PCR product; Step 4: Determine the SNP molecular marker genotype based on the sequencing peak graph.

4. The use of the SNP molecular marker associated with duck cervical vertebra length according to claim 3, Features: In step 1, the final concentration of the reaction system is calculated as follows based on 25 μl: Duck DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl.

5. The sequence of the upstream primer F is shown in SEQ ID NO: 1, and the sequence of the downstream primer R is shown in SEQ ID NO: 2; The reaction conditions of the PCR amplification are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 56°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; and storage at 20°C.

6. The use of the SNP molecular marker associated with duck cervical vertebra length according to claim 3, Features: In the step 4, the judgment criterion is that the cervical vertebra length of individuals with CC genotype at the SNP site is significantly higher than the cervical vertebra length of individuals with TT genotype and TC genotype.

7. The use of the SNP molecular marker associated with duck cervical vertebra length according to claim 2, Features: The breeding of Loumen duck breed is the breeding of the core group of Loumen duck.

8. The use of the SNP molecular marker associated with duck cervical vertebra length according to claim 6, Features: The Loumen duck core group is a group composed of the top 20% of individuals in the Loumen duck breed that participated in the breeding and measurement of performance phenotypic values ​​related to the breeding objectives.

Images