High-temperature-resistant heterococcus and application thereof

Abstract

The invention discloses a high-temperature-resistant heterococcus and application thereof, and belongs to the technical field of algae. A high-temperature-resistant heterococcus sp. LBV11 strain is screened from Tengchong hot spring in Yunnan province and is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC M 20241316. Through biomass monitoring and culture condition optimization, rapid culture of the heterococcus is successfully realized. The Xenococcus sp. LBV11 screened by the invention can stably grow and keep good activity under the conditions that the temperature is 40 to 50 DEG C, the illumination is 12 to 16 hours / the dark environment is 8 to 12 hours, the illumination condition is 3000 to 5000 Lux, and the humidity is 60 to 65 percent. The algal strain is rich in nutritional ingredients and high in protein content, and phycocyanin in the algal strain has remarkable thermal stability. And when being cultured in the culture wastewater, the strain has relatively strong absorption capacity on main pollutants such as nitrogen and phosphorus in the culture wastewater, and shows an excellent effect in the aspect of water purification. Therefore, the heterococcus has wide application potential and commercial value in the fields of feed additives and water treatment, provides a new idea and an efficient solution for ecological treatment of aquaculture wastewater, and has a good market application prospect.

Description

Technical Field

[0001] The invention relates to the technical field of algae, and in particular to a high-temperature resistant Heterococcus algae and its application. Background Art

[0002] my country is a country facing major challenges in water resources and water environment protection. The huge amount of nitrogen and phosphorus emissions in aquaculture wastewater puts pressure on water pollution. Microalgae have the ability to efficiently remove pollutants such as nitrogen, phosphorus, and heavy metals in water treatment, and at the same time improve the ecological environment of water bodies by increasing oxygen through photosynthesis. Microalgae are highly adaptable and easy to apply on a large scale. They are a water purification method that conforms to sustainable development and are widely used in agricultural, industrial and domestic sewage treatment. In addition, as an efficient photosynthetic carbon-fixing organism, microalgae have a photosynthetic carbon-fixing efficiency that is 10 to 50 times that of plants, a fast growth rate, and an acreage yield that is more than 10 times that of traditional grain crops. Moreover, microalgae protein has a balanced amino acid content and is easily digestible by cells. It is an excellent feed protein raw material and is suitable for resource utilization purposes such as feed and fertilizer.

[0003] Microalgae treatment of wastewater under high temperature has a significant effect on the removal of nitrogen (N), phosphorus (P), total organic carbon (TOC) and chemical oxygen demand (COD). High temperature promotes the growth of microalgae, enhances its ability to absorb nitrogen and phosphorus, converts nitrogen into amino acids and proteins through photosynthesis and metabolism, and converts phosphorus into intracellular inorganic phosphorus. In addition, high temperature enhances the microalgae's ability to degrade organic matter, effectively reduces TOC and COD values, and significantly reduces organic carbon and biodegradable organic matter in wastewater.

[0004] High temperature environment significantly improves the removal effect of microalgae on major pollutants in wastewater treatment, showing good application potential. However, the suitable growth temperature range for normal microalgae is about 25℃-35℃. Growth will be affected or even impossible at higher temperatures and salt concentrations. Excessively high temperatures will affect the enzyme activity in algae cells, destroy the cell membrane structure, and reduce photosynthesis efficiency, thereby affecting their normal growth and metabolic activities. Conventional microalgae are obviously not suitable for growth in a high temperature environment. It is a reasonable strategy to develop and screen a strain of high temperature resistant microalgae for its high temperature environment.

[0005] The water temperature of Tengchong hot springs in Yunnan is generally between 40℃ and 50℃. A strain of algae with high protein content was screened from its water samples and identified as Xenococcus sp. As a member of cyanobacteria, Xenococcus sp. is famous for its ability to adapt to extreme environments. They can survive in various extreme conditions, including high temperature, high salt, high ultraviolet radiation and drought. This adaptability makes them occupy an important position in environmental changes and extreme ecosystems. Therefore, the high temperature resistance of Xenococcus sp. can be used to cultivate it in aquaculture wastewater under high temperature environment to absorb nitrogen and phosphorus and reduce the nitrogen and phosphorus content in the water body. When cultivating Xenococcus sp. under high temperature environment, in addition to being able to effectively absorb nitrogen and phosphorus in wastewater, its protein content can also be increased by optimizing culture conditions and technical means. The protein structure in high temperature resistant algae is usually more stable than that of ordinary algae, and this stability helps to improve the utilization rate and thermal stability of phycocyanin. Because the high temperature resistant algae have been naturally selected, the hydrogen bonds and hydrophobic interactions of proteins are stronger, making it less likely to denature under high temperature environment. This property enhances the thermal stability of phycocyanin, thereby improving its application value as a feed additive. Overall, Heterococcus has significant potential in the field of feed additives and water treatment. It provides new ideas and efficient solutions for the ecological treatment of aquaculture wastewater and has good market application prospects. With the continuous excavation and in-depth exploration of Heterococcus, it is expected to be more widely used in the global agricultural and industrial fields in the future. Summary of the invention

[0006] The present invention separates and purifies a high temperature resistant algae strain from hot spring water in Tengchong, Yunnan. It appears dark green in culture medium, tends to be black, and can aggregate into sheets. Through optical microscope observation, Xenococcus presents spherical or ellipsoidal cells, the cells are large, irregular in shape, and the cell walls are usually thicker and appear to be more solid. The cells contain multiple green chloroplasts, which appear yellow-green. In addition, Xenococcus often forms aggregates, and single cells are wrapped by a layer of sticky substances to form characteristic gelatinous masses. The 16S rRNA gene sequence obtained by sequencing is shown in SEQ ID NO:1. The sequence is compared in the NCBI database and has a high similarity with the group of the genus Xenococcus. It is named Xenococcus LBV11, and its Latin name is Xenococcus sp. LBV11.

[0007] Based on this, the present invention protects the following technical scheme: the high temperature resistant and high protein producing Xenococcus sp.LBV11 is deposited in the Classification Culture Collection Center with the deposit number of CCTCC M20241316

[0008] The above-mentioned method for cultivating Heterococcus aureus comprises the following steps:

[0009] 1. Algae activation: Streak Xenococcus sp.LBV11 on solid culture medium and culture under conditions of 40-50°C, 12-16h light / 8-12h dark, and 60%-65% humidity until a single algae colony grows;

[0010] 2. Seed liquid culture: inoculate the activated algae strain into liquid culture medium and culture at 40-50°C to obtain seed culture solution;

[0011] 3. Liquid fermentation: Add the seed culture solution obtained in step 2 into the liquid culture medium at a volume percentage of 4%-8% and culture at 40-50°C.

[0012] Preferably, the modified culture medium is formulated as follows:

[0013] The improved BG11 culture medium formula is sodium nitrate (NaNO3): 2g / L; potassium dihydrogen phosphate (K2HPO4): 0.06g / L; magnesium sulfate (MgSO4·7H2O): 0.075g / L; calcium chloride (CaCl2·2H2O): 0.036g / L; sodium carbonate (Na2CO3): 0.02g / L; citric acid: 0.006g / L; ammonium ferric citrate: 0.01g / L; EDTA-Na2: 0.001g / L; trace element solution: 1mL, including H3BO3 2.86g / L, MnCl2·4H2O 1.81g / L, ZnSO4 0.222g / L, Na2MoO4 0.39g / L, CuSO4·5H2O 0.079g / L, Co(NO3)2·6H2O 0.049 g / L was used as liquid culture medium, and 1.5% agar was added to the solid culture medium.

[0014] Preferably, the culturing method is carried out at two different temperatures: 40°C and 50°C.

[0015] Preferably, the culturing is carried out under a light intensity of 3000-5000 Lux.

[0016] Preferably, the culture method is to culture with continuous air supply.

[0017] The present invention also provides application of the above-mentioned high temperature resistant Heterococcus in feed additives.

[0018] Preferably, the above-mentioned application method is: harvest the cultured Xenococcus sp.LBV11. Use a high-speed refrigerated centrifuge for centrifugal dehydration for 10 minutes, at a temperature of 4°C and a speed of 8000r / min to ensure that the water content is minimized without affecting the nutritional components and physical structure of the algal cells. Finally, the dehydrated Xenococcus sp. is freeze-dried and preserved through a freeze-drying process. The freeze-dried powder of Xenococcus sp. can be directly added to feed as an additive. The Xenococcus sp. powder is dissolved in phosphate buffered saline (PBS) pH 6.8 and placed in an ultrasonic device, and ultrasonic vibrations are used to destroy the cell wall to release phycocyanin. The phycocyanin has good thermal stability and is a natural pigment, which is used in feed as a feed additive.

[0019] The present invention also provides the use of the above-mentioned high temperature resistant Heterococcus in aquaculture wastewater treatment

[0020] Preferably, the above application method is: centrifuge the cultured Xenococcus sp.LBV11, discard the culture medium, and wash with ultrapure water. Dilute the aquaculture wastewater to 30% with ultrapure water, inoculate Heterococcus sp. in 30% aquaculture wastewater and culture at 40°C. Cultivate for 14 days to reduce the nitrogen, phosphorus and total organic carbon content of aquaculture wastewater, mainly in high temperature weather, and use Heterococcus sp. in the treatment of aquaculture wastewater.

[0021] The present invention has the following beneficial advantages:

[0022] (1) The present invention successfully realizes the rapid cultivation of the Xenococcus sp. by monitoring biomass and optimizing culture conditions. The Xenococcus sp. LBV11 screened by the present invention can stably grow and maintain good activity under 40-50°C, 12-16h light / 8-12h dark environment, 3000-5000Lux lighting conditions, and 60-65% humidity. It has good high temperature tolerance.

[0023] (2) The heterosphaera of the present invention is not only rich in nutrients, but also has a high protein content, and the phycocyanin has significant thermal stability. When cultured in aquaculture wastewater, it has a strong absorption capacity for major pollutants in aquaculture wastewater such as nitrogen and phosphorus, and shows excellent effects in water purification. Therefore, the heterosphaera has broad application potential and commercial value in the fields of feed additives and water treatment, provides new ideas and efficient solutions for the ecological treatment of aquaculture wastewater, and has good market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0025] Figure 1 This is an optical microscope photo of Xenococcus sp.LBV11;

[0026] Figure 2 Phylogenetic tree constructed by comparing the 16S rRNA gene of Xenococcus sp.LBV11 with other cyanobacteria;

[0027] Figure 3 Growth curve of Xenococcus sp.LBV11 algae cells cultured with aeration at different temperatures (fixed light intensity 3000Lux)

[0028] Figure 4 To analyze the content of protein, carbohydrates and lipids in Xenococcus sp.LBV11;

[0029] Figure 5 To analyze the content of phycocyanin in Xenococcus sp.LBV11;

[0030] Figure 6 The study is about the cultivation of Xenococcus sp.LBV11 in wastewater and its effect on nitrogen removal in wastewater.

[0031] Figure 7 The removal of phosphorus from wastewater by Xenococcus sp.LBV11;

[0032] Figure 8 The removal of TOC from wastewater by Xenococcus sp.LBV11. DETAILED DESCRIPTION

[0033] The specific implementation of the present invention is further described in detail below in conjunction with specific implementation examples. Obviously, the described implementation examples are only part of the implementation examples of the present invention, rather than all the implementation examples. Based on the implementation examples in the present invention, all other implementation examples obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0034] Embodiment 1

[0035] Isolation, screening and identification of algae species

[0036] 8 samples of hot spring water collected from Tengchong, Yunnan Province contain obvious green algae. The suspension was aspirated and gradiently diluted 100 times and 1000 times, and the mixture was shaken. 100 μL was aspirated from the two diluted suspensions and coated on a solid plate of BG11 containing 100 mg / L ampicillin and 50 mg / L kanamycin, with 3 replicates per group. The plate was placed in a 30°C constant temperature light incubator for culture (light intensity 3000 Lux, humidity 65%, light 12h / dark 12h) and inverted for 7-10 days until a single algae colony grew out. Pick a single algae colony for microscopic observation and streak it on a new BG11 solid culture medium through a plate, further separate and purify it, add the purified single algae colony to a culture medium containing a small amount of antibiotics, and continue to culture it in a constant temperature incubator for 7 days. After that, the microscopic structure of Heterococcus was observed under a microscope.

[0037] A single algae colony was picked and placed in 10 μL sterile water, boiled at 100°C for 10 min, and amplified using conventional 16s rRNA ITS region universal primers. After agarose gel electrophoresis identification, the PCR product was sent for sequencing. The sequence identified correctly by sequencing was named Xenococcus sp.LBV11, and then sequence alignment was performed using Blast in NCBI, and an evolutionary tree was constructed using Mega software.

[0038] Table 1 16S rRNA amplification primers

[0039]

[0040] Table 2 PCR reaction system

[0041]

[0042] Embodiment 2

[0043] Xenococcus sp.LBV11 cultured with aeration at different temperatures

[0044] Xenococcus sp.LBV11 was expanded and cultured, and the inoculation amount was 4% and inoculated into 1LBG11 culture medium, and the light intensity in the light incubator was set to 3000 Lux, the humidity was 65%, the light was 12 hours / darkness was 12 hours, and the temperature was set to 40°C and 50°C respectively, and the culture was aerated uninterruptedly during this period. During the process of 0-14 days, samples were taken every two days, and the absorbance value of the algae cells at 680nm was measured by ultraviolet spectrophotometer. Subsequently, the Xenococcus sp.LBV11 cultured at the two temperatures was harvested. A high-speed refrigerated centrifuge was used for centrifugal dehydration for 10 minutes, the temperature was 4°C, and the speed was 8000r / min to ensure that the water content of the algae cells was minimized without affecting the nutritional components and physical structure of the algae cells. Finally, the dehydrated Heterococcus sp. was freeze-dried and stored by freeze-drying process.

[0045] Embodiment 3

[0046] Detection of protein content in Xenococcus sp.LBV11

[0047] Test method: Accurately weigh 0.2g algae powder in the digestion tube, accurately weigh 3g potassium sulfate and 0.2g anhydrous copper sulfate in the digestion tube, weigh 0.2g sucrose and an equal amount of catalytic reagent in the blank group, add 10mL concentrated sulfuric acid to the blank group and the experimental group, and add 4-5 zeolites to each digestion tube for digestion. After digestion, wait until it cools to room temperature and use an automatic Kjeldahl nitrogen analyzer to determine its total nitrogen content.

[0048] The protein content was calculated as

[0049] W=(V-V0)*C*14*6.25*100 / m

[0050] V: Volume of hydrochloric acid standard titration solution consumed by titrating the sample (mL)

[0051] V0: Volume of hydrochloric acid standard titration solution consumed in titration blank (mL)

[0052] C: Concentration of hydrochloric acid standard titration solution (mol / L)

[0053] 14: Molar mass of nitrogen (g / mL)

[0054] 6.25: Average coefficient for conversion of nitrogen to crude protein

[0055] m: mass of the sample (g)

[0056] Embodiment 4

[0057] Determination of Amino Acid Content in Xenococcus sp.LBV11

[0058] Test method: 12 mol / L hydrochloric acid and 0.4 g freeze-dried algae powder were used in a volume mass ratio (v / m) of 10:1 and magnetically stirred at 110°C for 14 hours to fully acidify the protein. Fully dry in an oven at 80°C for 24 hours. Take 400 μL of the above solution, place it in an EP tube, add 1 mol / L triethylamine acetonitrile solution (measure 1.4 mL triethylamine to a 10 mL volumetric flask, dilute to 10 mL with acetonitrile, and store at 4°C) 200 μL, 0.1 mol / L phenyl isothiocyanate acetonitrile solution (measure 0.12 mL phenyl isothiocyanate and dilute to 10 mL with acetonitrile, and store at 4°C) 200 μL, mix well, place at room temperature away from light for 1 hour, add 800 μL of n-hexane, vortex and oscillate, place for 10 minutes, centrifuge at 5000 rpm for 5 minutes, take the lower layer of solution, and prepare the derivatization solution, that is, the mixed reference derivatization solution. Amino acid standards were derivatized in the same manner.

[0059] A C18 chromatographic column (250 mm × 4.6 mm, 5 μm) was used, the column temperature was 43 °C, the mobile phase A was 0.1 mol / L sodium acetate buffer (adjusted to pH 6.5 with acetic acid)-acetonitrile (93:7), the mobile phase B was acetonitrile-water (4:1), the gradient elution program was shown in the table, the flow rate was 1.0 mL / min, the detection wavelength was 254 nm, and the injection volume was 10 μL.

[0060] Table 3 Gradient elution program:

[0061]

[0062] Embodiment 5

[0063] Detection of polysaccharide content in Xenococcus sp.LBV11

[0064] Test method: Weigh the Heterococcus powder, use the phenol-sulfuric acid method to determine its polysaccharide content, measure the absorbance at λ=490nm, and calculate the total sugar according to the glucose standard curve.

[0065] Carbohydrate content (%) = (sample concentration × dilution factor) / sample volume (g) × 100

[0066] Embodiment 6

[0067] Detection of lipid content in Xenococcus sp.LBV11

[0068] Test method: The lipids in the algae powder were extracted with n-hexane and the dry weight was obtained by rotary evaporation to obtain the lipid content in the algae powder. Specific steps: The Bligh-Dyer method was used for lipid extraction. Accurately weigh 0.2g of algae powder, add 4mL of a mixture of ethyl acetate and ethanol (v / v 1:1), stir magnetically at room temperature for 270min, then add 4mL of deionized water and 2mL of n-hexane in turn, shake and mix, centrifuge at 25℃3500g for 10min, repeat the extraction twice, collect and combine the top layer of solution into a pre-weighed glass tube, and finally remove the solvent and weigh it with a nitrogen gas flow. The lipid content is calculated using the following formula.

[0069] Lipid extraction content (mg / g) = (W2-W1) / W0

[0070] Wherein: W1 is the initial weight of the round-bottom flask, g; W2 is the weight of the round-bottom flask after the solvent evaporates, g; W0 is the weight of Euglena gracilis after the pigment is extracted, g.

[0071] Embodiment 7

[0072] Extraction and content determination of phycobiliprotein from Xenococcus sp.LBV11

[0073] Test method: Use phosphate buffered saline (PBS) pH 6.8 to extract phycobiliprotein from Xenococcus sp.LBV11 at room temperature, and use a UV spectrophotometer to measure the absorbance at 562nm, 620nm and 652nm. Phycobiliprotein is divided into three types: phycocyanin (PC), allophycocyanin (APC), and phycoerythrin (PE). The content of these three proteins is calculated using the following formula.

[0074] Phycocyanin (PC) = (A 620 -0.047×A 652 ) / 5.34

[0075] Allophycocyanin (APC) = (A 652 -0.208×A 620 ) / 5.09

[0076] Phycoerythrin (PE) = (A 652 -2.41×PC-0.849×APC) / 9.62

[0077] Embodiment 8

[0078] Cultivation of Xenococcus sp.LBV11 in wastewater and its removal effect on total nitrogen and ammonia nitrogen in wastewater

[0079] Test method: Dilute the aquaculture wastewater to 30% with ultrapure water, inoculate the algae in 30% aquaculture wastewater and culture at 40°C. During the 0-14 days of culture, sample 5 mL of algae solution every 2 days, centrifuge at 6000 rpm for 5 minutes, retain the supernatant, filter with 0.22 μm filter membrane, and determine the concentration of total nitrogen and ammonia nitrogen in the supernatant. The total nitrogen content in the wastewater is determined by the instrument. The total nitrogen detection reagent is dissolved in water, and 1 mL of the water sample to be tested is diluted 10 times and added to the digestion tube. Ultrapure water is used as a blank control, and 0.5 mL of alkaline potassium persulfate is added to each of them for digestion for 30 minutes. After cooling, take out 0.25 mL of the solution, add two drops of reagent 2, then add 0.6 mL of reagent 3, and then add 5 mL of reagent 4 and shake well for detection. Read the instrument reading. The determination of ammonia nitrogen is carried out by adding the above-mentioned water sample diluted 10 times to the ammonia nitrogen activator, and readings are taken after standing for reaction.

[0080] Embodiment 9

[0081] Removal effect of total phosphorus in wastewater by Xenococcus sp.LBV11

[0082] Test method: Phosphorus (PO43-) in wastewater is determined by ammonium molybdate spectrophotometry. During the 0-14 days of cultivation, 5 mL of algae solution is sampled every 2 days, centrifuged at 6000 rpm for 5 minutes, the supernatant is retained, and the concentration of total phosphorus in the supernatant is determined after filtering with a 0.22 μm filter membrane. Take 10 50 mL colorimetric tubes, add 0, 1, 2, 4, 6, 8, 10, 12, 14 and 16 mL of working solution respectively, and dilute to the 25 mL mark with ultrapure water. Add 4 mL of 5% potassium persulfate solution and sterilize by high pressure for 30 minutes. After cooling, add ultrapure water to dilute to the 50 mL mark, then add 1 mL of 10% ascorbic acid solution, add 2 mL of molybdate solution after 30 seconds, mix well, leave at room temperature for 15 minutes, and measure the absorbance at a wavelength of 700 nm with ultrapure water as a reference.

[0083] Embodiment 10

[0084] Removal effect of TOC in wastewater by Xenococcus sp.LBV11

[0085] Test method: TOC in wastewater is measured by instrument. During the 0-14 days of cultivation, 5 mL of algae solution is sampled every 2 days, centrifuged at 6000 rpm for 5 minutes, the supernatant is retained, and the TOC concentration in the supernatant is measured after filtering with a 0.22 μm filter membrane. The water sample to be tested is diluted 10 times, 20 mL is taken and placed under the TOC detector, the standard curve that has been measured is set, and the program is run for measurement.

[0086] Results Analysis

[0087] 1. Screening and identification of algae species

[0088] The algae species in Tengchong hot spring were separated and purified by plate streaking, and a strain of Heterococcus was identified through morphological observation and 16s RNA analysis. It appears dark green and black in the culture medium, and can aggregate into sheets. Through optical microscopy, Heterococcus presents spherical or ellipsoidal cells. The cells are large and irregular in shape. The cell walls are usually thicker and appear to be more solid. There are multiple green chloroplasts in the cells, which appear yellow-green. In addition, Heterococcus often forms aggregates, and individual cells are wrapped in a layer of sticky substances to form characteristic gelatinous clumps. These characteristics make Heterococcus easy to identify under a microscope. After Blast alignment of its sequence on NCBI Genbank, it was found that the Query Cover of Xenococcus sp.CR L 15 and CR 15M was 94%, and the Per.ident was 97.21%; and the Query Cover of Xenococcus sp.316 was 91%, and the Per.ident was 97.8%. The phylogenetic tree is as follows Figure 2 As shown. Based on morphological and sequencing analysis, the algae was named Xenococcus sp. LBV11. The present invention isolated and purified a high temperature resistant algae with high protein content from the hot spring water of Tengchong, Yunnan. Liquid culture shows dark green, black, and can be aggregated into sheets. Under the microscope, the morphology shows multiple spheres aggregated into irregular spheres, showing yellow-green, showing the typical morphology of Xenococcus sp.

[0089] The gene sequence of 16S rRNA is shown in SEQ ID NO.1:

[0090] GAAGTCCGAGAGGGAACAGCGGGAACTGCTGCTAATACCCAATAAGCCTA

[0091] AGGGTAAAAGAAATTCGCCTAGAGAGGGGCTCGCGTCCGATTAGCTAGTTG

[0092] GTGGGGTAAGAGCCTACCAAGGCGACGATCGGTAGCTGGTCTGAGAGGAT

[0093] GAGCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCA

[0094] GCAGTGGGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGCAATACCGC

[0095] GTGAGGGAGGAAGGCTCTTGGGTTGTAAACCTCTTTTCTGGGGGAAGAAG

[0096] TCCTGACGGTACCCCAGGAATCAGCATCGGCTAACTCCGTGCCAGCAGCCG

[0097] CGGTAATACGGAGGATGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGT

[0098] CCGCAGGTGGTACATCAAGTCTGCTGTCAAAGACCGGAGCTTAACTCCGG

[0099] ACAGGCAGTGGAAACTGGTGAACTAGAGTACGGTAGGGGTAGAGGGAATT

[0100] CCCAGTGTAGCGGTGAAATGCGTAGAGATTGGGAAGAACACCAGTGGCGA

[0101] AGGCGCTCTACTGGGCCGTAACTGACACTAAGGGACGAAAGCTAGGGGAG

[0102] CGAATGGGATTAGATACCCCATTATTCACCCCTTTTTCCCCTCC

[0103] 2. The deposit information of algae species Xenococcus sp.LBV11 is as follows:

[0104] The algae species LBV11 was sent to the China Type Culture Collection (CCTCC) in Wuhan for identification and preservation. The preservation time is June 20, 2024, the preservation number is CCTCC M 20241316; the classification name is Xenococcus sp.LBV11.

[0105] 3. Growth curve of Xenococcus sp.LBV11 at different temperatures

[0106] Comparison of the growth status of Xenococcus sp.LBV11 at 40℃ and 50℃, such as Figure 3As shown in the figure, the algae strain showed good growth adaptability under both temperature conditions. The results showed that Xenococcus sp.LBV11 still maintained stable growth ability in high temperature environment, reflecting its significant tolerance to high temperature environment. In particular, during the culture period of 0 to 14 days, the cell density of the algae strain accumulated rapidly and the growth rate was relatively stable. This stable proliferation trend shows that Xenococcus sp.LBV11 can still maintain a relatively consistent growth rate under temperature fluctuations. Further analysis found that under the culture condition of 40℃, the cell density of Xenococcus sp.LBV11 was higher than that at 50℃ at each time point, indicating that the growth effect of the algae strain at 40℃ was more significant. 40℃ may provide a more ideal metabolic environment for the algae strain, promoting the proliferation and vitality of cells. At 50℃, although the growth was still good, its cell density was lower than that at 40℃, indicating that higher temperature may have a certain inhibitory effect on growth. These results indicate that 40°C is more suitable as the culture temperature for Xenococcus sp.LBV11, which can ensure its rapid proliferation and provide support for subsequent applications.

[0107] 4. Analysis of the main nutrients in Xenococcus sp.LBV11

[0108] The contents of various nutrients (protein, carbohydrates, and lipids) of Xenococcus sp.LBV11 after cultivation at 40°C and 50°C are as follows Figure 4 As shown in the results, the protein content of Xenococcus sp.LBV11 reached the highest level of 46.0% under the culture condition of 40℃. In contrast, the protein content under 50℃ decreased to 39.9%, indicating that higher temperature may be unfavorable for protein accumulation. In addition, the total sugar content of the strain was also high at 40℃, reaching 22.59%, while it decreased to 19.44% at 50℃. The difference in lipid content was also obvious, with the lipid content at 40℃ being 16.3% and decreasing to 12.6% at 50℃. These data together indicate that the culture condition of 40℃ is more suitable for the accumulation of nutrients of Xenococcus sp.LBV11 strain, especially in the synthesis of proteins and lipids. It is speculated that 40℃ may be a more ideal culture temperature for the strain, which helps to optimize its nutritional value and achieve a higher level of accumulation of key components such as proteins and lipids, which has important reference value for subsequent application research.

[0109] 5. Analysis of amino acid content of Xenococcus sp.LBV11

[0110] As one of the important nutritional factors for animal growth, the richness and content of amino acids play a very important role in the growth process of animals. The amino acid content of Xenococcus sp.LBV11 is shown in Table 4 below. The content of lysine in the essential amino acids is relatively high among the essential amino acids, which is 7.83 mg / g. This is of great significance to human protein synthesis, immune function and calcium absorption. Leucine and isoleucine are 4.57 mg / g and 1.28 mg / g respectively, which are important amino acids for promoting muscle growth and tissue repair. The contents of phenylalanine and valine are 14.13 mg / g and 1.64 mg / g respectively, which are helpful for the production of neurotransmitters and energy metabolism. The content of threonine is low, at 1.72 mg / g, but it also plays a role in maintaining the health of the immune system and protein balance. The content of methionine is 5.62 mg / g, which is a medium level among the essential amino acids. Methionine plays a variety of roles in the body, such as anti-oxidation, supporting liver health and promoting protein synthesis. In addition, Xenococcus sp. LBV11 is also rich in non-essential amino acids, especially aspartic acid, glutamic acid and arginine, which play an important role in protein metabolism, immune support and antioxidant function. The amino acid composition of this algae strain is balanced, with both essential and non-essential amino acids, which has significant nutritional value and broad health potential, and can be used as a supplementary source of high-quality protein in the diet.

[0111] Table 4 Amino acid content analysis of Xenococcus sp.LBV11

[0112]

[0113] 6. Phycocyanin content of Xenococcus sp.LBV11

[0114] Phycocyanin is an important pigment protein in cyanobacteria. In this study, the results of the assay were as follows Figure 5 The results showed that the phycocyanin content in Xenococcus sp.LBV11 was 56.65 mg / g, indicating that it is highly abundant in cyanobacteria. In addition, the content of allophycocyanin was also determined, with a result of 32.71 mg / g. Under 40°C culture conditions, Xenococcus sp.LBV11 may exhibit higher thermal stability of phycocyanin. After being cultured in a high temperature environment, the structure of its phycocyanin has been optimized so that it can remain stable at high temperatures. This adaptability helps it survive in extreme environments. The molecular structure of phycocyanin may contain more hydrophobic amino acids, which enhances its stability at high temperatures. The experimental results may show that the extraction amount and activity of phycocyanin in Xenococcus sp.LBV11 cultured at 40°C remain high, which further confirms its stronger thermal stability.

[0115] 7. Cultivation of Xenococcus sp.LBV11 in wastewater and its removal effect on total nitrogen (TN) and ammonia nitrogen in wastewater

[0116] The results show that Xenococcus sp.LBV11 has a significant effect on the removal of TN and ammonia nitrogen in wastewater. Figure 6 As shown in the results, after 14 days of cultivation in aquaculture wastewater at a temperature of 40°C and a concentration of 30%, the algae strain showed excellent nitrogen removal ability. On the 4th day of cultivation, the removal rates of TN and ammonia nitrogen reached more than 82.12% and 91.26%, respectively, indicating that it had a strong nitrogen removal effect at an early stage. As the cultivation time increased, the removal rate further increased. On the 14th day, the removal rates of TN and ammonia nitrogen reached 89.22% and 92.37%, respectively. These data show that Xenococcus sp.LBV11 has excellent nitrogen removal effects under high temperature and a certain concentration of aquaculture wastewater, especially in the early stage. It can efficiently reduce the nitrogen content in the wastewater, which provides a potential bioremediation method for the removal of TN and ammonia nitrogen in wastewater treatment.

[0117] 8. Removal effect of Xenococcus sp.LBV11 on total phosphorus (TP) in wastewater

[0118] According to the test results, Xenococcus sp.LBV11 has a significant effect on the removal of total phosphorus (TP) in wastewater treatment. Figure 7 As shown in the figure, after 14 days of cultivation in aquaculture wastewater at a temperature of 40°C and a concentration of 30%, the algae strain showed a strong ability to remove phosphorus. On the second day of cultivation, the TP removal rate reached more than 79.89%, showing its good effect in removing phosphorus in a short time. On the 14th day of cultivation, the total phosphorus removal rate reached 91.69%, indicating that the algae strain has excellent ability in phosphorus treatment, thus playing a positive role in improving water quality.

[0119] 9. Removal of Total Organic Carbon (TOC) from Wastewater by Xenococcus sp.LBV11

[0120] In the process of wastewater treatment, Xenococcus sp.LBV11 showed significant TOC removal ability. Figure 8 As shown in the results, after 14 days of cultivation, the algae strain achieved a removal rate of 93.56% for total organic carbon (TOC). This result shows that Xenococcus sp.LBV11 not only effectively removes TOC components in wastewater, but also maintains a high removal capacity during long-term cultivation, demonstrating its potential in the field of wastewater treatment.

[0121] As mentioned above, the above examples are only used to explain the technical solutions of the present invention, rather than to limit the present invention; although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that it is still possible to modify the technical solutions described in the above embodiments, or to replace some technical features equivalently; and such changes or substitutions will not cause the essence of the respective technical solutions to deviate from the spirit and scope of each implementation mode in the present invention.

Claims

1. A thermostable Heterococcus sp., characterized in that: The Xenococcus sp. is Xenococcus sp. LBV11, which has been deposited in China Center for Type Culture Collection with the deposit number of CCTCC M20241316.

2. The heat-resistant Heterococcus sp. according to claim 1, characterized in that: The single cells of the Heterococcus algae are precisely separated under a microscope by micromanipulation technology, and the Heterococcus algae that can withstand high temperatures of 40°C-50°C are obtained by high-temperature culture.

3. The method for culturing the high temperature resistant Heterococcus sp. according to claim 2 is characterized in that: The following steps are involved: (1) Activating algae: streaking Xenococcus sp. LBV11 on a modified BG11 solid medium, culturing at 40-50° C., 12-16 h light / 8-12 h dark, light intensity of 3000-5000 lux, and humidity of 60%-65% until a single algae colony grows; (2) Seed liquid culture: inoculate the activated algae strain into a liquid culture medium and culture at 40°C-50°C to obtain a seed culture solution; (3) Liquid expansion culture: Add the seed culture solution obtained in step 2 into the liquid culture medium at a volume percentage of 4%-8% and culture at 40-50°C.

4. The method for culturing the high temperature resistant Heterococcus sp. according to claim 3, characterized in that: The improved BG11 culture medium formula is sodium nitrate (NaNO3): 2g / L; potassium dihydrogen phosphate (K2HPO4): 0.06g / L; magnesium sulfate (MgSO4·7H2O): 0.075g / L; calcium chloride (CaCl2·2H2O): 0.036g / L; sodium carbonate (Na2CO3): 0.02g / L; Citric acid: 0.006 g / L; ammonium ferric citrate: 0.01 g / L; EDTA-Na2: 0.001 g / L; trace element solution: 1 mL, including H3BO3 2.86 g / L, MnCl2·4H2O1.81 g / L, ZnSO4 0.222 g / L, Na2MoO4 0.39 g / L, CuSO4·5H2O 0.079 g / L, Co(NO3)2·6H2O0.049 g / L as liquid culture medium, and 1.5% agar is added to the solid culture medium on this basis.

5. Use of the high temperature resistant Heterococcus as claimed in claim 1 in feed additive or aquaculture wastewater treatment.

6. The use of the high temperature resistant Heterococcus as claimed in claim 5, characterized in that: The high temperature resistant Heterococcus has a high protein content and good thermal stability of phycocyanin, and is mainly used as a feed additive.

7. The use of the high temperature resistant Heterococcus as claimed in claim 5, characterized in that: The high temperature resistant Heterococcus aeruginosa is used in regulating nitrogen, phosphorus and total organic carbon in aquaculture wastewater.

Images