Application of reagent for detecting methylation level of molecular marker in preparation of product for diagnosing lung adenocarcinoma

Abstract

The invention belongs to the technical field of disease diagnosis, and particularly relates to application of a reagent for detecting the methylation level of a molecular marker in preparation of a product for diagnosing lung adenocarcinoma. The molecular marker is at least one of a full length or a methylation region of positive chain DNA (Deoxyribonucleic Acid) of Chr11: 62525877-62526116 bp or negative chain DNA of Chr11: 62525877-62526116 bp, and the reference genome is GRCh38.p14. The invention further discloses a method for detecting the GRCh38.p14 gene. According to the present invention, with the Chr11: 62525877-62526116 bp positive chain DNA sequence or / and the Chr11: 62525877-62526116 bp negative chain DNA sequence as the marker, the good sensitivity and the good specificity are provided for the lung adenocarcinoma plasma sample and the lung adenocarcinoma tissue sample, and the lung adenocarcinoma can be used for the early diagnosis and the screening of the lung adenocarcinoma;

Description

Technical Field

[0001] The present invention belongs to the technical field of disease diagnosis, and in particular relates to use of a reagent for detecting the methylation level of a molecular marker in preparing a product for diagnosing lung adenocarcinoma. Background Art

[0002] Lung cancer is one of the most harmful malignant tumors to human health and life. Globally, its incidence rate is second only to breast cancer, while its mortality rate ranks first. The China Cancer Center has released the latest national cancer statistics, and lung cancer still ranks first in the incidence and mortality of malignant tumors in my country. Lung cancer is divided into two categories according to pathological histological types: small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC). Lung adenocarcinoma is a common clinical pathological subtype of NSCLC. The 5-year survival rate of lung cancer is about 18%. The fundamental reason is that it is difficult to diagnose lung cancer in the early stage. More than 70% of patients are already in the advanced stage when diagnosed. The treatment effect of lung cancer depends to a large extent on whether it can be detected early. Scientists around the world are still committed to discovering biomarkers for early diagnosis of lung cancer. It is of great significance to conduct in-depth research on the occurrence and development mechanism of lung cancer.

[0003] In recent years, many studies have shown that epigenetics plays an important role in the occurrence and development of tumors, among which DNA methylation is the most common. The occurrence and development of lung adenocarcinoma is related to the abnormal activation or inhibition of related oncogenes or tumor suppressor genes due to changes in DNA methylation levels. DNA methylation may occur before somatic mutations and throughout the entire process of the tumor. Therefore, it has been widely studied in the diagnosis and recurrence monitoring of malignant tumors. Liquid biopsy technology based on DNA methylation makes non-invasive diagnosis of cancer possible. This method detects changes in the methylation levels of specific molecular markers in body fluid samples such as blood and urine to screen or diagnose cancer early. Among them, the selection of molecular markers is very important, which will greatly affect the sensitivity and specificity of this diagnostic method. Summary of the invention

[0004] In view of the above technical problems, the technical solutions provided by the present invention are as follows:

[0005] In a first aspect, the present invention provides a reagent for detecting the methylation level of a molecular marker for use in preparing a product for diagnosing lung adenocarcinoma, wherein the molecular marker is at least one of the full length or methylation region of Chr11:62525877-62526116bp positive-strand DNA or Chr11:62525877-62526116bp negative-strand DNA, and the reference genome is GRCh38.p14.

[0006] In a second aspect of the present invention, a primer pair for detecting the methylation level of the molecular marker is provided, comprising a methylation upstream and downstream primer pair and a non-methylation upstream and downstream primer pair;

[0007] The methylation upstream primer for detecting the methylation level of the positive strand DNA of Chr11:62525877-62526116bp is 5'-TAAGTAGATTGTCGATC-3', and the downstream primer is 5'-CAAAATTCCGCTCAAAAACG-3';

[0008] The non-methylated upstream primer for detecting the methylation level of the positive strand DNA of Chr11:62525877-62526116bp is 5'-TAAGTAGATTGTTGATT-3', and the downstream primer is 5'-CAAAATTCCACTCAAAAAC-3';

[0009] The methylation upstream primer for detecting the methylation level of the negative strand DNA of Chr11:62525877-62526116bp is 5'-TTGATTTTTGTAGGATTTC-3', and the downstream primer is 5'-CAAACTACCGACCGAAATACG-3';

[0010] The non-methylated upstream primer for detecting the methylation level of the negative-strand DNA of Chr11:62525877-62526116bp is 5'-TTGATTTTTGTAGGATTTT-3', and the downstream primer is 5'-CAAACAAACTACCAACCAAAATACA-3'.

[0011] The third aspect of the present invention provides a primer pair and probe combination for detecting the methylation level of the methylated molecular marker, which comprises an upstream primer, a downstream primer and a TaqMan detection probe;

[0012] The primer pair and probe combination for detecting the methylated Chr11:62525877-62526116bp positive strand DNA is:

[0013] Upstream primer: 5'-TTTTTTGGGTAGAGATTTGGAGTAA-3',

[0014] Downstream primer: 5'-TCTCCCACCTACTAACCTTTACAAA-3',

[0015] TaqMan detection probe: 5′-TGCGAGTATTATCGTGAA-3′;

[0016] The primer pair and probe combination for detecting the methylated Chr11:62525877-62526116bp negative strand DNA are:

[0017] Upstream primer: 5'-ATTGATTTTTGTAGGATTTCGTTT-3',

[0018] Downstream primer: 5'-ACCAAACAAACTACCAACCAAAATACA-3',

[0019] TaqMan detection probe: 5'-CGAATGTTTTGTTAGGA-3'.

[0020] Preferably, the 5' end of the TaqMan detection probe is connected to a fluorescent group, and the 3' end is connected to a fluorescent quenching group; the fluorescent group is selected from one of FAM, ROX, VIC or CY5, and the fluorescent quenching group is selected from one of TAMRA, BHQ or MGB.

[0021] Preferably, the 5'-end fluorescent group of the TaqMan detection probe for detecting the methylated Chr11:62525877-62526116bp positive-strand DNA is FAM, and the 3'-end fluorescent quenching group is MGB;

[0022] The 5'-end fluorescent group of the TaqMan detection probe for detecting the methylated Chr11:62525877-62526116bp negative-strand DNA is ROX, and the 3'-end fluorescent quenching group is MGB.

[0023] In a fourth aspect, the present invention provides a kit comprising the primer pair or the primer pair and a probe combination.

[0024] A fifth aspect of the present invention provides a use of the primer pair or the primer pair and probe combination or the kit in determining a positive lung adenocarcinoma sample.

[0025] Preferably, the sample is from lung tissue or plasma.

[0026] Preferably, the determination of lung adenocarcinoma positive samples is performed according to the following steps:

[0027] Extract DNA from lung tissue samples, perform bisulfite conversion, and purify to obtain template DNA;

[0028] Using the template DNA and the primer pair to perform PCR amplification;

[0029] The amplification results were determined as follows: if at least 43 CpG sites in the positive-strand DNA of Chr11:62525877-62526116bp or the negative-strand DNA of Chr11:62525877-62526116bp were methylated, the sample was a positive sample for lung adenocarcinoma; if at least 43 CpG sites in the positive-strand DNA of Chr11:62525877-62526116bp or the negative-strand DNA of Chr11:62525877-62526116bp were unmethylated, the sample was a negative sample for lung adenocarcinoma.

[0030] Preferably, the determination of lung adenocarcinoma positive samples is performed according to the following steps:

[0031] Extract DNA from lung tissue samples, perform bisulfite conversion, and purify to obtain template DNA;

[0032] Using the template DNA, qMSP amplification is performed using a primer pair and a probe combination for detecting methylated Chr11: 62525877-62526116 bp positive-strand DNA or a primer pair and a probe combination for detecting methylated Chr11: 62525877-62526116 bp negative-strand DNA;

[0033] The amplification results were determined: if the Ct value of the Chr11:62525877-62526116bp positive-strand DNA or Chr11:62525877-62526116bp negative-strand DNA amplification was ≤38, the sample was considered to be methylation-positive in this amplification region, and the sample was a lung adenocarcinoma-positive sample; if the Ct value of the Chr11:62525877-62526116bp positive-strand DNA or Chr11:62525877-62526116bp negative-strand DNA amplification was >38, the sample was considered to be methylation-negative in this amplification region, and the sample was a lung adenocarcinoma-negative sample.

[0034] The present invention has excellent detection effects on lung adenocarcinoma tissue samples and plasma samples by detecting the methylation level of Chr11:62525877-62526116bp positive-strand DNA or negative-strand in the sample, and provides a biomarker that can be used to detect lung adenocarcinoma, which is beneficial to the early detection of lung adenocarcinoma. In particular, the combination of Chr11:62525877-62526116bp positive-strand DNA and negative-strand has good detection sensitivity and specificity for lung adenocarcinoma, with a sensitivity of 88.9% and a specificity of 92.5%, which can effectively distinguish lung adenocarcinoma patients from healthy people. DETAILED DESCRIPTION

[0035] The following examples are intended to further illustrate the present invention, but are not intended to limit the present invention.

[0036] Example 1

[0037] Bisulfite sequencing was used to analyze the methylation levels of the positive (region 1) and negative (region 2) strands of Chr11:62525877-62526116bp in tissue samples. The reference genome was GRCh38.p14.

[0038] 1. Design of detection primer pairs

[0039] In order to effectively distinguish methylated DNA from unmethylated DNA, bisulfite can be used to treat DNA. Under the action of bisulfite, unmethylated cytosine is deaminated and converted to uracil, while methylated cytosine remains unchanged. In the subsequent PCR amplification, uracil bases are eventually replaced by thymine bases. Methylated primer pairs and non-methylated primer pairs are designed for the DNA sequence of the target region, respectively. Methylated primer pairs only amplify methylated DNA templates, while non-methylated primer pairs only amplify non-methylated DNA templates. Subsequently, Sanger sequencing can be used to obtain the methylation status of cytosine in each CpG dinucleotide site in the amplification product corresponding to the methylated primer pair and the non-methylated primer pair.

[0040] Based on the above principle, this example uses bisulfite sequencing to analyze the methylation levels of the positive and negative strand DNA sequences of Chr11: 62525877-62526116 bp in lung adenocarcinoma tissue samples and lung adenocarcinoma adjacent normal tissue samples, respectively.

[0041] Chr11:62525877-62526116bp positive strand DNA sequence is as follows:

[0042] TGGCCTGGGTAGCAGAGGACCTGGCTATCCCTTGGGTAGAGACTTGGAGCAAGCAGACTGCCGACCGGAGTGCGAGCATCATCGTGAACTTTTCCCTAGGTTGTGACCGAGATTCCCGACGAGAGAGACTGAGGGGAAGAGAGGAAGGAGGGGCGGGCTCCTGGCAAGGCATTCGCTCCTGAGCGGAATCCTGCAAAG GTCAGTAGGTGGGAGAGGCAGAGAGAGGCGGAGGTGACGGGA(SEQ ID NO.1)

[0043] The DNA sequence of Chr11:62525877-62526116bp after the positive strand is completely converted by bisulfite is as follows:

[0044] TGGTTTGGGTAGTAGAGGATTTGGTTATTTTTTGGGTAGAGATTTGGAGTAAGTAGATTGTCGATCGGAGTGCGAGTATTATCGTGAATTTTTTTTTAGGTTGTGATCGAGATTTTCGACGAGAGAGATTGAGGGGAAGAGAGGAAGGAGGGGCGGGTTTTTGGTAAGGTATTCGTTTTTGAGCGGAATTTTGTAAAGGTTAGTAGGTGGGAGAGGTAGAGAGAGGCGGAGGTGACGGGA(SEQ ID NO.2)

[0045] The DNA sequence of the positive strand at Chr11:62525877 - 62526116bp after complete non - conversion is shown as follows:

[0046] TGGTTTGGGTAGTAGAGGATTTGGTTATTTTTTGGGTAGAGATTTGGAGTAAGTAGATTGTTGATTGGAGTGTGAGTATTATTGTGAATTTTTTTTTAGGTTGTGATTGAGATTTTTGATGAGAGAGATTGAGGGGAAGAGAGGAAGGAGGGGTGGGTTTTTGGTAAGGTATTTGTTTTTGAGTGGAATTTTGTAAAGGTTAGTAGGTGGGAGAGGTAGAGAGAGGTGGAGGTGATGGGA(SEQ ID NO.3)

[0047] The DNA sequence of the negative strand at Chr11:62525877 - 62526116bp is shown as follows:

[0048] TCCCGTCACCTCCGCCTCTCTCTGCCTCTCCCACCTACTGACCTTTGCAGGATTCCGCTCAGGAGCGAATGCCTTGCCAGGAGCCCGCCCCTCCTTCCTCTCTTCCCCTCAGTCTCTCTCGTCGGGAATCTCGGTCACAACCTAGGGAAAAGTTCACGATGATGCTCGCACTCCGGTCGGCAGTCTGCTTGCTCCAAGTCTCTACCCAAGGGATAGCCAGGTCCTCTGCTACCCAGGCCA(SEQ ID NO.4)

[0049] The DNA sequence of Chr11:62525877-62526116bp minus strand after complete bisulfite conversion is as follows:

[0050] TTTCGTTATTTTCGTTTTTTTGTTTTTTATTTATTGATTTTTGTAGGATTTCGTTTAGGAGCGAATGTTTTGTTAGGAGTTCGTTTTTTTTTTTTTTTTTTTGTTTTTCGTCGGGAATTTCGGTTATAATTTAGGGAAAAGTTTACGATGATGTTCGTATTTCGGTCGGTAGTTTGTTTGTTTTAAGTTTTATTTAAGGGATAGTTAGGTTTTTTTGTTATT (SEQ ID NO.5)

[0051] The DNA sequence of Chr11:62525877-62526116bp negative strand after complete unconversion is as follows:

[0052] TTTTGTTATTTTTGTTTTTTTTTGTTTTTTATTTATTGATTTTTGTAGGATTTTGTTTAGGAGTGAATGTTTTGTTAGGAGTTTGTTTTTTTTTTTTTTTTTTTTGTTTTTTTTGTTGGGAATTTTGGTTATAATTTAGGGAAAAGTTTATGATGATGTTTGTATTTTGGTTGGTAGTTTGTTTGTTTTAAGTTTTATTTAAGGGATAGTTAGGTTTTTTGTTATTT (SEQ ID NO.6)

[0053] The DNA sequences shown in SEQ ID NO.2-3 and SEQ ID NO.5-6 were artificially synthesized and constructed into pUC19 plasmid vectors respectively. The DNA sequences shown in SEQ ID NO.2-3 and SEQ ID NO.5-6 were used as templates to design methylated primer pairs and non-methylated primer pairs specific to the positive chain (region 1) of Chr11: 62525877-62526116bp and the negative chain (region 2) of Chr11: 62525877-62526116bp, respectively. After screening and testing, the nucleotide sequences of the primer pairs that met the conditions are shown in Table 1 below.

[0054] Table 1Chr11:62525877-62526116bp Nucleotide sequences of primer pairs for positive and negative strands

[0055]

[0056]

[0057] 2. Collection of tissue samples

[0058] A total of 76 lung tissue samples diagnosed with lung adenocarcinoma and 72 adjacent normal tissue samples were collected. All samples were formalin-immersed and paraffin-embedded. The collection process of all samples was approved by the Ethics Committee, all volunteers signed informed consent forms, and all samples were anonymized.

[0059] 3. Extraction, transformation and purification of DNA from tissue samples

[0060] For the collected lung tissue samples, QIAamp DNA FFPE Tissue Kit (Cat: 56404) was used to extract tissue DNA. For specific operations, please refer to the kit instructions. The kit used for conversion and purification of tissue sample DNA is the nucleic acid conversion reagent (Ehan Equipment No. 20200843) of Wuhan Aimeisen Life Science Technology Co., Ltd., and the specific operation steps are referred to the kit instructions.

[0061] 4. PCR amplification and bisulfite sequencing

[0062] The methylated primer pairs and non-methylated primer pairs shown in Table 1 were artificially synthesized separately for standby use. Using the tissue DNA extracted in step 3 above and converted with bisulfite as a template, the PCR reaction system was configured according to the formula in Table 2, and then PCR amplification was performed according to the procedure provided in Table 3. For each sample to be tested, when amplifying the target region, 2 tubes of reaction system must be prepared, that is, methylated primer pairs and non-methylated primer pairs are used for amplification respectively. After the PCR amplification is completed, the amplified product is sent to the company for Sangol sequencing. The sequencing primers are the same as those in Table 2, and sequencing is performed from the 5' end and the 3' end at the same time.

[0063] Table 2 PCR reaction system

[0064]

[0065] Table 3 PCR reaction program

[0066]

[0067] 5. Results Analysis

[0068] For DNA sequences converted by bisulfite, if the sequencing result of a CpG dinucleotide site on the initial DNA sequence (before conversion) is still CG, the site is considered to be completely methylated; if the sequencing result of a CpG dinucleotide site on the initial DNA sequence is a double peak, that is, there are both CG and TG, the site is partially methylated; only when the sequencing result of a CpG dinucleotide site on the initial DNA sequence is TG, the site is considered to be unmethylated. There are 10 CpG sites in both region 1 and region 2. If 8 or more CpG sites in region 1 or region 2 of the sample to be tested are methylated (including complete methylation and partial methylation), the sample is considered to be methylation-positive in region 1 or region 2; if 8 or more CpG sites in region 1 or region 2 of the sample to be tested are all unmethylated, the sample is considered to be methylation-negative in region 1 or region 2.

[0069] According to the above standards, methylation analysis was performed on the Sanghor sequencing results of the 148 tissue samples collected in this example, and the proportions of methylation-positive and methylation-negative in lung adenocarcinoma tissue samples and adjacent normal tissue samples were counted, and the results are shown in Table 4. For 76 cancer tissue samples, 63 samples were sequenced successfully, and for 72 adjacent normal tissue samples, 68 samples were sequenced successfully.

[0070] Table 4 Methylation levels of region 1 and region 2 in lung adenocarcinoma tissue samples and adjacent normal tissue samples

[0071]

[0072] As can be seen from Table 4, regions 1 and 2 are methylation-positive in all successfully sequenced lung adenocarcinoma tissue samples, while in adjacent normal tissue samples, 85.3% (58 / 68) of the samples have region 1 methylation-negative, and 88.2% (60 / 68) of the samples have region 2 methylation-negative. The above results show that the methylation levels of regions 1 and 2 in lung adenocarcinoma tissue samples are significantly higher than those in adjacent normal tissue samples, that is, regions 1 and 2 are highly methylated in lung adenocarcinoma tissue samples, while they are low methylated or unmethylated in adjacent normal tissue samples. The significant difference in methylation levels of regions 1 and 2 in lung adenocarcinoma and adjacent normal tissue samples can be used to distinguish cancer and non-cancerous samples.

[0073] Example 2

[0074] Performance of qMSP method for diagnosing tissue samples by analyzing methylation levels in subregions of region 1 or region 2

[0075] 1. Tissue sample collection is the same as in Example 1.

[0076] 2. The extraction, bisulfite conversion and purification of DNA from tissue samples were the same as in Example 1.

[0077] 3. Methylation-specific fluorescence quantitative PCR

[0078] Compared with bisulfite sequencing, methylation-specific fluorescence quantitative PCR reaction can detect the methylation level of the target region more conveniently and quickly, and is more cost-effective. Therefore, this example uses the methylation-specific fluorescence quantitative PCR method to detect the methylation level of each target region, and analyzes the performance of this method in diagnosing lung adenocarcinoma tissue samples.

[0079] The DNA sequences of region 1 and region 2 converted by bisulfite are used as templates to design primer pairs and TaqMan detection probes for methylation-specific fluorescence quantitative PCR (qMSP) amplification. The primer pairs are required to have good amplification specificity, that is, the primer pairs only amplify methylated DNA templates, but not unmethylated DNA templates, and will not cause other non-specific amplifications; in addition, the primer pairs are required to have good amplification efficiency, that is, the amplification efficiency of each target region is between 90% and 110%. The nucleotide sequences of the primer pairs and detection probes that meet the above requirements are shown in Table 5.

[0080] Table 5 Nucleotide sequences of methylation detection primer pairs and TaqMan detection probes

[0081]

[0082]

[0083] The probes used in Table 5 are all TaqMan probes, the 5' end of the probe is a fluorescent group, such as FAM, ROX, VIC, CY5, etc., and the 3' end is a fluorescent quenching group, such as TAMRA, BHQ, MGB, etc. The qPCR reaction based on TaqMan probes can realize the simultaneous detection of multiple target genes in one reaction system. At this time, it is only necessary for the fluorescent groups carried by the 5' end of each target gene-specific detection probe to be different. In this embodiment, each qPCR reaction system needs to detect two target genes, namely the target region of the molecular marker and the internal reference gene ACTB. The TaqMan probe specific to region 1 has a 5' end fluorescent group of FAM and a 3' end fluorescent quenching group of MGB; the TaqMan probe specific to region 2 has a 5' end fluorescent group of ROX and a 3' end fluorescent quenching group of MGB; the detection primer pair and detection probe of the ACTB gene are shown in Table 5, and the corresponding detection probe has a 5' end fluorescent group of VIC and a 3' end fluorescent quenching group of BHQ. The above primers and probes are artificially synthesized for standby use.

[0084] The bisulfite-converted and purified tissue sample DNA was used as a template, and the primer pairs and detection probes provided in Table 5 were used to perform qMSP reactions. The qMSP amplification system is shown in Table 6, and the amplification program is shown in Table 7. When performing qPCR reactions on each sample, the amount of the internal reference gene ACTB needs to be detected to monitor the sample quality and result interpretation. In each PCR reaction plate, in addition to setting up experimental wells for detecting the samples to be tested, positive control wells and negative control wells also need to be set up at the same time. The template of the positive control well is 10 3 copies / μL of plasmid containing the transformed ACTB sequence and 10 3 The template of the negative control well is TE buffer, and the other components are the same as those of the experimental tube.

[0085] Table 6qMSP reaction system

[0086]

[0087]

[0088] Table 7qMSP reaction procedure

[0089]

[0090] After the qPCR reaction is completed, adjust the baseline (generally, set the signal value corresponding to the 3rd to 15th cycle as the baseline level) and set the threshold. The threshold must be within the exponential amplification period. The straight line that crosses the threshold and is parallel to the X-axis is called the threshold line. The number of cycles corresponding to the intersection of the threshold line and the amplification curve is the Ct value. To analyze the results of the qPCR reaction, it is required that ① the negative control tube has no amplification (i.e., no line); ② the positive control PCR tube has an obvious exponential growth period, and the Ct value of the target gene in the positive control PCR tube is between 26 and 30; ③ the Ct value of the internal reference gene ACTB of the sample to be tested is less than or equal to 33. If the positive control, negative control and internal reference gene meet the above requirements, the test results of the sample to be tested can be analyzed and the results can be interpreted. Otherwise, the experiment is invalid and must be retested.

[0091] 4. Interpretation of results

[0092] For tissue samples, the positive judgment value is 38. If the Ct value of amplification using a pair of methylation detection primers and probes is ≤38, the sample is considered to be methylation-positive in this amplification region, and the sample is a positive sample of lung adenocarcinoma; if the Ct value of amplification using a pair of methylation detection primers and probes is >38, the sample is considered to be methylation-negative in this amplification region, and the sample is a negative sample of lung adenocarcinoma. According to the above standards, the methylation level of the region 1 or region 2 is detected by the qMSP method, and the performance of diagnosing lung adenocarcinoma tissue samples and adjacent tissue samples is shown in Table 8.

[0093] Table 8 Performance of qMSP method in detecting methylation levels in region 1 or region 2 in diagnosing lung adenocarcinoma tissue samples

[0094]

[0095] As can be seen from Table 8, by detecting the methylation level of the biomarker by the qMSP method, lung adenocarcinoma tissue and adjacent normal tissue samples can also be effectively distinguished. Overall, when region 1 is used as the target region for detection, its sensitivity for detecting lung adenocarcinoma tissue samples is 98.68%, and its overall specificity for detecting healthy human plasma samples is 91.8%. Therefore, the diagnostic performance of region 2 is better than that of region 1.

[0096] Example 3

[0097] Performance of Region 1 and / or Region 2 in lung adenocarcinoma plasma samples

[0098] 1. Collection of blood samples

[0099] A total of 87 anticoagulated blood samples were collected from patients diagnosed with lung adenocarcinoma by tissue biopsy, with about 10 mL collected from each person. At the same time, 98 anticoagulated blood samples were collected from healthy people. The collection process of all blood samples was approved by the Ethics Committee, all volunteers signed informed consent forms, and all samples were anonymized.

[0100] 2. Extraction of plasma free DNA

[0101] After the collected anticoagulated blood samples were centrifuged, the plasma layer was collected for the extraction of plasma free DNA. The plasma cfDNA was extracted using the magnetic bead serum / plasma free DNA (cfDNA) extraction kit (DP709) of Tiangen Biochemical Technology (Beijing) Co., Ltd., and the specific operation was carried out according to the instructions of the kit.

[0102] 3. Conversion and purification of plasma sample DNA

[0103] Same as Example 2.

[0104] 4. qMSP reaction and quality control

[0105] Same as Example 2.

[0106] 5. qMSP result analysis

[0107] The nucleic acid combinations 1 to 2 in Table 5 were selected to perform methylation-specific fluorescence quantitative PCR experiments, and ROC analysis was performed based on the obtained Ct values ​​to statistically analyze the performance of diagnosing lung adenocarcinoma plasma samples using the methylation levels of amplified regions 1 or 2 in the nucleic acid combinations 1 to 2 in Table 5. The results were interpreted in the same way as in Example 2, and the results are shown in Table 9.

[0108] Table 9 Performance of region 1 or region 2 in diagnosing 185 cases of lung adenocarcinoma and healthy human plasma samples

[0109]

[0110] As can be seen from Table 9, compared with tissue samples, the sensitivity of diagnosing lung adenocarcinoma plasma samples by detecting the methylation level of region 1 or region 2 is reduced, which is speculated to be related to the extremely low content of cfDNA in plasma samples. However, nucleic acid combination 2 still shows good diagnostic ability for lung adenocarcinoma plasma samples, and its AUC value range for diagnosing lung adenocarcinoma plasma samples is 0.762-0.85.

[0111] In order to further improve the performance of region 1 and region 2 in diagnosing lung adenocarcinoma plasma samples, this example analyzes the performance of using region 1 and region 2 as molecular markers to diagnose lung adenocarcinoma. From Table 9, it can be seen that region 1 combined with region 2 has excellent performance in diagnosing lung adenocarcinoma plasma samples, and the AUC values ​​for diagnosing lung adenocarcinoma plasma samples are all greater than 0.86. The sensitivity and specificity of detecting plasma samples are 88.9% and 92.5% respectively, and the AUC value is 0.878.

[0112] Example 4

[0113] Performance Validation of Zone 1 and / or Zone 2 Detection in Lung Adenocarcinoma Plasma Samples

[0114] 1. Independent validation set sample collection

[0115] In this example, samples were collected to verify the performance of different nucleic acid combinations in diagnosing lung adenocarcinoma plasma samples under the positive judgment value determined in Example 3.

[0116] A total of 62 anticoagulated blood samples were collected from patients diagnosed with lung adenocarcinoma by tissue biopsy, and 62 anticoagulated blood samples were collected from healthy people. Each plasma sample was about 10 mL. The collection process of all blood samples was approved by the ethics committee, all volunteers signed informed consent, and all samples were anonymized.

[0117] 2. The extraction, transformation and purification of free DNA in plasma samples, qMSP reaction and quality control are the same as in Example 2.

[0118] 3. qMSP result analysis

[0119] Using the positive judgment value shown in Example 2 as the judgment standard, if the Ct value of a certain sample to be tested is less than or equal to the positive judgment value, the sample is considered to be a positive sample for lung adenocarcinoma, and if the Ct value of a certain sample to be tested is greater than the positive judgment value, the sample is considered to be a negative sample for lung adenocarcinoma. Based on the above judgment standard, the Ct value of each nucleic acid combination detection target area is analyzed, and its detection performance is statistically analyzed, and the results are shown in Table 10.

[0120] Table 10 Performance of region 1 or region 2 in diagnosing 124 cases of lung adenocarcinoma and healthy human plasma samples

[0121]

[0122] As can be seen from Table 10, in the independent validation set containing 124 samples, region 1+region 2 has excellent performance in diagnosing lung adenocarcinoma plasma samples, with a sensitivity of 85.81% and a specificity of 95.71% for healthy human plasma samples.

[0123] The present invention has been described above with the preferred embodiments of the present invention as the center. A person skilled in the art of the present invention can understand that the present invention can be embodied in a deformed form within the scope of the essential characteristics of the present invention. Therefore, the disclosed embodiments are not used to limit the present invention, but to illustrate the present invention. The scope of the present invention is reflected by the scope of the invention claims, rather than by detailed description, and all differences within the equivalent scope belong to the scope of the present invention.

Claims

1. Use of a reagent for detecting the methylation level of a molecular marker in the preparation of a product for diagnosing lung adenocarcinoma, characterized in that: The molecular marker is at least one of the full length or methylation region of Chr11:62525877-62526116bp positive-strand DNA or Chr11:62525877-62526116bp negative-strand DNA, and the reference genome is GRCh38.p14.

2. A primer pair for detecting the methylation level of the molecular marker according to claim 1, characterized in that: Including methylated upstream and downstream primer pairs and unmethylated upstream and downstream primer pairs; The methylation upstream primer for detecting the methylation level of the positive strand DNA of Chr11:62525877-62526116bp is 5'-TAAGTAGATTGTCGATC-3', and the downstream primer is 5'-CAAAATTCCGCTCAAAAACG-3'; The non-methylated upstream primer for detecting the methylation level of the positive strand DNA of Chr11:62525877-62526116bp is 5'-TAAGTAGATTGTTGATT-3', and the downstream primer is 5'-CAAAATTCCACTCAAAAAC-3'; The methylation upstream primer for detecting the methylation level of the negative strand DNA of Chr11:62525877-62526116bp is 5'-TTGATTTTTGTAGGATTTC-3', and the downstream primer is 5'-CAAACTACCGACCGAAATACG-3'; The non-methylated upstream primer for detecting the methylation level of the negative-strand DNA of Chr11:62525877-62526116bp is 5'-TTGATTTTTGTAGGATTTT-3', and the downstream primer is 5'-CAAACAAACTACCAACCAAAATACA-3'.

3. A primer pair and probe combination for detecting the methylation level of the molecular marker of claim 1, characterized in that: It includes an upstream primer, a downstream primer and a TaqMan detection probe; The primer pair and probe combination for detecting the methylated Chr11:62525877-62526116bp positive strand DNA is: Upstream primer: 5'-TTTTTTGGGTAGAGATTTGGAGTAA-3', Downstream primer: 5'-TCTCCCACCTACTAACCTTTACAAA-3', TaqMan detection probe: 5′-TGCGAGTATTATCGTGAA-3′; The primer pair and probe combination for detecting the methylated Chr11:62525877-62526116bp negative strand DNA are: Upstream primer: 5'-ATTGATTTTTGTAGGATTTCGTTT-3', Downstream primer: 5'-ACCAAACAAACTACCAACCAAAATACA-3', TaqMan detection probe: 5'-CGAATGTTTTGTTAGGA-3'.

4. The primer pair and probe combination according to claim 3, characterized in that: The 5' end of the TaqMan detection probe is connected to a fluorescent group, and the 3' end is connected to a fluorescent quenching group; the fluorescent group is selected from one of FAM, ROX, VIC or CY5, and the fluorescent quenching group is selected from one of TAMRA, BHQ or MGB.

5. The primer pair and probe combination according to claim 4, characterized in that: The 5'-end fluorescent group of the TaqMan detection probe for detecting the methylated Chr11:62525877-62526116bp positive-strand DNA is FAM, and the 3'-end fluorescent quenching group is MGB; The 5'-end fluorescent group of the TaqMan detection probe for detecting the methylated Chr11:62525877-62526116bp negative-strand DNA is ROX, and the 3'-end fluorescent quenching group is MGB.

6. A kit, characterized in that: It comprises the primer pair according to claim 2 or the primer pair according to claim 3 and a probe combination.

7. Use of the primer pair according to claim 2, or the primer pair and probe combination according to claim 4, or the kit according to claim 6 in determining a positive sample for lung adenocarcinoma.

8. The use according to claim 7, characterized in that The samples were from lung tissue or plasma.

9. The use according to claim 8, characterized in that The determination of lung adenocarcinoma positive samples is performed according to the following steps: Extract DNA from lung tissue samples, perform bisulfite conversion, and purify to obtain template DNA; Using the template DNA and the primer pair to perform PCR amplification; The amplification results were determined as follows: if at least 8 CpG sites in the positive-strand DNA of Chr11:62525877-62526116bp or negative-strand DNA of the sample to be tested were methylated, the sample was a positive sample for lung adenocarcinoma; if at least 8 CpG sites in the positive-strand DNA of Chr11:62525877-62526116bp or negative-strand DNA of the sample to be tested were unmethylated, the sample was a negative sample for lung adenocarcinoma.

Images