Library construction method for single gene hereditary disease related gene detection, nucleic acid product and kit

Abstract

The invention provides a library construction method for single gene hereditary disease related gene detection, a nucleic acid product and a kit. Comprising at least one of a long-chain PCR primer for amplifying an ATP7B gene, a long-chain PCR primer for amplifying a G6PD gene, a long-chain PCR primer for amplifying an HBB gene, a long-chain PCR primer for amplifying a PAH gene, a long-chain PCR primer for amplifying an MMACHC gene, a long-chain PCR primer for amplifying an SLC26A4 gene and a long-chain PCR primer for amplifying a GJB2 gene. The nucleic acid product for detecting the related gene mutation of the single gene hereditary disease can be more specifically, sensitively and accurately combined with target nucleic acid sequences of ATP7B, G6PD, HBB, PAH, MMACHC, SLC26A4 and GJB2 genes, and the problem of high GC / AT region enrichment is better solved.

Description

Technical Field

[0001] The present application relates to the field of molecular biology technology, and in particular to a library construction method, nucleic acid product and kit for detecting genes related to single gene genetic diseases. Background Art

[0002] Single gene diseases are diseases caused by mutations in a certain gene. These gene mutations can be passed on to offspring, causing the same disease or symptoms. Single gene diseases can be subdivided into autosomal dominant inheritance, such as achondroplasia; autosomal recessive inheritance, such as deafness; X-linked dominant genetic diseases, such as X-linked intellectual disability; X-linked recessive genetic diseases, such as Duchenne muscular dystrophy; and Y-linked genetic diseases, such as azoospermia. Currently, there are more than 9,000 known single gene diseases, with a combined incidence rate of more than 1 / 100. Most single gene diseases cause malformations, disability, and death. Only 5% have effective drugs, and the cost is expensive.

[0003] Currently, the technologies that can be used to detect single-gene genetic diseases include Sanger sequencing, capillary electrophoresis, and high-throughput sequencing. Among them, Sanger sequencing has limited throughput and is suitable for detecting mutations in known genes. It is often used as a means of detecting single-gene genetic diseases with clear pathogenic genes or pathogenic sites or as a verification technology for high-throughput sequencing; capillary electrophoresis is mainly used for single-gene genetic diseases that have been clearly caused by abnormal numbers of short tandem repeat sequences; and high-throughput sequencing mainly adopts the following methods for detecting target regions or genes: hybridization capture (liquid phase and solid phase) and multiplex PCR. Hybridization capture can capture larger target regions. Probe-based hybridization capture technology is easier to optimize probes to obtain better uniformity and has better compatibility with multiple types of mutations. Therefore, probe-based hybridization capture technology is suitable for larger gene panels. Liquid hybridization capture sequencing can be used for the detection of genomic target regions ranging from a few kb to hundreds of Mb, and can detect SNV, InDel, CNV and other mutations. However, liquid phase capture has problems such as cumbersome experimental operation, long detection cycle, low coverage of GC / AT high content areas, and relatively high cost for detection of single diseases or several genes; and WES detection based on liquid phase hybridization capture mainly focuses on coding regions and splicing regions. Multiplex PCR uses short amplicon primers, and hundreds or thousands of pairs of amplification primers are required for full coverage detection of multiple genes. As more genes or sites are detected, panel primer design becomes more difficult and the synthesis cost is higher. At the same time, it has problems such as cross-amplification, primer dimers, competitive amplification, and amplification heterogeneity, and is also affected by GC / AT content.

[0004] Therefore, there is an urgent need for technologies and products that can efficiently and accurately detect gene mutations associated with single-gene genetic diseases. Summary of the invention

[0005] Based on this, the present application provides a library construction method, nucleic acid product and kit for detecting genes related to single-gene genetic diseases, which can be used to simultaneously detect multiple single-gene genetic diseases with high sensitivity, high throughput and low cost.

[0006] According to the first aspect of the present application, a nucleic acid product for detecting gene mutations associated with monogenic genetic diseases is provided, including at least one of a long-chain PCR primer for amplifying the ATP7B gene, a long-chain PCR primer for amplifying the G6PD gene, a long-chain PCR primer for amplifying the HBB gene, a long-chain PCR primer for amplifying the PAH gene, a long-chain PCR primer for amplifying the MMACHC gene, a long-chain PCR primer for amplifying the SLC26A4 gene, and a long-chain PCR primer for amplifying the GJB2 gene.

[0007] In one embodiment, the nucleotide sequence of the long-chain PCR primers for amplifying the ATP7B gene is shown in SEQ ID NOs: 1 to 10, the nucleotide sequence of the long-chain PCR primers for amplifying the G6PD gene is shown in SEQ ID NOs: 11 to 14, the nucleotide sequence of the long-chain PCR primers for amplifying the HBB gene is shown in SEQ ID NOs: 15 to 16, the nucleotide sequence of the long-chain PCR primers for amplifying the PAH gene is shown in SEQ ID NOs: 17 to 28, the nucleotide sequence of the long-chain PCR primers for amplifying the MMACHC gene is shown in SEQ ID NOs: 29 to 32, the nucleotide sequence of the long-chain PCR primers for amplifying the SLC26A4 gene is shown in SEQ ID NOs: 33 to 42, and the nucleotide sequence of the long-chain PCR primers for amplifying the GJB2 gene is shown in SEQ ID NOs: 43 to 44.

[0008] The second aspect of the present application provides the use of the above-mentioned nucleic acid product in the preparation of a detection kit for a single gene genetic disease.

[0009] The third aspect of the present application provides a kit for detecting a single gene genetic disease, the kit comprising the above-mentioned nucleic acid product.

[0010] In one embodiment, the kit further comprises PCR reaction reagents.

[0011] In one embodiment, the PCR reaction reagents include one or more of PCR buffer, DNA polymerase, magnesium ions and dNTPs.

[0012] In one embodiment, the kit further comprises a DNA extraction reagent.

[0013] The fourth aspect of the present application provides a method for constructing a library for detecting genes related to single gene genetic diseases, comprising the following steps:

[0014] Extracting genomic DNA from the biological sample to be tested;

[0015] Using the genomic DNA as a template, the nucleic acid product is used to perform PCR amplification to obtain a first amplification product;

[0016] Performing a second PCR amplification using the first amplification product as a template to obtain a second amplification product; and

[0017] Constructing the library for detecting genes related to single gene genetic diseases according to the second amplification product;

[0018] The primers used for the second PCR amplification include at least one of a universal primer and a specific primer.

[0019] In one embodiment, after the second amplification product is obtained, the second amplification product is purified, the purified product is taken for quality inspection, and the product that passes the quality inspection is used to construct a gene library of the gene related to the single gene genetic disease.

[0020] In one embodiment, the conditions of the first PCR amplification include: 94°C to 96°C for 1 min to 3 min, 96°C to 98°C for 10 s to 30 s, 65°C to 70°C for 1 min to 8 min, and 30 to 40 cycles.

[0021] The present application simultaneously captures and builds libraries for seven pathogenic genes of monogenic genetic diseases: ATP7B, G6PD, HBB, PAH, MMACHC, SLC26A4 and GJB2 genes. The nucleic acid product used in the present application to detect gene mutations related to monogenic genetic diseases can be more specifically, sensitively and accurately combined with the target nucleic acid sequences of ATP7B gene, G6PD gene, HBB gene, PAH gene, MMACHC gene, SLC26A4 gene and GJB2 gene, and can detect CDS region and splicing region related variations, as well as deep intron region and UTR region related variations, and can also detect the deletion of exons contained in the amplicon, while also greatly reducing the problems of cross-amplification, pairing, competitive amplification and amplification heterogeneity between primers, and better solving the problem of enrichment in high GC / AT regions.

[0022] The method of adding linkers to both ends of the DNA fragment to be tested by PCR reaction was used, and two rounds of PCR reaction were used to successfully construct a library for the detection of genes related to single-gene genetic diseases. It has the advantages of short library construction cycle, high matching rate, good uniformity, good repeatability, and simple operation. It can provide guidance for clinicians to comprehensively evaluate the disease risk of the subjects, customize personalized medical and life intervention measures, so as to significantly reduce the risk of single-gene genetic diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the quality inspection result of agarose gel electrophoresis of 5 ng / μL sample in Example 1;

[0024] Figure 2 This is the quality inspection result of agarose gel electrophoresis of 5 ng / μL sample in Example 1;

[0025] Figure 3 This is the quality inspection result of agarose gel electrophoresis of 2 ng / μL sample in Example 1;

[0026] Figure 4 This is the IGV diagram of ATP7B gene detection in Example 1. DETAILED DESCRIPTION

[0027] In order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the specific implementation methods of the present application are described in detail. In the following description, many specific details are set forth to facilitate a full understanding of the present application. However, the present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present application, so the present application is not limited by the specific embodiments disclosed below.

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present application. The terms used herein in the specification of the present application are only for the purpose of describing specific embodiments and are not intended to limit the present application. Unless otherwise specifically stated, various raw materials, reagents, instruments and equipment used in the present application, etc. can be purchased from the market or can be prepared by existing methods.

[0029] As used herein, the terms "target nucleic acid sequence", "target nucleic acid" and "target sequence" refer to a target nucleic acid sequence to be detected. In the present application, the terms "target nucleic acid sequence", "target nucleic acid" and "target sequence" have the same meaning and are used interchangeably. As used herein, the terms "target sequence" and "target-specific sequence" refer to a sequence that can selectively / specifically hybridize or anneal with a target nucleic acid sequence under conditions that allow nucleic acid hybridization, annealing or amplification, and that includes a sequence that is complementary to the target nucleic acid sequence. In the present application, the terms "target sequence" and "target-specific sequence" have the same meaning and are used interchangeably. It is easy to understand that a targeting sequence or a target-specific sequence is specific for a target nucleic acid sequence. In other words, under conditions that allow nucleic acid hybridization, annealing or amplification, a targeting sequence or a target-specific sequence hybridizes or anneals only with a specific target nucleic acid sequence, and does not hybridize or anneal with other nucleic acid sequences.

[0030] In the present application, "plurality", "multiple", "multiple times", "multiples", etc., unless otherwise specified, refer to a number greater than 2 or equal to 2. For example, "one or more" means one or greater than or equal to two.

[0031] In the present application, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0032] In this application, “reads” refers to sequence fragments obtained by sequencing; “sequencing depth” refers to the number of times the PCR amplification product is sequenced.

[0033] As shown in the background technology, in the traditional technology, multiple PCR used in the detection of single-gene genetic diseases are all short amplicon primers. Hundreds or thousands of pairs of amplification primers are required for full coverage detection of multiple genes. As the number of genes or sites detected increases, the design of panel primers becomes more difficult and the synthesis cost is higher. At the same time, there are problems such as cross-amplification, primer dimers, competitive amplification, and amplification heterogeneity. At the same time, it is affected by the GC / AT content, such as the AT content of chr7:7358795-107359068 of the SLC26A4 gene, which is 66.4%, and the GC content of exon 1 of the GJB2 gene is 80.8%. At the same time, as the research found, the variation of UTR and intron regions is often eliminated in the initial screening of variation due to insufficient functional prediction, but the pathogenic variation of some diseases is located in these regions, such as: PAH gene, HBB gene, etc. Therefore, the pathogenic or possible pathogenic variation in the deep intron and UTR region of the gene is also one of the pathogenic causes of the disease.

[0034] Based on this, one embodiment of the present application provides a nucleic acid product for detecting gene mutations related to single gene genetic diseases, including at least one of a long-chain PCR primer for amplifying the ATP7B gene, a long-chain PCR primer for amplifying the G6PD gene, a long-chain PCR primer for amplifying the HBB gene, a long-chain PCR primer for amplifying the PAH gene, a long-chain PCR primer for amplifying the MMACHC gene, a long-chain PCR primer for amplifying the SLC26A4 gene, and a long-chain PCR primer for amplifying the GJB2 gene.

[0035] The nucleic acid product of the embodiment of the present application includes 7 of the above-mentioned long-chain PCR primers including the long-chain PCR primers for amplifying the ATP7B gene, the long-chain PCR primers for amplifying the G6PD gene, the long-chain PCR primers for amplifying the HBB gene, the long-chain PCR primers for amplifying the PAH gene, the long-chain PCR primers for amplifying the MMACHC gene, the long-chain PCR primers for amplifying the SLC26A4 gene and the long-chain PCR primers for amplifying the GJB2 gene.

[0036] The present application simultaneously captures and builds libraries for seven pathogenic genes of monogenic genetic diseases: ATP7B, G6PD, HBB, PAH, MMACHC, SLC26A4 and GJB2 genes. The nucleic acid product used in the present application to detect gene mutations related to monogenic genetic diseases can be more specifically, sensitively and accurately combined with the target nucleic acid sequences of ATP7B gene, G6PD gene, HBB gene, PAH gene, MMACHC gene, SLC26A4 gene and GJB2 gene, and can detect CDS region and splicing region related variations, as well as deep intron region and UTR region related variations, and can also detect the deletion of exons contained in the amplicon, while also greatly reducing the problems of cross-amplification, pairing, competitive amplification and amplification heterogeneity between primers, and better solving the problem of enrichment in high GC / AT regions.

[0037] In some of the embodiments, the nucleotide sequences of the long-chain PCR primers for amplifying the ATP7B gene are shown in SEQ ID NOs: 1 to 10, the nucleotide sequences of the long-chain PCR primers for amplifying the G6PD gene are shown in SEQ ID NOs: 11 to 14, the nucleotide sequences of the long-chain PCR primers for amplifying the HBB gene are shown in SEQ ID NOs: 15 to 16, the nucleotide sequences of the long-chain PCR primers for amplifying the PAH gene are shown in SEQ ID NOs: 17 to 28, the nucleotide sequences of the long-chain PCR primers for amplifying the MMACHC gene are shown in SEQ ID NOs: 29 to 32, the nucleotide sequences of the long-chain PCR primers for amplifying the SLC26A4 gene are shown in SEQ ID NOs: 33 to 42, and the nucleotide sequences of the long-chain PCR primers for amplifying the GJB2 gene are shown in SEQ ID NOs: 43 to 44.

[0038] Specifically, the nucleotide sequence shown in SEQ ID NO: 1 is: 5'-CATGTTCACTGGCTTTCCTTTTGGG-3'; the nucleotide sequence shown in SEQ ID NO: 2 is 5'-CCTGACCTGATGTGGGGGAGTATGT-3'; the nucleotide sequence shown in SEQ ID NO: 3 is: 5'-GGCGTGGTGCTCTCTGTGGTTTG-3'; the nucleotide sequence shown in SEQ ID NO: 4 is: 5'-AACCCTCCAGTTCCCTGTCCCTCA-3'; the nucleotide sequence shown in SEQ ID NO: 5 is: 5'-GGTGTGCTGTCAGGAGGCAAGTAGG-3'; the nucleotide sequence shown in SEQ ID NO: 6 is: 5'-GCCTGCCACCTACCCTGGGATAC-3'; the nucleotide sequence shown in SEQ ID NO: 7 is: TCTGTGGACAAACTGGGAAGGGAGT; the nucleotide sequence shown in SEQ ID NO: 8 is: CAGGTAGGTGTCCGAGGTGGCTAGTC; The nucleotide sequence shown in SEQ ID NO:9 is: 5'-ATAGACCTGCTGGCGGGGTATGG-3'; the nucleotide sequence shown in SEQ ID NO:10 is: 5'-TCCCCAAAGGACAATGACCAAACAC-3'; the nucleotide sequence shown in SEQ ID NO:11 is: 5'-CTTGAGAGATGAGACACCAATCCAGGG-3'; the nucleotide sequence shown in SEQ ID NO:12 is: 5'-GAAAGTCCCACTAGAGCATCGCAGC-3'; the nucleotide sequence shown in SEQ ID NO:13 is: 5'-CATTGTGACAGAAATCAGATCAGCGGT-3'; the nucleotide sequence shown in SEQ ID NO:14 is: 5'-CCCGCAGCAGAAAGGCAAGAGTA-3'; the nucleotide sequence shown in SEQ ID NO:15 is: 5'-CCTGGTGTGCCATTTGTTAAGCTTGT-3'; the nucleotide sequence shown in SEQ ID NO:16 is: 5'-CCTGGTGTGCCATTTGTTAAGCTTGT-3'; the nucleotide sequence shown in SEQ ID NO:17 is: 5'-CCTGGTGTGCCATTTGTTAAGCTTGT-3'; the nucleotide sequence shown in SEQ ID NO:18 is: 5'-CCTGGTGTGCCATTTGTTAAGCTTGT-3'; the nucleotide sequence shown in SEQ ID NO:19 is: 5'-CCTGGTGTGCCATTTGTTAAGCTTGT-3'; the nucleotide sequence shown in SEQ ID NO:20 is: 5'- The nucleotide sequence shown in SEQ ID NO: 16 is: 5'-CCCATCAAGTGTTCCTGCTCCAAGA-3'; the nucleotide sequence shown in SEQ ID NO: 17 is: 5'-CAAATGTGGGTGCTGTCCTCGGT-3'; the nucleotide sequence shown in SEQ ID NO: 18 is: 5'-CATCCTAGTGACTGCGGTAGCCTCC-3';The nucleotide sequence shown in SEQ ID NO:19 is: 5'-CTCTTGCTGAACTGCCTCTGGGATTA-3'; the nucleotide sequence shown in SEQ ID NO:20 is: 5'-AGTGAGAGCAAATCCTCATTGTAGCCTG-3'; the nucleotide sequence shown in SEQ ID NO:21 is: 5'-TTGGCACCATCCCCGAAAATAGC-3'; the nucleotide sequence shown in SEQ ID NO:22 is: 5'-TGTGTGCCAGAATCAATGCCGC-3'; the nucleotide sequence shown in SEQ ID NO:23 is: 5'-ATTCGCACCAGCCCCTGAAGTCTA-3'; the nucleotide sequence shown in SEQ ID NO:24 is: 5'-ACGGCTTTCTAACTGGCTTTGCGA-3'; the nucleotide sequence shown in SEQ ID NO:25 is: 5'-CCAGACAAACTCAGTGCCGAGCC-3'; the nucleotide sequence shown in SEQ ID NO:26 is: 5'-CCAGACAAACTCAGTGCCGAGCC-3'; the nucleotide sequence shown in SEQ ID NO:27 is: 5'-TTGGCACCATCCCCGAAAATAGC-3'; the nucleotide sequence shown in SEQ ID NO:28 is: 5'-TTGGCACCATCCCCGAAAATAGC-3'; the nucleotide sequence shown in SEQ ID NO:29 is: 5'-ATTCGCACCAGCCCCTGAAGTCTA-3'; the nucleotide sequence shown in SEQ ID NO:30 is: 5'- The nucleotide sequence shown in SEQ ID NO:26 is: 5'-TTATGACCACATCTGTGCTGCGGAT-3'; the nucleotide sequence shown in SEQ ID NO:27 is: 5'-CTCCTCTCGGCTGTGACAGTCGCT-3'; the nucleotide sequence shown in SEQ ID NO:28 is: 5'-CCTCTTTGGAACTTTGGGATGGGG-3'; the nucleotide sequence shown in SEQ ID NO:29 is: 5'-AAGGATGGGCAGGCAGTGAAAAGC-3'; the nucleotide sequence shown in SEQ ID NO:30 is: 5'-AATGCCTGGGGAATGTTGGACTCA-3'; the nucleotide sequence shown in SEQ ID NO:31 is: 5'-GTGGCTTTCTCCCTCTCAGGCTTG-3'; the nucleotide sequence shown in SEQ ID NO:32 is: 5'-GACTTTTCAAACATTGCTGCTACCTGGA-3'; the nucleotide sequence shown in SEQ ID NO:33 is: 5'-GACTTTTCAAACATTGCTGCTACCTGGA-3'; the nucleotide sequence shown in SEQ ID NO:34 is: 5'-GACTTTTCAAACATTGCTGCTACCTGGA-3'; the nucleotide sequence shown in SEQ ID NO:35 is: 5'-GACTTTTCAAACATTGCTGCTACCTGGA-3'; the nucleotide sequence shown in SEQ ID NO:36 is: 5'-GACTTTTCAAACATTGCTGCTACCTGGA-3'; the nucleotide sequence shown in SEQ ID NO:37 is: 5'-GACTTTTCAAACATTGCTGCTACCTGGA-3'; the nucleotide sequence shown in SEQ ID NO:38 is: 5'-GACTTTTCAAACATTGCTGCTACCTGGA-3'; the nucleotide sequence shown in SEQ ID NO:39 is: 5'-GACTTTTCAAACATTGCTGCTACCTGGA-3'; the nucleotide sequence shown in The nucleotide sequence shown in SEQ ID NO:33 is: 5'-TGCATTCTTTTGCAATTCTTCTGATTTGA-3'; the nucleotide sequence shown in SEQ ID NO:34 is: 5'-ACTCCGTTTTACCTCCTCACCCTTCA-3'; the nucleotide sequence shown in SEQ ID NO:35 is: 5'-AGTGAAGGGTGAGGAGGTAAAACGGA-3'; the nucleotide sequence shown in SEQ ID NO:36 is: 5'-TGAGCCCCACCTCTGGAAAGCC-3';The nucleotide sequence shown in SEQ ID NO:37 is: 5'-AAAACAGCCGAAGCCTCAACTCAAG-3'; the nucleotide sequence shown in SEQ ID NO:38 is: 5'-AGACGATGGACACATTGAGGAGGGAG-3'; the nucleotide sequence shown in SEQ ID NO:39 is: 5'-AGGGAAGTTGGGAATGGGTGGAGA-3'; the nucleotide sequence shown in SEQ ID NO:40 is: 5'-CAAAACAAGGCAGGAAGGAACCACTA-3'; the nucleotide sequence shown in SEQ ID NO:41 is: 5'-GGCTGCTCTACTCCTTCGTTCTGGC-3'; the nucleotide sequence shown in SEQ ID NO:42 is: 5'-GGGGCAACCAACTAAGAGGGAGCA-3'; the nucleotide sequence shown in SEQ ID NO:43 is: 5'-CCCCTAACAGTTGGTGGCAGTCAGTAA-3'; the nucleotide sequence shown in SEQ ID NO:44 is: 5'-CCCCTAACAGTTGGTGGCAGTCAGTAA-3'; the nucleotide sequence shown in SEQ ID NO:45 is: 5'-CCCCTAACAGTTGGTGGCAGTCAGTAA-3'; the nucleotide sequence shown in SEQ ID NO:46 is: 5'-CCCCTAACAGTTGGTGGCAGTCAGTAA-3'; the nucleotide sequence shown in SEQ ID NO:47 is: 5'-CCCCTAACAGTTGGTGGCAGTCAGTAA-3'; the nucleotide sequence shown in SEQ ID NO:48 is: 5'- The nucleotide sequence shown in NO:44 is: 5'-GTGTCTTTCTAAAGCCCAGCCACCTAAT-3'.;

[0039] It can be understood that while the primer multiplier is greatly reduced, the 3-terminal SNP site is avoided when designing primers, which effectively reduces the risk of disconnection and effectively improves the validity and availability of multiple long-chain PCR second-generation sequencing data.

[0040] Other embodiments of the present application provide the use of the above-mentioned nucleic acid product in the preparation of a detection kit for a single gene genetic disease.

[0041] Other embodiments of the present application also provide a kit comprising the above-mentioned nucleic acid product.

[0042] In some specific examples, the kit also includes PCR reaction reagents.

[0043] In some specific examples, the PCR reaction reagents include one or more of a PCR buffer, a DNA polymerase, magnesium ions, and dNTPs.

[0044] In some specific examples, the kit also includes a DNA extraction reagent.

[0045] It is understandable that, in some other specific examples, the above-mentioned kit may not include any of the PCR reaction reagents and DNA extraction reagents, and the excluded reagents may be reasonably obtained from the outside.

[0046] The use of the kit of the present application for detecting single gene genetic diseases can not only effectively detect variations in exons and splicing regions, but also detect deep introns and UTR region variations, and to a certain extent can also detect the deletion of a single exon.

[0047] Other embodiments of the present application further provide a method for constructing a library for detecting genes related to single gene genetic diseases, comprising steps S100 to S400.

[0048] Step S100: extracting genomic DNA from a biological sample to be tested.

[0049] In some embodiments, the biological sample to be tested is selected from one or more of peripheral blood, dried blood spots or oral mucosal epithelial cells.

[0050] Step S200: using the genomic DNA as a template and the above-mentioned nucleic acid product to perform a first PCR amplification to obtain a first amplification product.

[0051] In some embodiments, the conditions for the first PCR amplification include: 94°C to 96°C for 1 min to 3 min, 96°C to 98°C for 10 s to 30 s, 65°C to 70°C for 1 min to 8 min, and 30 to 40 cycles.

[0052] In a specific example, the conditions for the first PCR amplification include: 94° C. reaction for 2 min, 98° C. reaction for 15 s, 68° C. reaction for 1 min to 8 min, and 30 cycles.

[0053] In some embodiments, the length of the amplified product is 10500 bp to 14800 bp.

[0054] Step S300: using the first amplification product as a template, performing a second PCR amplification to obtain a second amplification product.

[0055] In some embodiments, the primers used in the second PCR amplification include at least one of a universal primer and a specific primer.

[0056] Specifically, in step S300, the second PCR amplification is performed using the first amplification product as a template, and the step of obtaining the second amplification product includes steps S310 to S320.

[0057] Step S310: adding a ligation adapter to the first amplification product to obtain a ligation adapter product.

[0058] Step S320: using the product after the adapter is connected as a template, using universal primers and specific primers to amplify the product after the adapter is connected, to obtain a second amplification product.

[0059] In some of the embodiments, the multiple long-chain PCR amplification products can be combined in equal mass or in equal volume, preferably in equal mass.

[0060] Furthermore, after the second amplification product is obtained, the second amplification product is purified, the purified product is taken for quality inspection, and the product that passes the quality inspection is used to construct a gene library of genes related to single gene genetic diseases.

[0061] Step S400: constructing a library for detecting genes related to single gene genetic diseases based on the second amplification product.

[0062] In some of the embodiments, the second amplification product can be constructed and sequenced on a second-generation sequencing platform or on a third-generation sequencing platform.

[0063] It is understandable that the above-mentioned library construction method for detecting genes related to single-gene genetic diseases can be a disease diagnosis method or a non-disease diagnosis purpose.

[0064] One embodiment of the present application provides a gene library of genes related to single gene genetic diseases constructed by the library construction method of any of the above technical solutions.

[0065] This application uses two rounds of PCR reactions to successfully construct a library for detecting genes related to single-gene genetic diseases. It has the advantages of short library construction cycle, high matching rate, good uniformity, good repeatability, and simple operation. It can provide guidance for clinicians to comprehensively assess the disease risk of the subjects, customize personalized medical and life intervention measures, and significantly reduce the risk of single-gene genetic diseases.

[0066] The present application will be further described below in conjunction with specific embodiments and comparative examples, but they should not be construed as limiting the scope of protection of the present application.

[0067] Example 1

[0068] 1. Genes associated with single gene diseases

[0069] The monogenic genetic diseases involved in the embodiments of the present application include hepatolenticular degeneration, glucose-6-phosphate dehydrogenase, β-thalassemia, phenylketonuria, methylmalonic aciduria and homocystinuria, cblC type, autosomal recessive deafness with vestibular aqueduct dilatation type 4 / Pendred syndrome and autosomal recessive deafness type 1A; the genes detected in the present application include pathogenic genes: ATP7B, G6PD, HBB, PAH, MMACHC, SLC26A4 and GJB2. Specifically shown in Table 1 below:

[0070] Table 1

[0071]

[0072] 2. Primer Design and Synthesis

[0073] 1. The sequences of multiplex long-chain PCR primers used to detect ATP7B, G6PD, HBB, PAH, MMACHC, SLC26A4 and GJB2 genes are shown in Table 2 below.

[0074] Table 2

[0075]

[0076]

[0077] 2. Provide a kit for detecting single gene genetic diseases

[0078] The kit includes PCR reaction solution, nucleic acid products for detecting gene mutations related to single gene genetic diseases, and DNA polymerase. Among them, nucleic acid products include:

[0079] Long-chain PCR primers for amplifying ATP7B gene, the nucleotide sequences of which are shown in SEQ ID NOs: 1 to 10;

[0080] Long-chain PCR primers for amplifying the G6PD gene, the nucleotide sequences of which are shown in SEQ ID NOs: 11 to 14;

[0081] Long-chain PCR primers for amplifying the HBB gene, the nucleotide sequences of which are shown in SEQ ID NOs: 15-16;

[0082] Long-chain PCR primers for amplifying the PAH gene, the nucleotide sequences of which are shown in SEQ ID NOs: 17 to 28;

[0083] Long-chain PCR primers for amplifying the MMACHC gene, the nucleotide sequences of which are shown in SEQ ID NOs: 29 to 32;

[0084] Long-chain PCR primers for amplifying the SLC26A4 gene, the nucleotide sequences of which are shown in SEQ ID NOs: 33 to 42;

[0085] The nucleotide sequences of the long-chain PCR primers used to amplify the GJB2 gene are shown in SEQ ID NOs: 43-44.

[0086] 3. Detection Method

[0087] 1. Sample pretreatment and nucleic acid extraction

[0088] The sample types used were peripheral blood, dried blood spots or oral mucosal epithelial cells, and nucleic acid extraction or purification reagents [Susu Medical No. 20210902] were used for gDNA extraction.

[0089] 2. Library construction

[0090] In the first step, the amplification primers used the above-designed and synthesized long-chain PCR primers for amplifying ATP7B gene, the long-chain PCR primers for amplifying G6PD gene, the long-chain PCR primers for amplifying HBB gene, the long-chain PCR primers for amplifying PAH gene, the long-chain PCR primers for amplifying MMACHC gene, the long-chain PCR primers for amplifying SLC26A4 gene and the long-chain PCR primers for amplifying GJB2 gene to amplify the target gene site sequence; in the second step, the amplification primers used universal primer A and specific primer X to add sample-specific sequences to the amplification product sequence to help identify different samples; the fragmentation and purification of the amplification product began with the finished kit of the Genomic Copy Number Abnormality Detection Kit (DA500 / DA5000) of Suzhou Beikang Medical Instrument Co., Ltd.

[0091] 2.1 Targeted enrichment of target regions - library construction

[0092] a) Use gDNA as template for regional targeted enrichment. Prepare the amplification reaction mix on an ice box according to Table 3 below:

[0093] Table 3

[0094] Components Volume (μL) Buffer 12.5 dNTP Mix 5 DNA Polymerase 0.5 Primers 1.5 gDNA (100ng) 2.5 Nuclease-free water 3 Total volume 25

[0095] b) Vortex to mix and centrifuge briefly.

[0096] c) Place the above PCR tube on the PCR instrument, select "105°C" for "Hot Cover", tighten the hot cover, and set the reaction parameters according to Table 4 below:

[0097] Table 4

[0098]

[0099] 2.2 Purification and quantification of amplified products

[0100] After equal mass pooling of each amplification product, add AMPure XP magnetic beads according to 0.8× volume, blow and mix with a gun, leave at room temperature for 5 minutes, place on a magnetic stand, wait for the liquid to become clear, remove the supernatant, wash with 200μL of 70% alcohol, repeat once, dry the magnetic beads at room temperature, resuspend the magnetic beads with 25μL Low TE, and elute the DNA. Quantification was performed using Qubit dsDNA HS AssayKit.

[0101] 2.3 Fragmentation and purification of amplified products

[0102] a) Briefly centrifuge the DNA fragmentation enzyme for 3 seconds, place on ice, and prepare the system shown in Table 5 in a PCR tube.

[0103] Table 5

[0104]

[0105]

[0106] b) Vortex to mix, centrifuge briefly, and place on ice. Add 5 μL of fragmentation enzyme mixture, gently pipette 8 times to mix (do not vortex), centrifuge briefly, and immediately place in a gene thermal cycler that has been precooled to 4°C, and react according to the conditions in Table 6 below (the temperature of the hot cover is set to 70°C):

[0107] Table 6

[0108] temperature time 4℃ 1min 32℃ 13min 65℃ 30min 4℃ Hold

[0109] c) After the reaction is completed, centrifuge for 5 seconds, transfer the fragmented product to a 1.5 mL centrifuge tube, and add 75 μL of nuclease-free water to 100 μL.

[0110] d) Add 80 μL of DNA purification magnetic beads, mix well and let stand at room temperature for 5 minutes, then place on a magnetic rack for 3 to 5 minutes until the liquid clarifies, and take the supernatant into a new 1.5 mL centrifuge tube (discard the magnetic beads).

[0111] e) Add 20 μL DNA purification magnetic beads, mix well and let stand at room temperature for 5 minutes, then place on a magnetic rack for 3 to 5 minutes until the liquid becomes clear, and discard the supernatant (be careful not to absorb the magnetic beads).

[0112] f) Add 200 μL of 80% ethanol, gently spin the 1.5 mL centrifuge tube once, let it stand for 30 seconds, and discard the supernatant (be careful not to absorb the magnetic beads).

[0113] g) Repeat the previous step.

[0114] h) Centrifuge for 5 seconds, then place on a magnetic rack for 1 to 2 minutes until the liquid becomes clear, and discard the supernatant (be careful not to absorb the magnetic beads).

[0115] i) Open the cap of the 1.5 mL centrifuge tube and leave it at room temperature for about 3 minutes to allow the residual ethanol to evaporate completely until there is no obvious water stain on the surface. Be careful not to over-dry. If cracks appear on the magnetic beads, cover the tube cap and proceed to the next step of the experiment immediately.

[0116] j) Remove the 1.5 mL centrifuge tube from the magnetic stand, add 21 μL DNA elution buffer, resuspend the magnetic beads, and let stand at room temperature for 5 minutes.

[0117] k) Place the 1.5 mL centrifuge tube back on the magnetic rack for 3 to 5 minutes until the liquid becomes clear, and take 19 μL of the eluted product into a new 0.2 μL PCR tube (be careful not to suck up the magnetic beads).

[0118] 2.4 Adapter ligation and purification

[0119] a) Prepare the system in Table 7 in a PCR tube on an ice box according to the table below:

[0120] Table 7

[0121] Components Reaction volume (μL) Fragmented DNA 19 Ligase buffer 25 Universal connector 2 DNA ligase 4 Total amount of reaction system 50

[0122] b) Vortex to mix and centrifuge briefly.

[0123] c) Place the PCR tube on a PCR instrument and run the following PCR program in Table 8 (heat cover at 30°C):

[0124] Table 8

[0125] temperature time 20℃ 15min 4℃ Hold

[0126] d) Centrifuge immediately after completion and proceed to the next step.

[0127] e) Transfer the adapter ligation product to a 1.5 mL centrifuge tube, add 50 μL DNA purification magnetic beads, mix well, let stand at room temperature for 5 minutes, then place on a magnetic stand for 3 to 5 minutes until the liquid is clear, and discard the supernatant (be careful not to absorb the magnetic beads); add 300 μL 80% ethanol, gently spin the 1.5 mL centrifuge tube once, let stand for 30 seconds, and discard the supernatant (be careful not to absorb the magnetic beads)

[0128] f) Repeat the previous step.

[0129] g) Centrifuge for 5 seconds, then place on a magnetic rack for 1 to 2 minutes until the liquid is clear, and discard the supernatant (be careful not to absorb the magnetic beads).

[0130] h) Open the cap of the 1.5 mL centrifuge tube and leave it at room temperature for about 3 minutes to allow the residual ethanol to evaporate completely until there is no obvious water stain on the surface. Be careful not to over-dry. If cracks appear on the magnetic beads, cover the tube cap and proceed to the next experimental operation immediately.

[0131] i) Remove the 1.5mL centrifuge tube from the magnetic stand, add 19μL DNA elution buffer, resuspend the magnetic beads, and let stand at room temperature for 5 minutes. Place the 1.5mL centrifuge tube back on the magnetic stand for 3-5 minutes until the liquid is clear, and take 17μL of the eluted product into a new 0.2mL tube (be careful not to suck up the magnetic beads).

[0132] 2.5 Amplification, enrichment and purification

[0133] a) Prepare the system in Table 9 in a PCR tube on an ice box according to the table below:

[0134] Table 9

[0135] Components Reaction volume (μL) Adapter-ligated DNA 17 PCR enzyme mix 25 Universal Primer A 4 Specific primer X 4 Total amount of reaction system 50

[0136] Among them, the above-mentioned specific primers are adapter sequences with different barcodes of BGI, specifically TGTGAGCCAAGGAGTTGNNNNNNNNNNTTGTCTTCCTAAGACCGCTTGGCCTCCGACTT; the universal primer is: SEQ ID NO:45: 5'-GAACGACATGGCTACGATCCGACT-3'. When the DNA molecules to be tested come from multiple test samples, each sample can be added with a different label sequence (barcode) to distinguish the samples during the sequencing process, so as to achieve simultaneous sequencing of multiple samples, and 96 samples can be sequenced. The sequencing method is PE100 or PE150.

[0137] b) Vortex to mix and centrifuge briefly.

[0138] c) Place the PCR tube on a PCR instrument and run the following PCR program in Table 10:

[0139] Table 10

[0140]

[0141] d) Centrifuge briefly and transfer the amplified product to a 1.5 mL centrifuge tube. Add 50 μL of DNA purification magnetic beads, mix well and let stand at room temperature.

[0142] 5 minutes, then place on the magnetic stand for 3 to 5 minutes until the liquid becomes clear, and discard the supernatant (be careful not to absorb the magnetic beads).

[0143] e) Add 300 μL of 80% ethanol, gently spin the 1.5 mL centrifuge tube once, let it stand for 30 seconds, and discard the supernatant (be careful not to absorb the magnetic beads).

[0144] f) Repeat the previous step.

[0145] g) Centrifuge for 5 seconds, then place on a magnetic rack for 1 to 2 minutes until the liquid is clear, and discard the supernatant (be careful not to absorb the magnetic beads).

[0146] h) Open the cap of the 1.5 mL centrifuge tube and leave it at room temperature for about 3 minutes to allow the residual ethanol to evaporate completely until there is no obvious water stain on the surface. Be careful not to over-dry. If cracks appear on the magnetic beads, cover the tube cap and proceed to the next experimental operation immediately.

[0147] i) Remove the 1.5 mL centrifuge tube from the magnetic stand, add 22 μL DNA elution buffer, resuspend the magnetic beads, and let stand at room temperature for 5 minutes.

[0148] j) Place the 1.5 mL centrifuge tube back on the magnetic rack for 3 to 5 minutes until the liquid becomes clear, and transfer all the eluted product to a new 1.5 mL centrifuge tube (be careful not to suck up the magnetic beads).

[0149] k) Store the constructed library samples briefly in a 4°C refrigerator and wait for library quantification.

[0150] 2.6 Sequencing

[0151] The second-generation sequencing platform was used for sequencing, and the sequencing method was PE100 or PE150.

[0152] test

[0153] 1. Sensitivity detection

[0154] The samples were quantified using Qubit, and the samples were diluted to 15ng / μL, 10ng / μL, 5ng / μL, and 2ng / μL according to the quantitative results to determine the detection sensitivity. The primers at 15ng / μL, 10ng / μL, and 5ng / μL could be effectively amplified. The agarose gel electrophoresis quality inspection showed that all of them had target-specific bands, but some primers at 2ng / μL did not amplify bands. The specific electrophoresis diagram is shown below:

[0155] The quality inspection results of 5ng / μL sample agarose gel electrophoresis are as follows Figure 1-2 As shown, Note: M: DL15000, each lane is respectively: primer combination of SEQ ID NO: 1 to SEQ ID NO: 44 of ATP7B, G6PD, HBB, PAH, MMACHC, SLC26A4 and GJB2 genes, Figure 1 The middle lanes from left to right are Figure 1 : The lanes represent: Lane 1: M:DL15000; Lane 2: SEQ ID NO:1+SEQ ID NO:2; Lane 3: SEQ ID NO:3+SEQ ID NO:4; Lane 4: SEQ ID NO:5+SEQ ID NO:6; Lane 5: SEQ ID NO:7+SEQ ID NO:8; Lane 6: SEQ ID NO:9+SEQ ID NO:10; Lane 7: SEQ ID NO:11+SEQ ID NO:12; Lane 8: SEQ ID NO:13+SEQ ID NO:14; Lane 9: SEQ ID NO:15+SEQ ID NO:16; Lane 10: SEQ ID NO:17+SEQ ID NO:18; Figure 2The lanes from left to right are: Lane 1: M:DL15000; Lane 2: SEQ ID NO:19+SEQ ID NO:20; Lane 3: SEQ ID NO:21+SEQ ID NO:22; Lane 4: SEQ ID NO:23+SEQ ID NO:24; Lane 5: SEQ ID NO:25+SEQ ID NO:26; Lane 6: SEQ ID NO:27+SEQ ID NO:28; Lane 7: SEQ ID NO:29+SEQ ID NO:30; Lane 8: SEQ ID NO:31+SEQ ID NO:32; Lane 9: SEQ ID NO:33+SEQ ID NO:34; Lane 10: SEQ ID NO:35+SEQ ID NO:36; Lane 11: SEQ ID NO:37+SEQ ID NO:38; Lane 12: SEQ ID NO:39+SEQ ID NO:40; Lane 13: SEQ ID NO:41+SEQ ID NO:42 Lane 14: SEQ ID NO:43+SEQ ID NO:44.

[0156] The quality inspection results of 2ng / μL amplification product agarose gel electrophoresis (partial) are as follows Figure 3 As shown, Note: M:DL15000, Figure 3 The middle lanes from left to right are: Lane 1: M: DL15000; Lane 2: SEQ ID NO: 13 + SEQ ID NO: 14; Lane 3: SEQ ID NO: 15 + SEQ ID NO: 16; Lane 4: SEQ ID NO: 17 + SEQ ID NO: 18; Lane 5: SEQ ID NO: 13 + SEQ ID NO: 14; Lane 6: SEQ ID NO: 1 + SEQ ID NO: 2; Lane 7: SEQ ID NO: 19 + SEQ ID NO: 20; Lane 8: SEQ ID NO: 21 + SEQ ID NO: 22; Lane 9: SEQ ID NO: 35 + SEQ ID NO: 36; Lane 10: SEQ ID NO: 5 + SEQ ID NO: 6; Lane 11: blank control. Since some primers at 2 ng / μL could not be amplified, the gene detection requirements could not be met.

[0157] 2. Specificity detection

[0158] Replace SEQ ID NO:3 and SEQ ID NO:4 in the ATP7B gene primer set with other primers

[0159] The specific sequence is SEQ ID NO:46: 5'-TCCACGTTGCTGACTTTGCACCCA-3'; SEQ ID NO:47: 5'-CACGCCCCAGGTGAGTAGAGGAAC-3', which will cause the uniformity deviation of the amplicon to be too large. Before the replacement, the quality control data is shown in Table 11 below:

[0160] Table 11

[0161]

[0162] After replacement, the uniformity is as follows: Figure 4 As shown in IGV, note: the horizontal axis is the base position, the vertical axis is the sequencing depth, the red arrow indicates the amplicon region of the SEQ ID NO:1 and SEQ ID NO:2 primer set, and the green arrow indicates that the SEQ ID NO:3 and SEQ ID NO:4 primers are replaced with other primer combinations. After the SEQ ID NO:3 and SEQ ID NO:4 primers are replaced, their sequencing depth is about 10 times different from the sequencing depth of other primer sets of the ATP7B gene, which seriously affects the accuracy of the detection of SNVs and Indels sites within its range, and is prone to false positives or false negatives. At the same time, it also increases the cost of Sanger experiment verification. It is not as good as the technical solution of the specific primer combination of this application.

[0163] The quality control data of G6PD, HBB, PAH, MMACHC, SLC26A4 and GJB2 are shown in Table 12 below:

[0164] Table 12

[0165]

[0166]

[0167] Example 2

[0168] Blood samples from two patients who had undergone whole exome testing and were found to carry ATP7B pathogenic variants were collected. The sample information is shown in Table 13. 1 ml of each peripheral blood sample was collected and stored in EDTA anticoagulation tubes. This detection method was used for ATP8B gene detection.

[0169] Table 13

[0170] Serial number Sample No. Gene mutation type 1 Sample 1 NM_000053.4(ATP7B):c.2939G>T 2 Sample 2 NM_000053.4(ATP7B):c.3316G>A

[0171] Blood samples were extracted with nucleic acid extraction or purification reagents [Susu Medical Equipment No. 20210902] for gDNA extraction. The experiment using the present invention is detailed in the above experimental process. The specific results are as follows:

[0172] 1. Second-generation platform sequencing quality control results:

[0173] The quality control results of the next-generation sequencing are shown in Table 14:

[0174] Table 14

[0175]

[0176] Notes: Raw base (Mb): the amount of raw sequencing data; QC Fail reads: reads that do not meet the quality control requirements; Paired Reads: paired-end reads; Mapped Reads: reads mapped to the target region of the amplicon; Fraction of Mapped Reads: the proportion of reads mapped to the target region of the amplicon; Coverage: coverage; Fraction Region covered: the proportion of target region coverage.

[0177] 2. Next-generation sequencing test results:

[0178] According to the test results, the test results of the present invention are consistent with the known results, with a compliance rate of 100%. The test results are shown in Table 15:

[0179] Table 15

[0180]

[0181] Example 3

[0182] One dry blood sample was collected and found to carry the MMACHC pathogenic variant after whole exome testing. The sample information is shown in Table 16.

[0183] This detection method is used for MMACHC gene detection.

[0184] Table 16

[0185]

[0186] The dried blood sample was subjected to gDNA extraction using nucleic acid extraction or purification reagents [Susu Medical Equipment No. 20210902]. The experiment using the present invention is detailed in the above experimental procedure. The specific results are as follows:

[0187] 1. Second-generation platform sequencing quality control results:

[0188] The quality control results of the next-generation sequencing are shown in Table 17:

[0189] Table 17

[0190] raw total sequences reads mapped mapping rate [Target]Coverage (>=100x) 1814876 1806891 0.9956 100.00％

[0191] 2. Next-generation sequencing test results:

[0192] All variant identification results are shown in Table 18 below:

[0193] Table 18

[0194]

[0195]

[0196] According to the test results, the test results of the present invention are consistent with the known results, with a compliance rate of 100%.

[0197] Example 4

[0198] 20 samples with known results (WES test) were recruited and selected for accuracy and repeatability verification, including 16 positive samples, 4 negative samples and nuclease-free water. Two experimenters performed the experiment at different time points according to the same operating procedures as in Example 1. The specific test results are shown in Table 19 below.

[0199] Table 19

[0200]

[0201]

[0202] According to the test results, the kit 1 of the present application has high accuracy and good repeatability.

[0203] It can be seen from the above results that, except for the specific combination of the present application, other detection combination systems either cannot be successfully detected, or the detection sensitivity and precision are very low. This fully demonstrates that not any primer design or combination can achieve the detection effect of the single gene genetic disease nucleic acid product of the present application.

[0204] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0205] The above-mentioned embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims.

Claims

1. A nucleic acid product for detecting gene mutations associated with single gene genetic diseases, characterized in that: It includes at least one of a long-chain PCR primer for amplifying the ATP7B gene, a long-chain PCR primer for amplifying the G6PD gene, a long-chain PCR primer for amplifying the HBB gene, a long-chain PCR primer for amplifying the PAH gene, a long-chain PCR primer for amplifying the MMACHC gene, a long-chain PCR primer for amplifying the SLC26A4 gene, and a long-chain PCR primer for amplifying the GJB2 gene.

2. The nucleic acid product for detecting gene mutations associated with single gene genetic diseases according to claim 1, characterized in that: The nucleotide sequences of the long-chain PCR primers for amplifying the ATP7B gene are shown in SEQ ID NOs: 1 to 10, the nucleotide sequences of the long-chain PCR primers for amplifying the G6PD gene are shown in SEQ ID NOs: 11 to 14, the nucleotide sequences of the long-chain PCR primers for amplifying the HBB gene are shown in SEQ ID NOs: 15 to 16, the nucleotide sequences of the long-chain PCR primers for amplifying the PAH gene are shown in SEQ ID NOs: 17 to 28, the nucleotide sequences of the long-chain PCR primers for amplifying the MMACHC gene are shown in SEQ ID NOs: 29 to 32, the nucleotide sequences of the long-chain PCR primers for amplifying the SLC26A4 gene are shown in SEQ ID NOs: 33 to 42, and the nucleotide sequences of the long-chain PCR primers for amplifying the GJB2 gene are shown in SEQ ID NOs: 43 to 44.

3. Use of the nucleic acid product according to claim 1 or 2 in the preparation of a detection kit for a single gene genetic disease.

4. A kit for detecting a single gene genetic disease, characterized in that: The kit comprises the nucleic acid product according to any one of claims 1 to 2.

5. The kit for detecting a single gene genetic disease according to claim 4, characterized in that: The kit also includes PCR reaction reagents.

6. The kit for detecting a single gene genetic disease according to claim 5, characterized in that: The PCR reaction reagents include one or more of a PCR buffer, a DNA polymerase, magnesium ions and dNTPs.

7. The kit for detecting a single gene genetic disease according to any one of claims 4 to 6, characterized in that: The kit also includes a DNA extraction reagent.

8. A method for constructing a library for detecting genes related to single gene genetic diseases, characterized in that: The following steps are involved: Extracting genomic DNA from the biological sample to be tested; Using the genomic DNA as a template, the nucleic acid product according to claim 1 or 2 is used for PCR amplification to obtain a first amplification product; Performing a second PCR amplification using the first amplification product as a template to obtain a second amplification product; as well as Constructing the library for detecting genes related to single gene genetic diseases according to the second amplification product; The primers used for the second PCR amplification include at least one of a universal primer and a specific primer.

9. The library construction method according to claim 8, characterized in that After the second amplification product is obtained, the second amplification product is purified, the purified product is taken for quality inspection, and the product that passes the quality inspection is used to construct a gene library of the gene related to the single gene genetic disease.

10. The library construction method according to any one of claims 8 to 9, characterized in that: The conditions of the first PCR amplification include: reaction at 94° C. to 96° C. for 1 min to 3 min, reaction at 96° C. to 98° C. for 10 s to 30 s, reaction at 65° C. to 70° C. for 1 min to 8 min, and cycled 30 to 40 times.

Images