Application of sakuranetin in promoting nodulation of leguminous plants

Abstract

The invention discloses application of sakuranetin in promoting nodulation of leguminous plants. After heterologous overexpression of 35Sproo: OsNOMT-GFP in the leguminous plant, the sakuranetin content in the leguminous plant is higher than that of a wild type, and the number of root nodules is increased after inoculation of rhizobium. The method for rapidly and effectively increasing the number of the root nodules of the leguminous plants is established by irrigating the sakuranetin aqueous solution in the growth process of the leguminous plants, so that the method is easy to implement and remarkable in effect, and a powerful reference is provided for increasing the number of the root nodules of the leguminous plants.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of sakura extract in promoting nodulation of leguminous plants. Background Art

[0002] Soybean is an important oil crop, food crop and feed crop. The Leguminosae family to which soybeans belong can specifically form a nodule symbiotic relationship with rhizobia in the soil. Rhizobia can fix nitrogen in the air into ammonium salts that can be used by plants and supply them to plants. In return, soybeans will provide the carbon source synthesized by photosynthesis to rhizobia. Compared with other crops, nodule symbiosis can provide soybeans with a portion of nitrogen fertilizer. Although the symbiotic nitrogen fixation of leguminous plants was once the main source of nitrogen in the agricultural system (about 50 million tons per year), its current contribution is less than half of that of chemical fertilizer nitrogen. Improving nodule symbiosis can help reduce dependence on chemical fertilizers and alleviate ecological hazards such as eutrophication of water bodies caused by excessive use of chemical fertilizers.

[0003] Sakurenatin belongs to the dihydroflavonoids in flavonoids, and plays an important role in fighting fungi and bacteria, slowing down aging, and inhibiting cancer cells. The last step of sakurenatin synthesis requires methylation modification of the precursor naringenin by formyltransferase (NOMT) ​​to finally generate sakurenatin. Sakurenatin has been widely studied as a phytoalexin in plants to resist the infection of pathogenic microorganisms. The symbiotic relationship between soybeans and rhizobia requires flavonoids as signal molecules, but there is still no relevant report on whether sakurenatin has an effect on nodule symbiosis. Summary of the invention

[0004] In view of the deficiencies of the prior art, the present invention provides the application of sakura glycosides in promoting nodulation of leguminous plants.

[0005] In order to solve the above technical problems, in the first aspect, the present invention provides the use of sakura glycosides in promoting nodulation of leguminous plants. The leguminous plants may preferably be soybeans.

[0006] Preferably, the nodulation of leguminous plants is promoted by increasing the content of sakura glycosides. The content of sakura glycosides is regulated by the gene OsNOMT, wherein the gene OsNOMT has a nucleotide sequence shown in SEQ ID NO:1.

[0007] The protein encoded by the gene OsNOMT has the protein sequence shown in SEQ ID NO:2.

[0008] In a second aspect, the present invention provides the use of sakura glycosides in reducing the dependence of leguminous plants on chemical fertilizers.

[0009] Preferably, the nodulation of leguminous plants is promoted by increasing the content of sakura glycosides.

[0010] In a third aspect, the present invention provides a method for constructing a transgenic legume plant, which is constructed by cloning the OsNOMT gene of a wild-type legume plant and using transgenic technology.

[0011] In a fourth aspect, the present invention provides a method for increasing the number of root nodules of leguminous plants, specifically by irrigating the soil around the roots of leguminous plants with an aqueous solution of sakura hormone.

[0012] Preferably, the leguminous plant is a 3-4 week old seedling;

[0013] Preferably, the concentration of the sakura extract aqueous solution is 10-30 μM; the irrigation cycle is once every 2-3 days, and the dosage is 30-80 ml.

[0014] The rhizobium strain is USDA110; and the number of nodules is observed for 2-3 weeks.

[0015] Beneficial effects of the present invention:

[0016] The present invention proposes that sakura glycosides can promote nodulation of legumes. In addition, the number of nodules can be increased after the legumes are watered with a sakura glycosides aqueous solution. After the legumes are heterologously overexpressed with 35Spro::OsNOMT-GFP, the content of sakura glycosides in the legumes is higher than that in the wild type, and the number of nodules is increased after inoculation with rhizobia. That is, the present invention proposes to establish a method for quickly and effectively increasing the number of nodules of legumes by watering with a sakura glycosides aqueous solution during the growth of legumes. Therefore, the present invention is simple to implement and has significant effects, and provides a strong reference for increasing the number of nodules of legumes. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a statistics of the number of nodules after soybeans were irrigated with sakura extract aqueous solution.

[0018] Figure 2 This is the detection of sakurabin content in vivo after soybean overexpressed 35Spro::OsNOMT-GFP.

[0019] Figure 3 This is the statistics of nodule numbers after soybean overexpressed 35Spro::OsNOMT-GFP. DETAILED DESCRIPTION

[0020] The present invention is further described below in conjunction with specific implementation schemes. These embodiments should be understood as only the best examples of the present invention, and are not intended to limit the present invention in any way. Any improvements, modifications and equivalent substitutions made within the scope of the invention should be included in the scope of the present invention.

[0021] Example 1: Watering soybeans with sakura extract aqueous solution

[0022] 1. Soybean cultivation: Wild-type seeds Williams82 were buried 2 cm under moist vermiculite and placed in a 28°C constant temperature incubator for 3 days. Water was applied every day to keep the vermiculite moist until the soybeans emerged. The germinated soybeans were transferred to new vermiculite, with one plant per pot, and placed in a greenhouse (daytime: 30°C, light intensity 160 μE / m 2 s, 16h; night: 25℃, light intensity 0μE / m 2 s, 8h) and set aside.

[0023] 2. Preparation of sakurain aqueous solution: sakurain was dissolved in DMSO to prepare a 100mM stock solution. Diluted with water to a 10μM working solution. The control group was a 10μM naringenin aqueous solution prepared in the same way and a DMSO dilution without sakurain or naringenin.

[0024] 3. Rhizobium inoculation: OD after overnight culture of soybean rhizobium (Bradyrhizobium japonicum USDA110) 600 Adjust to about 0.02-0.08, 1-3 ml per soybean plant. Water once every 2-3 days with tap water, once a day, and use 30-80 ml to keep the soil moist.

[0025] 4. Watering soybeans with sakura extract aqueous solution: After the soybean seedlings cultured above were inoculated with rhizobia, 30-80 ml of sakura extract aqueous solution and naringenin aqueous solution (control) were watered at the roots instead of tap water. The treatment was repeated twice, with an interval of 2-3 days between the two treatments, and then tap water was resumed.

[0026] 5. Counting the number of nodules: Dig out the soybeans 3 weeks after inoculation with rhizobia, clean the vermiculite from the roots, and count the number of nodules. Figure 1 .

[0027] Example 2: Construction of transgenic soybean overexpressing 35Spro::OsNOMT-GFP

[0028] 1. Construction of transgenic vector and Agrobacterium

[0029] The primers for whole gene amplification were designed using the NCBI primer design tool, with the CDS sequence of rice (Oryza sativa v7.0) in Phytozome (https: / / phytozome-next.jgi.doe.gov / ) as a reference. The cDNA of rice leaves was used as a template (the extraction method of cDNA was conventional, for example, refer to CN 104561025 A), specific primers were designed, and the OsNOMT fragment was amplified using Biorun Pfu PCR Mix high-fidelity enzyme PCR. The primer sequences are: OsNOMT-F: AACACGGGGACTTTGCAACATGGGAGACATGGTGAGCCCG OsNOMT-R: TGAAGACAGGCTAGTTACATTACTTGTACAGCTCGTCCATGCCG

[0030] The obtained nucleotide sequence of the gene OsNOMT is shown in SEQ ID NO:1; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:2.

[0031] PCR amplification reaction system: Biorun Pfu PCRMix 25ul, ddH2O 20ul, cDNA 1ul, upstream and downstream primers 2ul each, a total of 50ul. The PCR reaction program is: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds, 50℃ annealing for 45 seconds, 72℃ extension for 113 seconds, 30 cycles; finally 72℃ final extension for 10 minutes, the obtained PCR product was identified by 1% agarose gel electrophoresis, and then the amplified band was recovered and purified, and the recovered product was constructed into the pBWA(V)BS-ZY1-GFP2 vector, and the above recombinant plasmid was transformed into Escherichia coli, coated with Kan resistance plates, cultured at 37℃ for 12 hours, and identified by plaque PCR.

[0032] Pick 10 plaques and perform 1.5ml EP tube inoculation and PCR identification at the same time. The primer sequences are:

[0033] HS-35seq: TTCATTTGGAGAGAACACGGGGGAC

[0034] M55820:CGAAGCCGCGGAAGAATTG

[0035] PCR amplification reaction system: Biorun Magic PCR Mix 12.5ul, ddH2O 9.5ul, template 1ul, upstream and downstream primers (HS-35seq / M55820) 1ul each, a total of 25ul. The PCR reaction program is: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds, 50℃ annealing for 45 seconds, 72℃ extension for 113 seconds, 30 cycles; finally 72℃ final extension for 10 minutes. The target band is a fragment of about 662bp. Take the bacterial solution corresponding to 1-3 positive bands, take 100uL for sample sequencing, and inoculate the remaining 400uL of bacterial solution into 5-10mlKan resistance LB, shake the test tube, and after the sequencing results come out, take a tube corresponding to the correct sequencing to extract the plasmid, that is, 35Spro::OsNOMT-GFP.

[0036] Take 1 μL of plasmid and add it to 50 μL EHA105 Agrobacterium competent cells, mix thoroughly and then transfer to an electroporation cup. After electroporation, add 1 mL of LB liquid culture medium, mix thoroughly and then transfer to a 1.5 mL centrifuge tube. Incubate in a shaker at 30°C and 180 rpm for 30 min. Pipette 50 μL of the activated Agrobacterium liquid and inoculate it on LB solid culture medium. Incubate in the dark at 30°C for 48 h to obtain Agrobacterium carrying the target gene plasmid.

[0037] 2. Soybean Genetic Transformation

[0038] 2.1 Induction

[0039] 2.1.1. Select healthy and mature soybean seeds and sterilize them using chlorine disinfection method (100 ml sodium hypochlorite (8% effective concentration) added to 5 ml concentrated hydrochloric acid) for 16-20 hours. This experimental process is carried out in a fume hood. After sterilization, blow the seeds for 24 hours in a clean bench to disperse the residual chlorine, seal the petri dish containing the sterilized soybeans, and store them at 4°C for later use.

[0040] 2.1.2. Pre-culture: Inoculate the sterilized seeds with the hilum facing downward on the germination medium, place in a 25°C incubator, and culture in the dark for 1 day.

[0041] 2.2 Preparation of Agrobacterium tumefaciens culture solution

[0042] Agrobacterium carrying the target gene plasmid was spread on LB medium (Tryptone 10g / L, Yeast extract 5g / L, Sodium chloride 10g / L) for initial activation. After 48h of culture, the cells were collected and activated again on new medium. After 24h of culture, the cells were collected in the infection solution, vortexed and mixed, and the bacterial solution OD = 0.5 was adjusted by spectrophotometer for use.

[0043] 2.3 Construction of transgenic soybean by Agrobacterium infection

[0044] The Agrobacterium carrying the target gene plasmid was delivered to Wuhan Boyuan Company for transgenic soybean construction, and transgenic soybeans overexpressing 35Spro::OsNOMT-GFP were obtained. Specifically:

[0045] 2.3.1 Scratch the germinated soybeans in step 2.1, and then add the bacterial solution prepared in step 2.2 to complete the infection. Discard the infection solution, and then spread the explants on the co-cultivation medium lined with filter paper, and co-cultivate at 25°C in the dark for 3-5 days.

[0046] 2.3.2 Recovery culture

[0047] After co-cultivation, select the explants that grow well and are not contaminated, cut off the end of the embryonic axis, insert them into the recovery solid culture medium, and resume culture for 7-10 days.

[0048] 2.3.3 Screening and culture

[0049] The explants with clustered shoots after recovery culture were inoculated onto screening medium and cultured under 16h / 8h light / darkness for 21 days.

[0050] 2.3.4 Elongation culture

[0051] The well-growing clustered shoots after screening were transferred to new elongation medium and cultured under 16h / 8h light / dark conditions for 21 days.

[0052] 2.3.5 Rooting culture

[0053] When the shoots grow to about 5 cm, they are transferred to rooting medium for further screening. They are cultured under 16h / 8h light / dark conditions for 21 days.

[0054] 2.3.6 Positive seedling detection

[0055] The Bar test paper method is used to directly identify the presence of bar / pat protein in transgenic plants.

[0056] 2.3.7 Hardening of seedlings

[0057] The positive seedlings detected by the Bar test paper were removed from the culture medium, the culture medium attached to the roots of the seedlings was washed clean, and the seedlings were transferred to the seedling tray filled with nutrient soil.

[0058] The seedlings were cultured at 27°C with 16h / 8h light / darkness and hardened for 3 to 4 weeks to obtain transgenic soybeans overexpressing 35Spro::OsNOMT-GFP.

[0059] Example 3: Detection of sakurain content in soybean after overexpression of 35Spro::OsNOMT-GFP

[0060] 1. Prepare sakura extract: ethanol: water: acetonitrile: acetic acid = 79: 13.99: 7: 0.01 (volume ratio).

[0061] 2. Extraction of sakura glycosides: Accurately weigh the root powder of wild-type soybean (WT) and two strains (NOMT-OE-1 and NOMT-OE-3) of transgenic soybeans overexpressing 35Spro::OsNOMT-GFP selected from Example 2, add 2 ml of extract, shake vigorously and incubate at 4°C (20 rpm) for 24 h. Centrifuge at 4°C, 16000g for 15 min, collect the supernatant in a new centrifuge tube, centrifuge again at 4°C, 16000g for 15 min, and collect the supernatant. Detect sakura glycosides by LC-MS / MS method.

[0062] 3. Preparation of standard: Weigh 28.63 mg of sakura glycoside standard, dissolve it in 1 ml of sakura glycoside extract, and prepare a 10 mg / ml stock solution. Dilute it in a gradient to prepare a gradient of 100, 25, 6.25, 1.56, 0.39, 0.09 ng / ml, which is used to make a labeling curve to calculate the sakura glycoside concentration of the sample.

[0063] like Figure 2 As shown in Figure 2, the signal intensity of NOMT-OE-1 and NOMT-OE-3 was significantly higher than that of the WT control. The annotated curve for calculating the concentration of sakura chlorophyll was y=6981.15279x+49.09438(r 2 =0.99980).

[0064] 4. Chromatographic mass spectrometry acquisition conditions:

[0065] Using SCIEX ultra-high performance liquid phase triple quadrupole tandem mass spectrometer Triple Quad TM LC-MS / MS 5500+ system for acquisition, including Ultra Performance Liquid Chromatography UPLC, ExionLC TM AD) and triple quadrupole tandem mass spectrometry (Triple Quad TM LC-MS / MS 5500+).

[0066] Chromatographic column: ZORBAX Eclipse Plus C18 column (1.8 μm, 3.0 mm*100 mm; mobile phase A: ultrapure water (added with 0.01% formic acid, 2 mM ammonium formate); mobile phase B: methanol (added with 0.01% formic acid, 2 mM ammonium formate). Flow rate 0.4 mL / min, column temperature 40 °C, injection volume 1 μL. A 15 min gradient elution method was used, and the elution gradient settings are detailed in the following table:

[0067] Table 1: Liquid phase elution gradient

[0068] time Mobile phase composition (v / v) 0~1.0min 25％B 1.0~11.0min 25％B 11.0~13.0min 95％B 13.0~13.1min 95％B 13.1~15min 25％B

[0069] Mass spectrometry conditions: Data were collected using software Analyst 1.7.1. The ion source was an electrospray ionization source (ESI); the detection method was multiple reaction monitoring (MRM); the spray voltage (IS) was -4500 V in negative ion mode; the ion source temperature (TEM) was 500 °C; the nebulizer gas (Ion Source Gas1, Gas1) pressure was 50 psi; the auxiliary gas (Ion Source Gas2, Gas2) pressure was 55 psi; the curtain gas (CUR) pressure was 35 psi. The collision gas (CAD) was 8. According to the optimized declustering potential (DP) and collision energy (CE), the ion pairs were scanned and detected.

[0070] like Figure 2 The content of sakurain in soybeans overexpressing 35Spro::OsNOMT-GFP was 3-9 times that of the control group, which was significantly induced. These results indicate that overexpression of 35Spro::OsNOMT-GFP can promote the synthesis of sakurain.

[0071] Example 4: Soybean overexpressing 35Spro::OsNOMT-GFP inoculated with rhizobia

[0072] 1. Soybean cultivation: Wild-type seeds Williams82 and transgenic soybean lines NOMT-OE-1 and NOMT-OE-3 overexpressing 35Spro::OsNOMT-GFP were buried 2 cm under moist vermiculite and placed in a 28°C constant temperature incubator for 3 days. Water the vermiculite every day to keep it moist until the soybeans emerge. The germinated soybeans were transferred to new vermiculite, one plant per pot, and kept in a greenhouse (daytime: 30°C, light intensity 160μE / m 2 s, 16h; night: 25℃, light intensity 0μE / m 2 s, 8h) and set aside.

[0073] 2. Rhizobium inoculation: OD after overnight culture of soybean rhizobium (Bradyrhizobium japonicum USDA110) 600 Adjust to about 0.02-0.08, 1-3 ml per soybean plant. Water once every 2-3 days with tap water, once a day, and use 30-80 ml to keep the soil moist.

[0074] 3. Counting the number of nodules: Dig out the soybeans 2 weeks after inoculation with rhizobia, clean the vermiculite from the roots, and count the number of nodules. Figure 3 The average number of root nodules per plant of the wild-type soybean was 10, while the average number of root nodules per plant of the two soybean lines overexpressing 35Spro::OsNOMT-GFP, NOMT-OE-1 and NOMT-OE-3, were 15 and 19, respectively, which were significantly different from the wild type.

[0075] The above embodiments are not limitations of the present invention, and the present invention is not limited to the above embodiments. As long as the requirements of the present invention are met, they belong to the protection scope of the present invention.

Claims

1. Application of sakura extract in promoting nodulation of leguminous plants.

2. The use according to claim 1, characterized in that By increasing the content of sakura glycosides, the nodulation of leguminous plants can be promoted.

3. The use according to claim 2, characterized in that The content of sakura chlorophyll is regulated by the gene OsNOMT, and the gene OsNOMT has a nucleotide sequence shown in SEQ ID NO:

1.

4. The application of sakura extract in reducing the dependence of leguminous plants on chemical fertilizers.

5. The use according to claim 4, characterized in that By increasing the content of sakura glycosides, the nodulation of leguminous plants can be promoted.

6. The use according to claim 5, characterized in that The content of sakura chlorophyll is regulated by the gene OsNOMT, and the gene OsNOMT has a nucleotide sequence shown in SEQ ID NO:

1.

7. A method for constructing a transgenic leguminous plant, characterized in that The wild-type legume plant was constructed by cloning the OsNOMT gene and using transgenic technology.

8. A method for increasing the number of leguminous plant nodules, characterized in that Specifically, the method is to irrigate the soil around the roots of leguminous plants with a solution of sakura extract.

9. The method according to claim 8, characterized in that The legumes are 3-4 week old seedlings.

10. The method according to claim 8, characterized in that The concentration of the sakura extract aqueous solution is 10-30 μM; the irrigation cycle is once every 2-3 days, and the dosage is 30-80 ml.

Images