Application of pediococcus acidilactici

Abstract

The invention relates to the technical field of microorganisms, in particular to application of pediococcus acidilactici. The pediococcus acidilactici TG005 is preserved in the China Center for Type Culture Collection on June 24, 2024, the preservation number is CCTCC NO: M 20241349, and the preservation address is Wuhan University, Wuhan, China. The pediococcus acidilactici TG005 provided by the invention is a multifunctional probiotic strain, is obtained by screening from domestic healthy human excrement samples, and has good application safety and functional adaptability; the strain can reduce the cholesterol level and prevent cardiovascular diseases; uric acid precursor substances are degraded, uric acid generation is reduced, and hyperuricemia and related diseases are prevented; pathogenic bacteria with fusobacterium nucleatum and bacteroides fragilis can be inhibited, and colorectal cancer is prevented; when being used as a probiotic additive for preparing medicines for degrading cholesterol, preventing cardiovascular diseases caused by high cholesterol, preventing hyperuricemia, colorectal cancer and the like, the lactobacillus plantarum has a wide application prospect.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to the application of a strain of Pediococcus acidilactici. Background Art

[0002] With the changes in modern lifestyle and the adjustment of dietary structure, cardiovascular disease has become one of the leading causes of death worldwide and is generally considered a type of metabolic disease. Hypercholesterolemia is widely recognized as one of the main risk factors for cardiovascular disease. The accumulation of excess cholesterol in the liver is not only closely related to the development of non-alcoholic fatty liver disease, but also plays a key role in its evolution to non-alcoholic fatty liver disease. In recent years, more and more evidence has shown that the accumulation of excess cholesterol is also closely related to the occurrence of various diseases such as diabetes, Alzheimer's disease, and hypothyroidism. Therefore, controlling serum cholesterol levels is of great significance in reducing the incidence of related diseases.

[0003] As a heterocyclic organic compound, the production of uric acid involves multiple metabolic pathways. First, adenosine monophosphate (AMP) can be converted into inosine through two mechanisms: on the one hand, AMP removes the amino group by deaminase to form inosine monophosphate (IMP), and then dephosphorylates by nucleotidase to form inosine; on the other hand, AMP can remove the phosphate group by nucleotidase to form adenosine, and then convert it into inosine through deamination reaction. Guanine phosphate is converted into guanosine under the action of nucleotidase; next, inosine and guanosine are converted into hypoxanthine and guanine respectively by purine nucleoside phosphorylase. Hypoxanthine is oxidized to xanthine by xanthine oxidase, while guanine is formed into xanthine by the action of guanine deaminase. Finally, xanthine is further oxidized to uric acid by xanthine oxidase. When the blood uric acid level is higher than the normal reference range, hyperuricemia (HUA) can be diagnosed. Hyperuricemia has long been closely associated with gout, and may be associated with the occurrence of coronary heart disease, hypertension, stroke, metabolic syndrome and other diseases.

[0004] Colorectal cancer (CRC) is one of the most common and deadly tumors in the world, and its occurrence is closely related to genetics, environment, and lifestyle. Previous studies have shown that the intestinal microbiome may play a key role in the occurrence of colorectal tumors. Compared with healthy individuals, enterotoxigenic Bacteroides fragilis (ETBF) and Fusobacterium nucleatum are significantly enriched in the colonic mucosa of patients with colorectal cancer. These bacteria may act as drivers of disease occurrence, colonize or infect cancer tissues and promote disease progression. Therefore, in vitro screening of probiotics that can antagonize Fusobacterium nucleatum and enterotoxigenic Bacteroides fragilis will provide new ideas for the effective prevention and treatment of colorectal cancer.

[0005] At present, drugs used clinically to treat cholesterol, such as statins, may induce diabetes, cause muscle damage and lead to kidney damage, and some patients have poor tolerance to statins. The use of statins is associated with an increased risk of cancer; drugs used to lower uric acid, such as allopurinol, febuxostat, and benzbromarone, may cause damage to the kidneys and liver; traditional treatments for colorectal cancer are expensive, lack advanced treatment methods, and have large side effects: for advanced colorectal cancer, radiotherapy and chemotherapy are commonly used treatments, but these methods can bring serious side effects, such as vomiting, immunosuppression, and drug resistance. Although there are also probiotic products on the market to treat the above diseases, most of them are single-functional strains and cannot provide multiple effects of lowering cholesterol, degrading uric acid precursors, and inhibiting key pathogenic bacteria of colorectal cancer at the same time. Therefore, it is of great significance to develop a multifunctional probiotic strain. Summary of the invention

[0006] In view of the shortcomings of the prior art, the present invention provides an application of a strain of Pediococcus acidilactici. The Pediococcus acidilactici can not only reduce cholesterol levels, effectively degrade uric acid precursors, reduce uric acid production, and prevent hyperuricemia and related diseases, but also inhibit pathogenic bacteria and prevent colorectal cancer, and is a multifunctional probiotic strain.

[0007] To achieve the above object, the present invention provides the following technical solutions: The lactic acid bacteria of the present invention are TG005 ( Pediococcus acidilactici TG005), and deposited in China Center for Type Culture Collection on June 24, 2024, with the deposit number CCTCC NO:M 20241349, and the deposit address is Wuhan University, Wuhan, China. The lactic acid Pediococcus was screened from healthy human fecal samples. The deposit certificate and survival certificate can be found in the Chinese patent publication number CN118909861A.

[0008] The first aspect of the present invention provides the use of the Pediococcus acidilactici strain in the preparation of cholesterol-degrading drugs.

[0009] The second aspect of the present invention provides the use of the Pediococcus acidilactici strain in the preparation of drugs for cardiovascular diseases caused by high cholesterol.

[0010] The third aspect of the present invention provides the use of the strain of Pediococcus acidilactici in the preparation of a uric acid-degrading drug. Specifically, the degradation of uric acid is mainly reflected in the degradation of adenosine, inosine and guanosine.

[0011] The fourth aspect of the present invention provides use of the strain of Pediococcus acidilactici in preparing medicines for hyperuricemia and related diseases.

[0012] The fifth aspect of the present invention provides the use of the strain of Pediococcus acidilactici in inhibiting Fusobacterium nucleatum and enterotoxigenic Bacteroides fragilis.

[0013] The sixth aspect of the present invention provides the use of the strain of Pediococcus acidilactici in the preparation of a drug for preventing and treating colorectal cancer.

[0014] Beneficial effects of the present invention: The lactic acid Pediococcus of the present invention is a multifunctional probiotic strain, which is screened from domestic healthy human fecal samples and has good application safety and functional adaptability; the strain can not only reduce cholesterol levels and prevent cardiovascular diseases; it can also degrade uric acid precursors, reduce uric acid production, and prevent hyperuricemia and related diseases; it can also inhibit pathogenic bacteria such as Fusobacterium nucleatum and Bacteroides fragilis, and prevent colorectal cancer. The lactic acid Pediococcus can be made into medicine to effectively prevent or treat the above diseases, and can provide an effective comprehensive health solution for clinical medicine. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is a streaking morphology diagram of the plate of Pediococcus acidilactici TG005 in Example 1 of the present invention; Figure 2 This is a graph showing the Gram staining result of Pediococcus acidilactici TG005 in Example 1 of the present invention; Figure 3 This is a standard curve diagram of cholesterol in Example 2 of the present invention; Figure 4 The chromatogram of inosine and adenosine in Example 3 of the present invention; Figure 5 The guanosine chromatogram in Example 3 of the present invention; Figure 6 This is a physical picture of the inhibition zone of Pediococcus acidilactici against Fusobacterium nucleatum in Example 4 of the present invention, wherein a is Pediococcus acidilactici TG005, b is Pediococcus acidilactici NGRI 0510Q, c is a negative control, and d is a positive control; Figure 7 This is a physical picture of the inhibition zone of Pediococcus acidilactici against Bacteroides fragilis in Example 4 of the present invention, wherein e is Pediococcus acidilactici TG005, f is Pediococcus acidilactici NGRI 0510Q, g is a negative control, and h is a positive control.

[0016] The present invention is further described below in conjunction with the accompanying drawings and embodiments. DETAILED DESCRIPTION

[0017] In order to better illustrate the technical scheme of the present invention, the scheme of the present invention will be explained below in conjunction with embodiments. It will be appreciated by those skilled in the art that the following embodiments are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. If specific techniques or conditions are not indicated in the embodiments, they are carried out according to the techniques described in the literature or reference books in this area or according to the product instructions. If the manufacturer is not indicated in the reagents or instruments used, they are all conventional products.

[0018] The above-mentioned technical features of the present invention and the technical features specifically described below (such as implementation cases) can be combined with each other to form a new or preferred technical solution.

[0019] MRS medium: casein digest 10.0 g / L, beef extract powder 10.0 g / L, yeast extract powder 4.0 g / L, ammonium citrate tribasic 2.0 g / L, sodium acetate 5.0 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.05 g / L, potassium hydrogen phosphate 2.0 g / L, glucose 20.0 g / L, Tween-80 1.08 g / L, agar 15.0 g / L, sodium selenite 100 µg / mL.

[0020] BHI medium: peptone 10.0 g / L, dehydrated calf brain extract powder 12.5 g / L, dehydrated buffalo heart extract powder 5.0 g / L, sodium chloride 5.0 g / L, glucose 2.0 g / L, disodium hydrogen phosphate 2.5 g / L.

[0021] MRS-THIO-OX-CHOL medium: casein digest 10.0 g / L, beef extract powder 10.0 g / L, yeast extract powder 4.0 g / L, ammonium citrate tribasic 2.0 g / L, sodium acetate 5.0 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.05 g / L, potassium hydrogen phosphate 2.0 g / L, glucose 20.0 g / L, Tween-80 1.08 g / L, ox bile salt 3 g / L, cholesterol solution 0.1 mg / mL.

[0022] Example 1: Screening of probiotics The Pediococcus acidilactici used Pediococcus acidilactici ) was screened from stool samples of healthy adults in China. The specific screening steps are as follows: After the human stool sample is appropriately diluted, the dilution is spread on MRS solid medium and placed in an anaerobic incubator at 37°C for culture. A single colony is picked for three rounds of streaking purification. Subsequently, the single colony is inoculated into MRS broth medium and cultured on a shaker at 37°C and 200 rpm for 24-48 hours.

[0023] Genomic DNA extraction: The genomic DNA of the strain was extracted using a bacterial genomic DNA rapid extraction kit. PCR amplification and sequence alignment: The extracted genomic DNA was used as a template and 16S rDNA full-length primer pair (27F: 5'AGAGTTTGATCCTGGCTCAG 3' (SEQ ID NO: 1); 1492R: 5'TACGGCTACCTTGTTACGACTT 3' (SEQ ID NO: 2)) was used for PCR amplification. The amplified product was sent for sequencing, and the 16S rDNA gene sequence was compared with the sequence alignment database (BLAST) of the National Center for Biotechnology Information (NCBI) of the United States. The comparison results showed that the strain was confirmed to be Pediococcus acidilactici ( Pediococcus acidilactici ). Its 16S rDNA sequence (SEQ ID NO:3) is as follows: The strain was compared with NCBI website BLAST, which showed that the strain belonged to Pediococcus acidilactici and was named Pediococcus acidilactici TG005 ( Pediococcus acidilactici TG005), and was deposited in China Center for Type Culture Collection on June 24, 2024, with the accession number: CCTCC NO:M 20241349, and the deposit address is Wuhan University Collection Center, Wuhan, China, and the classification name is Pediococcus acidilactici Pediococcus acidilactici The plate morphology of this strain is as follows Figure 1 The Gram staining results are shown in Figure 2 As shown. Gram staining showed that the strain was a positive bacterium, did not produce spores, had no flagella, and the scattered individual colonies were spherical.

[0024] strain Pediococcus acidilactici NGRI 0510Q was screened from stool samples of healthy adults in China.

[0025] Example 2: Evaluation of the cholesterol-lowering ability of Pediococcus acidilactici TG005 in vitro Take out Pediococcus acidilactici TG005 and Pediococcus acidilactici NGRI 0510Q from the -80℃ refrigerator, activate them by streaking on BHI agar plates with a disposable inoculation loop, and culture them in an anaerobic incubator at 37℃ until a single colony grows. Use a disposable inoculation loop to dip the single colony on BHI agar, inoculate it into BHI liquid culture medium, shake it evenly, and culture it in a shaking incubator at 37℃ and 200 rpm until OD 600 Reaching the range of 0.8-1.2.

[0026] Determination of cholesterol standard curve: Accurately weigh 0.1g of cholesterol powder and use n-hexane to prepare a 1 mg / mL solution. Then, pipette 0.02, 0.04, 0.06, 0.08, 0.1, 0.12, and 0.14 mL of the solution into colorimetric tubes, respectively, and blow dry with nitrogen in a 60°C water bath. Subsequently, add 4 mL of 0.5 mg / mL o-phthalaldehyde solution and 2 mL of 98% concentrated sulfuric acid, and allow the color reaction to develop for 20 minutes. Measure the absorbance at 553nm. Draw a standard curve with cholesterol content as the horizontal axis and absorbance as the vertical axis. The formula for the established standard curve is y = 4.0498x-0.0061, R 2 = 0.9954; Figure 3 As shown, the standard curve clearly demonstrates the linear relationship between cholesterol concentration and absorbance value.

[0027] Determination of cholesterol content in samples by o-phthalaldehyde method: Add the bacterial suspension of the strain to 10 mL of MRS-THIO-OX-CHOL medium at a 3% inoculum and culture at 37°C for 24 h. Take 1 mL of sample, add 3 mL of 95% ethanol and 2 mL of 50% (w / v) potassium hydroxide solution, and vortex thoroughly. Place the mixture in a 60°C constant temperature water bath for 10 min, add 5 mL of n-hexane after cooling, and vortex and extract for 1-2 min. Then, add 2 mL of distilled water, shake and mix, and let stand to separate. Take 2 mL of the upper n-hexane layer, blow dry with nitrogen in a 60°C water bath, add 4 mL of 0.5 mg / mL o-phthalaldehyde solution (made up to volume with glacial acetic acid) and 2 mL of concentrated sulfuric acid, color reaction for 20 min, and measure the absorbance at 553 nm. Finally, determine the cholesterol content in the fermentation broth according to the cholesterol standard curve and calculate according to the following formula:

[0028] Where: C is the cholesterol content in the supernatant before culturing the test strain; A is the cholesterol content in the supernatant after the test strain was cultured.

[0029] By comparing the cholesterol degradation ability of P. acidilactici NGRI 0510Q and TG005 (as shown in Table 1), it can be seen that P. acidilactici TG005 has the highest cholesterol reduction efficiency, reaching 42.23%, while the cholesterol clearance rate of P. acidilactici NGRI 0510Q is only 15.09%, indicating that P. acidilactici TG005 has a good cholesterol degradation ability.

[0030] Table 1 Cholesterol degradation ability of strains in vitro

[0031] Example 3: Evaluation of the ability of Pediococcus acidilactici TG005 to lower uric acid precursors in vitro Take out Pediococcus acidilactici TG005 and Pediococcus acidilactici NGRI 0510Q from the -80℃ refrigerator, activate them by streaking on BHI agar plates with a disposable inoculation loop, and culture them in an anaerobic incubator at 37℃ until a single colony grows. Use a disposable inoculation loop to dip the single colony on BHI agar, inoculate it into BHI liquid culture medium, shake it evenly, and culture it in a shaking incubator at 37℃ and 200 rpm until OD 600 When the concentration reaches the range of 0.8-1.2, it is inoculated into BHI liquid culture medium again, which is the second generation culture medium.

[0032] The culture fluid of the second generation of lactic acid Pediococcus TG005 and lactic acid Pediococcus NGRI 0510Q were centrifuged at 10000 r / min for 10 min, the supernatant was discarded and the cells were collected, and the cells were washed twice with PBS buffer, and then resuspended in PBS buffer, and 0.8 mL of the bacterial fluid was taken in three portions, and 0.8 mL of inosine-adenosine solution and guanosine solution were added respectively, and the inosine-adenosine solution and guanosine solution without bacteria were used as controls. After 6 hours of mixed culture on a shaking table at 37°C, the reaction solution was taken out and placed in an 85°C water bath for 20 min, the reaction was terminated and cooled to room temperature, centrifuged at 10000 r / min for 10 min, and the supernatant was collected. After passing through a 0.22 μm filter membrane, the content of inosine, adenosine, and guanosine was determined by liquid chromatography.

[0033] The following chromatographic conditions were set: chromatographic column: Waters C18 (4.6 mm × 250 mm); flow rate: 1.0 mL / min, detection wavelength: 254 nm; elution time: 40 min; column temperature: 40°C; injection volume: 10 μL; isocratic elution; mobile phase composition: potassium dihydrogen phosphate (pH=3.5): methanol = 100:1.

[0034] Under the above chromatographic conditions, the peaks are as follows Figure 4 and Figure 5 As shown, the retention time of guanosine is 13.573 min, the retention time of inosine is 12.636 min, and the retention time of adenosine is 24.431 min. The standard curve equations are: 肌苷 =2.27×10 4 X+1.06×10 4 , R 2 =0.999787; Y 腺苷 =3.05×10 4 X+5.88×10 4 , R 2 =0.999766; Y 鸟苷 =2.51×10 4 X-2.81×10 5 , R 2 =0.99943. Y: peak area; x: content (μg / mL).

[0035] Take the above supernatant and measure it by liquid chromatography. The result is as follows: Figure 4 and 5 As shown in the figure, the degradation rate of inosine, adenosine and guanosine by Pediococcus acidilactici TG005 was 100%, while Pediococcus acidilactici NGRI 0510Q could not completely degrade inosine, adenosine and guanosine, indicating that Pediococcus acidilactici TG005 has good ability to degrade inosine, adenosine and guanosine.

[0036] Example 4: Evaluation of the antibacterial ability of Pediococcus acidilactici TG005 against Fusobacterium nucleatum and Bacteroides fragilis Activation of pathogenic bacteria: Fusobacterium nucleatum (BNCC361670) and Bacteroides fragilis (BNCC336948) purchased from Beina Biotech were taken out from the -80℃ freezer, 10 μL of the frozen strains were inoculated into 10 mL of BHI liquid medium, and cultured in an anaerobic chamber at 37℃ for 24 h. The activated bacterial solution was inoculated into BHI solid medium and cultured at 37℃ for 48 h. During the experiment, a single colony was picked and placed in BHI liquid medium, cultured for 24 h until the logarithmic growth phase, and the bacterial suspension was diluted to OD 600 0.6-0.8 is reserved.

[0037] Probiotic activation: Take out Pediococcus acidilactici TG005 and NGRI 0510Q from the -80℃ refrigerator, use a disposable inoculation loop to streak on the BHI agar plate for activation, and culture in a 37℃ anaerobic incubator until a single colony grows. Dip a single colony and inoculate it in BHI liquid culture medium, shake it well, and culture it in a shaker at 37℃ and 200 rpm until the OD 600 Reach 0.8-1.2.

[0038] The BHI solid medium to be sterilized was cooled to 50°C and the pathogenic bacteria suspension (OD 600 0.6-0.8) was added to 25 mL of BHI solid medium at a ratio of 1% and mixed well. Use sterile tweezers to gently place the Oxford cup on the plate and pour in 25 mL of BHI solid medium. After cooling, take out the Oxford cup and add 200 μL of probiotic suspension (OD 600 The BHI medium was used as negative control and chloramphenicol as positive control. The plate was placed in a 37°C constant temperature anaerobic incubator for 24 hours. The size of the inhibition zone was measured with a vernier caliper using the cross method.

[0039] The Oxford cup method was used to determine the antibacterial effects of Pediococcus acidilactici TG005 and NGRI 0510Q on Fusobacterium nucleatum and Bacteroides fragilis. Figure 6-7 As shown in Table 2, the diameters of the inhibition zones of Pediococcus acidilactici TG005 against Fusobacterium nucleatum and Bacteroides fragilis were 14.5±0.5 mm and 18.25±0.25 mm, respectively, while the effect of Pediococcus acidilactici NGRI 0510Q was consistent with the negative control, with no antibacterial effect. This indicates that TG005 has a good antibacterial effect on Fusobacterium nucleatum and Bacteroides fragilis, the key pathogens of colon cancer.

[0040] Table 2 Antibacterial test results

[0041] In summary, the present invention screened out lactic acid Pediococcus acidilactici TG005 from healthy donors and verified it by in vitro test method, and found that it has strong cholesterol degradation ability, and the cholesterol clearance rate measured in vitro is 42.23%; it has strong degradation ability for uric acid precursors adenosine, inosine and guanosine, all of which can reach 100%; it has strong inhibitory ability against key pathogenic bacteria of colorectal cancer Fusobacterium nucleatum and Bacteroides fragilis, and the inhibition zones are 14.5±0.5 mm and 18.25±0.25 mm, respectively; the lactic acid Pediococcus acidilactici TG005 not only has good application safety and functional adaptability, but also can be used as a probiotic additive in the preparation of drugs for degrading cholesterol, preventing cardiovascular diseases caused by high cholesterol, preventing hyperuricemia and colorectal cancer, and has broad application prospects.

[0042] Finally, it should be emphasized that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various changes and modifications. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of a strain of Pediococcus acidilactici in the preparation of cholesterol-degrading drugs.

2. Application of a strain of Pediococcus acidilactici in the preparation of drugs for cardiovascular diseases caused by high cholesterol.

3. Application of a strain of Pediococcus acidilactici in the preparation of uric acid-degrading drugs.

4. Application of a strain of Pediococcus acidilactici in the preparation of drugs for hyperuricemia and related diseases.

5. Application of a strain of Pediococcus acidilactici in inhibiting Fusobacterium nucleatum and enterotoxigenic Bacteroides fragilis.

6. Use of a strain of Pediococcus acidilactici in the preparation of drugs for preventing and treating colorectal cancer.

7. The use according to any one of claims 1 to 6, characterized in that: The lactic acid bacteria is TG005 and was deposited in the China Center for Type Culture Collection on June 24, 2024, with a deposit number of CCTCC NO: M 20241349, and the deposit address is Wuhan University, Wuhan, China.

8. The use according to any one of claims 1 to 6, characterized in that: The Pediococcus acidilactici was screened from healthy human feces samples.

Images