Bifidobacterium pseudolongum and application thereof

Abstract

The invention belongs to the technical field of functional microorganism screening and application, and particularly discloses bifidobacterium pseudolongum and application thereof. The strain number of the Bifidobacterium pseudolongum provided by the invention is YBPL4, the YBPL4 strain is preserved in the China Center for Type Culture Collection, the preservation number is CCTCC M NO: 20241895, and the preservation date is September 2, 2024. The invention also discloses a preparation method of the Bifidobacterium pseudolongum, and the preparation method of the Bifidobacterium pseudolongum provided by the invention has the advantages that the strain number is YBPL4, and the YBPL4 strain is preserved in the China Center for Type Culture Collection (CCTCC); compared with the prior art, the bifidobacterium pseudolongum YBPL4 strain disclosed by the invention has the following unexpected technical effects that the bifidobacterium pseudolongum YBPL4 with high bile salt hydrolase activity disclosed by the invention simultaneously has multiple effects in an in-vivo experiment of a model mouse fed with high-fat feed, and the bifidobacterium pseudolongum YBPL4 strain can be used for preparing the bifidobacterium pseudolongum YBPL4 with high bile salt hydrolase activity. The probiotics have the effects of promoting growth of intestinal lactic acid bacteria, slowing down weight gain, reducing cholesterol and blood fat, improving the content of short-chain fatty acids such as acetic acid, propionic acid, butyric acid and valeric acid in intestinal tracts, remarkably improving abundance of lactobacillus and bifidobacteria, resisting inflammation, improving immunity and the like, and have great potential and practical value in the aspects of probiotic development and functional food application.

Description

Technical Field

[0001] The invention belongs to the technical field of functional microorganism screening and application, and specifically discloses a pseudo-Bifidobacterium longum and an application thereof. Background Art

[0002] Probiotics are a type of active microorganisms that are beneficial to the host when they reach a certain number. They usually have the effects of promoting intestinal health, increasing immunity, promoting nutrient absorption and regulating blood sugar. There are many types of probiotics, but new probiotic strains need to be continuously explored and utilized.

[0003] Bifidobacterium pseudolongum is a common Bifidobacterium microorganism in the intestines of humans and animals. In recent years, it has become a research hotspot due to its probiotic effects. In 2020, the journal Science reported that Bifidobacterium pseudolongum can enhance the response to immunotherapy by producing inosine. In 2023, Zhao Liping et al. reported that the NjM1 strain of Bifidobacterium pseudolongum resisted influenza A virus infection in wild-type mice. Chinese patent CN 101257910B involves the coccidioidomyces pseudolongum subspecies having a cholesterol-lowering effect, which can reduce the total cholesterol, triglycerides, VLDL and LDL cholesterol in the blood of experimental mice. Chinese patent CN 117701435A discloses a strain of Bifidobacterium pseudolongum RU224 that can restore the colon length of mice with DSS-induced intestinal inflammation, improve the integrity of the colon epithelial barrier, reduce the expression level of pro-inflammatory factor genes, and increase the expression of tight junction protein genes, and has a therapeutic effect on intestinal inflammation. Chinese patent CN 114854639B discloses a strain of Bifidobacterium pseudolongum CCFM1253 with an inosine production of 3.4 mg / mL, which can significantly alleviate the weight loss caused by colitis, significantly reduce the level of pro-inflammatory cytokines in the colon and increase the level of anti-inflammatory cells, etc., and has great application prospects in the preparation of products for the prevention and / or treatment of colitis.

[0004] The above patents mainly report that Pseudo-Bifidobacterium longum has certain effects, such as lowering cholesterol, lowering blood lipids, and anti-inflammatory, but there has been no report of Pseudo-Bifidobacterium longum having multiple effects at the same time; in addition, there is no clear experimental data to prove that the existing Pseudo-Bifidobacterium longum can regulate intestinal flora and promote the growth of lactic acid bacteria, such as promoting the growth of Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus johnsonii and Enterococcus faecalis.

[0005] Based on the above, the pseudo-longitudinal Bifidobacterium strain is a strain with the potential to be developed into a probiotic. Therefore, exploring the probiotic effects of the pseudo-longitudinal Bifidobacterium strain and developing probiotic products are the current research directions and hotspots in the microecological preparation industry. Summary of the invention

[0006] The purpose of the present invention is to provide a pseudo-Bifidobacterium longum and an application thereof in view of the deficiencies in the prior art.

[0007] The first object of the present invention is to provide a new strain of Bifidobacterium pseudolongum (Bifidobacteriumpseudolongum), strain numbered YBPL4, and the YBPL4 strain is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC M NO: 20241895 and a deposit date of September 2, 2024.

[0008] The YBPL4 strain was isolated from the intestine, and was finally identified as B. pseudolongum (B. pseudolongum) through colony morphology observation, Gram staining and 16S rDNA amplification of the strain genome, and sequencing and identification of the PCR product. The strain was named and numbered YBPL4.

[0009] The second object of the present invention is to provide a microbial preparation, which contains Bifidobacterium pseudolongum as described in the first aspect.

[0010] Preferably, the microbial preparation is any one or more of fermentation broth supernatant, fermentation broth precipitate and freeze-dried powder.

[0011] The active ingredient of the microbial preparation comprises Bifidobacterium pseudolongum YBPL4. In addition to Bifidobacterium pseudolongum YBPL4, the microbial preparation may further comprise auxiliary materials permitted in the field of microbial preparations.

[0012] The third object of the present invention is to provide the use of the pseudo-Bifidobacterium longum as described in the first aspect or the microbial preparation as described in the second aspect in the preparation of a product that promotes the growth of intestinal lactic acid bacteria, wherein the product is food, medicine, health product or feed.

[0013] Preferably, the lactic acid bacteria are Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus johnsonii and Enterococcus faecium.

[0014] The fourth object of the present invention is to provide the use of the pseudo-Bifidobacterium longum as described in the first aspect or the microbial preparation as described in the second aspect in the preparation of a product for slowing down weight gain, wherein the product is food, medicine, health product or feed.

[0015] Preferably, the slowing down of weight gain is slowing down weight gain caused by a high-cholesterol diet.

[0016] The fifth object of the present invention is to provide the use of the pseudo-Bifidobacterium longum as described in the first aspect or the microbial preparation as described in the second aspect in the preparation of cholesterol-lowering and blood lipid-lowering products, wherein the products are food, medicine, health care products or feed.

[0017] Preferably, the cholesterol-lowering and blood lipid-lowering methods include lowering serum total cholesterol (CHOL), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C).

[0018] The sixth object of the present invention is to provide the use of the pseudo-Bifidobacterium longum as described in the first aspect or the microbial preparation as described in the second aspect in the preparation of a product for regulating intestinal flora, wherein the product is food, medicine, health product or feed.

[0019] The seventh object of the present invention is to provide a use of the pseudo-Bifidobacterium longum as described in the first aspect or the microbial preparation as described in the second aspect in the preparation of an anti-inflammatory product, wherein the product is food, medicine, health product or feed.

[0020] Compared with the prior art, the pseudo-Bifidobacterium longum YBPL4 strain of the present invention has the following unexpected technical effects. The pseudo-Bifidobacterium longum YBPL4 with high bile salt hydrolase activity of the present invention has multiple effects in the in vivo experiment of model mice fed with high-fat diet, including promoting the growth of intestinal lactic acid bacteria such as Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus johnsonii, Enterococcus faecium, slowing down weight gain, lowering cholesterol and blood lipids, increasing the content of short-chain fatty acids such as intestinal acetic acid, propionic acid, butyric acid, valeric acid, etc., significantly increasing the abundance of Lactobacillus and Bifidobacterium, and anti-inflammatory and immunity-enhancing effects, and has great potential and practical value in the development of probiotics and the application of functional foods. Specifically:

[0021] 1) From the results of Example 1, it can be seen that the YBPL4 strain of the present invention has a strong tolerance to bile salts, can simultaneously degrade four bile salts, namely sodium taurocholate, sodium glycocholate, sodium taurodeoxycholate and sodium glycodeoxycholate, and has a very high bile salt hydrolase activity.

[0022] 2) The results of Example 2 show that the fermentation supernatants of the existing animal Bifidobacterium CICC 21715, Bifidobacterium longum CICC 6208, and Bifidobacterium longum CICC 6212 have no promoting effect on the growth of all tested lactic acid bacteria strains, while the fermentation supernatant of the YBPL4 of the present invention has a dominant promoting effect on the growth of the tested Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus johnsonii, and Enterococcus faecium, which has an unexpected technical effect compared to the prior art.

[0023] 3) The results of the high cholesterol mice weight test in Example 3 show that the pseudo-Bifidobacterium longum YBPL4 of the present invention can effectively slow down the weight gain of experimental mice fed with a high-fat diet.

[0024] 4) From the results of lipid metabolism in hypercholesterolemia mice in Example 3, it can be seen that the pseudo-Bifidobacterium longum YBPL4 of the present invention can significantly inhibit the intestinal absorption of cholesterol and promote the secretion of cholesterol in bile, thereby having the effect of lowering cholesterol and blood lipids.

[0025] 5) From the results of Example 3, it can be seen that the pseudo-Bifidobacterium longum YBPL4 of the present invention can increase the content of short-chain fatty acids such as intestinal acetic acid, propionic acid, butyric acid, and valeric acid, significantly increase the abundance of Lactobacillus and Bifidobacterium, regulate intestinal flora, and promote intestinal health.

[0026] 6) From the results of Example 3, it can be seen that the pseudo-Bifidobacterium longum YBPL4 of the present invention can reduce the expression of pro-inflammatory factors in experimental mice fed with a high-fat diet, increase the expression of anti-inflammatory factors, and improve immunity.

[0027] The deposit information of the microorganism involved in the present invention is as follows:

[0028] Depository: China Center for Type Culture Collection (CCTCC);

[0029] Address of depository: Wuhan, China;

[0030] Classification and nomenclature: Bifidobacteriumpseudolongum YBPL4;

[0031] Deposit number: CCTCC NO: M 20241895;

[0032] Deposit date: September 2, 2024; BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 HPLC spectra of four bile salt (GCA, TCA, GDCA, TDCA) standards.

[0034] Figure 2 The effect of adding YBPL4 fermentation broth on the growth of different lactic acid bacteria. Among them, (A) is the growth curve of Lactobacillus rhamnosus; (B) is the growth curve of Lactobacillus johnsonii; (C) is the growth curve of Lactobacillus plantarum; (D) is the growth curve of Enterococcus faecium.

[0035] Figure 3 YBPL4 intervenes in body weight changes in hypercholesterolemia mice.

[0036] Figure 4The changes in serum cholesterol indexes of YBPL4-treated hypercholesterolemia mice, including (A) the changes in total cholesterol (CHOL) content; (B) the changes in triglyceride (TG) content; (C) the changes in high-density lipoprotein cholesterol (HDL-C) content; (D) the changes in low-density lipoprotein cholesterol (LDL-C) content.

[0037] Figure 5 Transcriptional analysis of genes related to cholesterol metabolism in the liver of hypercholesterolemic mice induced by YBPL4 intervention.

[0038] Figure 6 These are the results of YBPL4 intervention in the changes of intestinal flora in hypercholesterolemia mice. DETAILED DESCRIPTION

[0039] The present invention is further described below in conjunction with the examples, which are provided for better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified.

[0040] The test strains used in the present invention include Lactobacillus plantarum CICC 20346, Lactobacillus rhamnosus CICC 21769, Lactobacillus johnsonii CICC 10862, Lactobacillus fermentans CICC 24209, Lactococcus lactis CICC 23610, Enterococcus faecium CICC20432, Enterococcus faecalis CICC 23213, Bifidobacterium animalis CICC 21715, Bifidobacterium longum CICC 6208, and Bifidobacterium longum CICC 6212. All of them were purchased from China Industrial Microbiological Culture Collection Administration Center (CICC).

[0041] The culture medium used in the present invention was purchased from Qingdao Haibo Biotechnology Co., Ltd. Other reagents, etc., can be obtained from commercial channels unless otherwise specified.

[0042] Example 1: Screening of YBPL4 strain with high bile salt hydrolase (BSH) activity

[0043] (1) Screening

[0044] Using healthy experimental mouse feces as samples, 50 mg of the sample was weighed and added to 450 μL of sterile saline for gradient dilution. -5 , 10 -6The dilution was spread on a modified MRS solid medium containing 0.3% sodium taurodeoxycholate, mupirocin lithium salt and cysteine ​​salt solution, and cultured at 37°C in an anaerobic environment for 48 hours. The plate with good growth was taken out of the incubator, and a colony with an obvious bile salt hydrolysis circle was observed. The colony was selected and streaked and purified on a modified MRS plate of mupirocin lithium salt and cysteine ​​salt solution, and cultured at 37°C in an anaerobic environment for 48 hours. A single colony was picked up and inoculated into a modified MRS liquid medium of mupirocin lithium salt and cysteine ​​salt solution for culture, and the bacterial solution was obtained and preserved.

[0045] The preserved strain was activated and streaked on a modified MRS solid medium containing 0.3% taurodeoxycholate mupirocin lithium salt and cysteine ​​salt solution to confirm the bile salt hydrolysis of the strain. A very obvious hydrolysis circle was observed on the plate for the strain, indicating that it had high bile salt hydrolase activity.

[0046] (2) Identification of bacterial species

[0047] The morphological characteristics of the strain were observed with the naked eye, showing smooth, round, milky white, translucent shape, with a diameter of 1 to 2 mm, which is consistent with the characteristics of bifidobacterium colonies. The suspected colonies on the cultured solid medium were picked for Gram staining, and the Gram staining results were positive bacteria, showing a curved, rod-shaped short rod shape. The genome of the strain obtained by extraction and screening was amplified for 16S rDNA, and the PCR product was obtained for sequencing (Qingke Bioengineering Co., Ltd.). The obtained sequence was compared with the nucleic acid sequence in NCBI-Blast, and it was finally determined to be B. pseudolongum (B. pseudolongum), named and numbered YBPL4.

[0048] The obtained sequence is as follows (SEQ ID NO: 1 in the sequence list):

[0049] AGGGGCGTCTCGCAGCTCGCCGGCGGTGGCCGTCATCAAGGTGGGCGCCGCGACCGAGGTCGAGGCCAAGGAACGCAAGCACCGCATCGAAGACGCCGTGCGCAACGCAAGGCTGCCATCGAAGAAGGCCTTGTGCCCGGCGGTGGTGTGGCGCTCGTGCAGGCCGCTGCCAAGGCGGAGAAGGACGTCAACCTCGAGGGCGACGAGGCCACT GGTGCCGCGATCGTCTTCGGTGGCATCGAAGCCCCGCTCAAGCAGATTGCCAACAACGCCGGCCTCTCGGGCGACGTGGTGCTCGACAAGGTGCTTTCGCTGCCTGAAGGCGAAGGCTTCAACGCAGCCACCGACACCTACGAGAACCTCATGGCCGCCGGTGTGACCGACCCGGTGAAGGTGACCCGTTCCGCCCTGCAGAACGCCGCGTCCATC

[0050] (3) Study on the bile salt hydrolase activity of YBPL4

[0051] The YBPL4 strain was streaked and activated on a MRS solid medium modified with mupirocin lithium salt and cysteine ​​salt solution, and cultured anaerobically at 37°C for 48 hours; a single colony grown on the plate was picked and inoculated into 3 mL of MRS liquid medium modified with mupirocin lithium salt and cysteine ​​salt solution, and cultured anaerobically at 37°C overnight. Determine OD 600nm The seed solution was diluted to OD 600nm ≈0.1; then, after anaerobic culture at 37°C for about 5 h until OD600≈2.5, the bacterial solution was concentrated to OD600≈5. Centrifugation (12000×g, 4°C, 1 min) was performed and the supernatant was removed.

[0052] The bile salt hydrolase activity was preliminarily screened by the ninhydrin method, and the bacterial sludge was resuspended in 0.1M HAc-NaAc buffer to prepare a bacterial suspension. The bile salt hydrolase activity was detected by the ninhydrin method. In a 1.5mL centrifuge tube, 50μL of bacterial suspension and 50μL of 20mM substrate (sodium taurocholate TCA, sodium glycocholate GCA, glycodeoxycholic acid GDCA and taurodeoxycholic acid TDCA) were added, mixed, and placed in a 37℃ water bath for 1h; after the water bath, 100μL of 15% TCA stop solution was added to terminate the reaction, mixed and centrifuged; 100μL of supernatant was taken in a glass test tube, 900μL of ninhydrin solution was added, a rubber stopper was plugged, vortexed and mixed, and a boiling water bath was performed for 14min; after the boiling water bath, it was immediately placed in ice water for cooling, and OD570nm was measured after 5min.

[0053] The activity of bile salt hydrolase was screened by high performance liquid chromatography. The bacteria were washed and resuspended with 0.1M HAc-NaAc buffer. 50μL of bacterial suspension and 50μL of bile salt mixture were mixed and reacted in a 37℃ water bath for 1h. The control sample was mixed with 50μL HAc-NaAc buffer and 50μL bile salt mixture. After the reaction, an equal volume of TCA stop solution was added to terminate the reaction, and the mixture was mixed and centrifuged at 12000×g for 10min. The supernatant of the reaction solution was filtered through a 0.45μm nylon membrane and then measured. Agilent 1260 high performance liquid chromatography system was used, equipped with Agilent TC-18 C18 reverse phase column. The detector was a diode array detector, and the detection wavelength was set to 200nm. The sample injection volume was 20μL, the column temperature was 20℃, and the column flow rate was 1mL / min. Figure 1 HPLC spectra of four bile salt (TCA, GCA, TDCA and GDCA) standards under the above chromatographic detection conditions.

[0054] According to the results in Table 1, the YBPL4 strain can hydrolyze both GCA and TCA, indicating that YBPL4 has strong bile salt hydrolase activity.

[0055] Table 1 Hydrolysis ability of YBPL4 strain on bile salts

[0056]

[0057] (4) Study on bile salt tolerance of YBPL4

[0058] The activated YBPL4 strain was inoculated at 1% inoculation into the modified MRS liquid medium containing 0.1%, 0.2%, and 0.3% ox bile salts of mupirocin lithium salt and cysteine ​​salt solution, and cultured anaerobically at 37°C for 5 hours, and the number of viable bacteria was determined by gradient dilution plate method. The results are shown in Table 2. YBPL4 has a certain tolerance to bile salts and can survive at a bile salt concentration of 0.1%, with a survival rate of more than 97%.

[0059] Table 2 Tolerance of YBPL4 to bile salts

[0060]

[0061] Example 2: Growth promotion effect of YBPL4 strain on various lactic acid bacteria

[0062] (1) Preparation of culture medium containing bifidobacterium fermentation supernatant

[0063] Bifidobacterium pseudolongum YBPL4, Bifidobacterium animalis CICC 21715, Bifidobacterium longum CICC 6208, and Bifidobacterium longum CICC 6212 were streaked and activated on a mupirocin lithium salt and cysteine ​​salt solution modified MRS solid medium, and cultured anaerobically at 37°C for 48 hours; a single colony grown on the plate was picked and inoculated into 3 mL of a mupirocin lithium salt and cysteine ​​salt solution modified MRS liquid medium, and cultured anaerobically at 37°C for 16 hours; the colonies were transferred to the same MRS liquid medium at a 1% inoculum amount and cultured for 8 hours respectively, and then the fermentation supernatant was collected by centrifugation (12000×g, 4°C, 1 min); 100 μL of each of the supernatants of the above four different bifidobacterium fermentation broths was mixed with 900 μL of 10×MRS to prepare an experimental group culture medium containing bifidobacterium fermentation supernatant, and 1×MRS culture medium was used as a control group culture medium.

[0064] (2) Effect of Bifidobacterium fermentation supernatant on the growth of different lactic acid bacteria

[0065] Plant lactobacillus CICC 20346, Lactobacillus rhamnosus CICC 21769, Lactobacillus johnsonii CICC10862, Lactobacillus fermentans CICC 24209, Lactococcus lactis CICC 23610, Enterococcus faecium CICC 20432 and Enterococcus faecalis CICC 23213 were streaked on MRS solid medium for activation and cultured at 37°C for 48h; single colonies grown on the plate were picked and inoculated into 3mL MRS liquid medium, and cultured at 37°C for 16h to prepare seed liquid. The seed liquid was added to the experimental group culture medium containing bifidobacterium fermentation liquid at an inoculation rate of 1%, and the MRS culture medium was used as the control group. After mixing, it was transferred to a sterile 96-well plate, 180μL per well, and cultured in a 37°C constant temperature incubator. At a certain interval, the OD of the bacterial liquid was accurately measured using a multifunctional microplate reader. 600nm The value was measured continuously for 24 hours.

[0066] The results are shown in Table 5 and Figure 2As shown, the fermentation supernatants of Bifidobacterium animalis CICC 21715, Bifidobacterium longum CICC 6208 and Bifidobacterium longum CICC 6212 had no promoting effect on the growth of all tested lactic acid bacteria strains, while the fermentation supernatant of YBPL4 of the present invention had a dominant promoting effect on the growth of tested Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus johnsonii and Enterococcus faecium.

[0067] Table 5 Effects of different bifidobacterium fermentation broths on the growth of lactic acid bacteria

[0068]

[0069] Note: "*" indicates that the fermentation supernatant of Bifidobacterium was added to the culture medium;

[0070] “++” indicates growth promotion; “+” indicates normal growth.

[0071] Example 3: Application of YBPL4 in hypercholesterolemia model mice

[0072] Animal model establishment: Animal experiments followed the guidelines of the Institutional Animal Care and Use Ethics Committee of Nanjing Normal University. Six-week-old SPF-grade male C57BL / 6 mice were placed under controlled environmental conditions (temperature 23°C, relative humidity 50%-60%, light / dark cycle 12 / 12h, free access to water and food during the experiment). The mice began to adapt 1 week before the experiment and were randomly divided into 3 groups, namely:

[0073] Control group: normal diet (ND)

[0074] Model group and experimental group: high cholesterol diet (HCD)

[0075] Mouse experimental animal feed was purchased from Jiangsu Collaborative Pharmaceutical Bioengineering Co., Ltd., ordinary feed item number 1010001; high cholesterol feed (1.25% cholesterol) item number XT108C.

[0076] Each group had 6 mice. They were free to eat and drink during the experiment. The mice were given oral administration, and each mouse in the experimental group was given 1×10 10 CFU / mL of Bifidobacterium pseudolongum YBPL4, the control group and the model group were given the same volume of sterile skim milk for a total of 6 weeks.

[0077] Experimental animal killing and sample preparation: Body weight was measured every week. After the 6-week animal experiment, mice were fasted for 12 hours but not deprived of water the day before killing. After taking fresh feces and blood, the mice were killed by dislocating the neck to take the remaining tissues. The specific operation method is as follows. 2-3 fresh feces were collected from the mouse anus and stored in a -80℃ ultra-low temperature refrigerator for later use; whole blood of the mouse was collected using the eyeball blood collection method and serum was separated and stored in a -80℃ ultra-low temperature refrigerator for later use; the liver, ileum and cecum were separated from the body and stored in a -80℃ ultra-low temperature refrigerator for later use. (1) Effect of YBPL4 on the body weight of hypercholesterolemia model mice

[0078] The results are as follows Figure 3 The results showed that after 6 weeks of high cholesterol diet feeding, the weight of mice in the model group increased significantly compared with the control group, while after intervention with Bifidobacterium pseudolongum YBPL4, the weight gain rate of the experimental group decreased significantly compared with the model group ( Figure 3 *** indicates p<0.001). This result indicates that the pseudo-Bifidobacterium longum YBPL4 of the present invention can slow down the increase of body weight after feeding with high cholesterol feed, and has the effect of controlling body weight.

[0079] (2) Effect of YBPL4 on lipid metabolism in hypercholesterolemia model mice

[0080] The effect of YBPL4 on fat metabolism in high-fat mice was studied from two aspects: serum biochemical indicators and intestinal cholesterol metabolism mRNA.

[0081] Take 10 μL of serum sample and use the blood biochemical analyzer of the Medical Experimental Animal Center of Nanjing Medical University to test the four biochemical indicators of mouse serum: total cholesterol (CHOL), high-density lipoprotein (HDL-C), low-density lipoprotein (LDL-C) and triglyceride (TG). Figure 4 The results showed that compared with the control group, the serum total cholesterol (CHOL), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) in the model group all showed an upward trend. Compared with the model group, the serum CHOL, TG, HDL-C and LDL-C levels in the YBPL4 experimental group all showed a significant downward trend ( Figure 4 In the figure, * indicates p<0.05, ** indicates p<0.01), indicating that YBPL4 has a significant cholesterol-lowering effect.

[0082] Total RNA from ileum and liver tissues was extracted using RNAiso Plus, and its concentration and purity were detected using a micro-UV spectrophotometer. RNA was converted into cDNA using a Takala kit, and quantitative qPCR was performed using the LightCycler System real-time system. The results were obtained using rpL32 mRNA as an internal reference. -△△CTThe relative gene expression was calculated, and the primer sequences are shown in Table 3. Figure 5 As shown in the figure, according to the analysis of cholesterol metabolism-related genes, compared with the control group, the transcription of ABCG5 / 8 and LDL-R in the model group mice was significantly reduced, and the transcription of HMGCR was significantly increased. Compared with the model group, the transcription of ABCG5 / 8 and LDL-R in the HCD+YBPL4 experimental group mice was significantly increased, and the transcription of HMGCR was significantly decreased ( Figure 5 In the table, * indicates p<0.05, ** indicates p<0.01, and *** indicates p<0.001). This indicates that the YBPL4 strain has the effect of inhibiting the absorption of cholesterol in the intestine and promoting the secretion of cholesterol in bile.

[0083] Table 3 Primer sequences used in this study

[0084]

[0085] (3) Effect of YBPL4 on intestinal flora of hypercholesterolemia model mice

[0086] Molecular microbiology methods were used to systematically study the microbial composition of the intestine, extract the microbial DNA of the cecum, amplify the bacterial 16SrDNA-V3, sequence it using the IlluminaNova Seq platform, and perform Metastats analysis to study the bacterial genera with significant differences between the groups. Figure 6 The metagenomic sequencing results showed that compared with the HCD group, the relative abundance of Lactiplantibacillus and Bifidobacterium in the YBPL4 experimental group increased significantly, indicating that the pseudo-Bifidobacterium longum YBPL4 of the present invention can regulate the intestinal flora.

[0087] The method for determining the content of cecal short-chain fatty acids is as follows: weigh about 70 mg of cecal sample and place it in a 2 mL EP tube, record the tube weight and wet weight, place it in a freeze dryer for freeze drying, and record the dry weight. Add 50 μL of saturated NaCl solution to the EP tube, shake until there is no obvious block, add 40 μL of 10% sulfuric acid to acidify and shake it with a vortex shaker for 30 seconds to mix. Add 1 mL of ether in the fume hood and shake it with a vortex shaker for 30 seconds, centrifuge (12000 rpm, 15 min, 4 ° C). After centrifugation, take the supernatant, add the supernatant to a 2 mL EP tube containing 0.25 g of anhydrous sodium sulfate, let it stand for 15 minutes, centrifuge it again under the same conditions, transfer the supernatant to a gas phase vial after centrifugation, and analyze it on the machine. Rtx-Wax column (30m×0.25μm×0.25μm) and mass spectrometer (GCMS-QP2010 Ultra system) were used to separate the short-chain fatty acids. Helium was used as the carrier gas, the flow rate was 2mL / min, the injection volume was 1μL, and the split ratio was 10:1. The initial column temperature was 100℃, which was increased to 140℃ at a heating rate of 7.5℃ / min, and then increased to 200℃ at a rate of 60℃ / min, and maintained at 200℃ for 3min. The injection temperature was 240℃ and the ionization temperature was 220℃. The full scan mode (mass-to-charge ratio scanning range 33-110) was used to detect the short-chain fatty acids, and the characteristic ions of each analyte standard were selected for quantitative analysis.

[0088] The results are shown in Table 4. Compared with the control group, the content of short-chain fatty acids such as valeric acid, propionic acid, butyric acid and acetic acid in the model group mice was reduced, while compared with the model group, the content of short-chain fatty acids such as valeric acid, propionic acid, butyric acid and acetic acid in the experimental group mice was significantly increased. This result also shows that Bifidobacterium pseudolongum YBPL4 has the effect of regulating intestinal flora.

[0089] Table 4 Effect of YBPL4 strain on the content of short-chain fatty acids in the cecum of mice

[0090]

[0091] (4) Effect of YBPL4 on the immune function of hypercholesterolemia model mice

[0092] The levels of serum TNF-α, IFN-γ, IL-1β, IL-4, IL-6 and IL-10 cytokines were determined using a kit (Nanjing Jiancheng Bioengineering Institute). The results are shown in Table 6. Compared with the control group, the levels of pro-inflammatory factors (TNF-α, IL-1β and IL-6) in the model group were relatively high, and the levels of anti-inflammatory factors (IL-4 and IL-10) were relatively low. Compared with the model group, the levels of pro-inflammatory factors (TNF-α, IL-1β and IL-6) in the experimental group were relatively low, and the levels of anti-inflammatory factors (IL-4 and IL-10) were relatively high, indicating that the YBPL4 strain can effectively reduce the pro-inflammatory factors, increase the anti-inflammatory factors and improve the immune performance of obese mice.

[0093] Table 6 Cytokine levels of TNF-α, IL-1β, IL-4, IL-6 and IL-10 in mouse serum

[0094]

[0095] The above are only embodiments of the present invention, and are not intended to limit the patent scope of the present invention. Any equivalent transformations made using the contents of the present invention specification, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. A pseudo-long Bifidobacterium (Bifidobacteriumpseudolongum), characterized in that The strain number is YBPL4. The YBPL4 strain is deposited in the China Center for Type Culture Collection, with the deposit number being CCTCC M NO: 20241895 and the deposit date being September 2, 2024.

2. A microbial preparation, characterized in that: The microbial preparation contains the Bifidobacterium pseudolongum as claimed in claim 1.

3. The microbial preparation according to claim 2, characterized in that The microbial preparation is any one or more of fermentation broth supernatant, fermentation broth precipitate and freeze-dried powder.

4. Use of the pseudo-Bifidobacterium longum as claimed in claim 1 or the microbial preparation as claimed in claim 2 in the preparation of a product that promotes the growth of intestinal lactic acid bacteria, wherein the product is a food, a medicine, a health product or a feed.

5. The use according to claim 4, characterized in that: The intestinal lactic acid bacteria are Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus johnsonii and Enterococcus faecium.

6. Use of the pseudo-Bifidobacterium longum as claimed in claim 1 or the microbial preparation as claimed in claim 2 in the preparation of a product for slowing down weight gain, wherein the product is food, medicine, health product or feed.

7. Use of the pseudo-Bifidobacterium longum as claimed in claim 1 or the microbial preparation as claimed in claim 2 in the preparation of a cholesterol-lowering and blood lipid-lowering product, wherein the product is a food, a medicine, a health product or a feed.

8. The use according to claim 7, characterized in that: The cholesterol-lowering and blood lipid-lowering methods include lowering serum total cholesterol CHOL, triglycerides TG, high-density lipoprotein cholesterol HDL-C and low-density lipoprotein cholesterol LDL-C.

9. Use of the pseudo-Bifidobacterium longum as claimed in claim 1 or the microbial preparation as claimed in claim 2 in the preparation of a product for regulating intestinal flora, characterized in that: The product is food, medicine, health product or feed.

10. Use of the pseudo-Bifidobacterium longum according to claim 1 or the microbial preparation according to claim 2 in the preparation of anti-inflammatory products, wherein the products are food, medicine, health products or feed.

Images