Engineering strain for dynamically regulating glucose metabolism to redirect 3-FL production and construction method thereof

Abstract

The invention relates to the technical field of biology, in particular to an engineering strain for dynamically regulating glucose metabolism to redirect 3-FL production and a construction method of the engineering strain. According to the invention, a gene-coded metabolic switch is adopted and is focused on dynamically regulating and controlling the level of phosphofructokinase (Pfk-I), so that the metabolic state is purposefully converted from a cell growth mode based on a wild strain metabolic pathway to a 3-FL production mode based on an escherichia coli anabolism pathway, and rewriting of a gene regulation network is realized; and the condition of converting the metabolic state from a cell growth mode to a production mode in the batch fermentation of the 3-FL is optimized, so that the production titer and yield of the 3-FL directly fermented from the glucose are improved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an engineering strain for dynamically regulating glucose metabolism to redirect 3-FL production and a construction method thereof. Background Art

[0002] Human milk oligosaccharides (HMO) are the third most abundant component in breast milk, with a content of 5-15 g / L, second only to lactose and lipids. In contrast, the concentration and variety of HMO in cow's milk are much lower. Fucosyloligosaccharides (FOs) are the main components of HMO, accounting for about 77% of HMO, mainly including 2'-fucosyllactose (2'-FL), 3-fucosyllactose (3-FL), lacto-N-fucopentose (LNFP), lacto-N-difucohexaose (LNDFH) and lacto-difucotetraose (LDFT). Among them, the most abundant fucosyllactoses (FLs) 2'-FL and 3-FL have a concentration of 0.5-2 g / L in breast milk. Since 2'-FL and 3-FL are believed to have health benefits for both adults and infants, FLs have received great attention as nutritional supplements and pharmaceutical ingredients.

[0003] At present, the production of 3-FL is mainly achieved through the cell factory method. 3-FL can be extracted from breast milk, but due to the limited source of breast milk, it is accompanied by high costs. The content of 3-FL extracted from the milk of other animals is low and is not suitable for large-scale production. The chemical and enzymatic synthesis of 3-FL is not industrially feasible because expensive substrates and intermediates are involved. The enzymatic synthesis of 3-FL requires the substrate 5'-diphosphate guanosine nucleoside-fucose (GDP-L-focose), which is more expensive than the final product. Therefore, engineered cell factories are the only economically viable way to produce 3-FL.

[0004] Various metabolic engineering strategies have been applied to the construction of cell factories producing 3-FL. Traditional metabolic engineering mainly focuses on the overexpression of the rate-limiting step fucosyltransferase (fucT, 1,3-fucosyltransferases), the strengthening of the precursor (GDP-L-focose) synthesis pathway, the deletion of the competing pathways UDP-glucose-1-phosphotransferase (wcaJ) and β-galactosidase (lacZ), and the balance of redox NADPH. Although these methods have been proven to be effective in improving cell productivity and yield, engineered strains often cannot dynamically control gene expression, which may lead to an unbalanced cellular metabolic network, thereby reducing productivity and yield. From the perspective of control theory, there is an urgent need to design powerful cells that can dynamically regulate pathway expression, regulate carbon flux between production units and cell growth units, balance the relationship between growth and production, and optimize production titer and yield ( Figure 1 ).

[0005] Fructose-6-phosphate (F6P) is an intermediate product of the glycolysis pathway and plays an important role in the growth of aerobic bacterial cells. It is also a precursor for the synthesis of GDP-L-focose. Since endogenous metabolism is strictly regulated to produce the desired metabolites for cell growth, the introduction of exogenous production pathways often leads to competition between cell growth and target chemical production, resulting in inefficient production of bio-based chemicals. Therefore, when the metabolic flux of the 3-FL production pathway is excessive, the number of cells producing 3-FL is reduced, resulting in a rather inefficient fermentation. So far, most of the work has been done from a static perspective to coordinate enzyme expression, optimize production titer and yield, including modifying plasmid copy number, promoter strength, ribosome binding sites, and combinations of these strategies.

[0006] In order to achieve efficient direct 3-FL fermentation from glucose, the conflict between cell growth and production must be resolved and a reasonable metabolic state for cell growth and production must be achieved. In the past few years, genetic and metabolic regulatory tools have been developed to potentially resolve the dilemma associated with cell growth and target chemical production. Some synthetic biosensors have been completed to improve the productivity and yield of microbial fermentation through metabolic flux control. Some genetic circuits are quite focused on cell growth and target conversion chemical production. For the fermentation of 3-FL, a new metabolic regulatory network needs to be rebuilt. Summary of the invention

[0007] In view of this, the engineered strain and construction method thereof for dynamically regulating glucose metabolism to redirect 3-FL production provided by the present invention retain the positive characteristics of the host bacteria in growth and glucose uptake, while dynamically regulating the flux of carbon metabolism between bacterial growth and product production.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The present invention provides a 1,3-fucosyltransferase having:

[0010] (1), the amino acid sequence shown in SEQ ID NO: 43; or

[0011] (2) an amino acid sequence obtained by substituting, deleting or adding one or more residues of the amino acid sequence shown in (1), and having the same or similar function as (1); or

[0012] (3) an amino acid sequence having at least 65% homology to the amino acid sequence shown in (1) or (2);

[0013] The plurality is 2 to 20.

[0014] The present invention also provides a nucleic acid molecule having a nucleotide sequence encoding the above 1,3-fucosyltransferase.

[0015] In some specific embodiments of the present invention, the nucleotide sequence encoding the 1,3-fucosyltransferase in the nucleic acid molecule comprises:

[0016] (4) the nucleotide sequence shown in SEQ ID NO: 44; or

[0017] (5) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as (4); or

[0018] (6) a nucleotide sequence having at least 65% homology to the nucleotide sequence shown in (4) or (5);

[0019] The plurality is 2 to 60.

[0020] The present invention also provides an expression vector, comprising the above nucleic acid molecule and an acceptable gene element.

[0021] In some specific embodiments of the present invention, the backbone of the above-mentioned expression vector includes pGEX-5X-2.

[0022] The present invention also provides an expression vector combination, comprising:

[0023] (I), an expression vector for knocking out wcaJ, an expression vector for knocking out lacZ, and the above expression vector; or

[0024] (II), an expression vector for knocking out wcaJ, an expression vector for knocking out lacZ, an expression vector for knocking out pfkB, and the above expression vectors; or

[0025] (III), expression vector for knocking out wcaJ, expression vector for knocking out lacZ, expression vector for knocking out pfkB, expression vector for replacing the promoter of pfkA with P BIOFAB and adding an expression vector with a protein degradation tag after pfkA and the above expression vector; or

[0026] (IV), expression vector for knocking out wcaJ, expression vector for knocking out lacZ, expression vector for knocking out pfkB, expression vector for knocking out sspB, expression vector for replacing the promoter of pfkA with P BIOFAB and adding an expression vector with a protein degradation tag after pfkA and the above expression vector; or

[0027] (V), expression vector for knocking out wcaJ, expression vector for knocking out lacZ, expression vector for knocking out pfkB, expression vector for replacing the promoter of sspB with P BAD And in P BAD The expression vector with araC added to the front is used to replace the promoter of pfkA with P BIOFAB and adding an expression vector containing a protein degradation tag and the above expression vector after pfkA;

[0028] The protein degradation tag includes ssrA;

[0029] The ssrA comprises DAS+4;

[0030] The P BIOFAB have:

[0031] (a), the nucleotide sequence shown in SEQ ID NO:46; or

[0032] (b) a nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (a), and having the same or similar function as (a); or

[0033] (c) a nucleotide sequence having at least 65% homology to the nucleotide sequence shown in (a) or (b);

[0034] The plurality is 2 to 10.

[0035] The present invention also provides the use of any of the following items in preparing a genetically engineered strain for producing fucosyllactose 3-FL or producing fucoxyl oligosaccharide 3-FL:

[0036] (i), the above-mentioned 1,3-fucosyltransferase;

[0037] (ii) the above-mentioned nucleic acid molecule;

[0038] (iii) the above-mentioned expression vector;

[0039] (iv) the above-mentioned expression vector combination.

[0040] The present invention also provides a genetically engineered strain, which is a modified Escherichia coli;

[0041] The modification includes: knocking out wcaJ, knocking out lacZ, adding the gene of the above-mentioned 1,3-fucosyltransferase, and adding a regulatory system;

[0042] The Escherichia coli includes W3110;

[0043] The regulatory system includes an L-arabinose operator system, a temperature-sensitive promoter, a pH-sensitive promoter, an oxygen-dependent promoter, a growth-dependent promoter, antisense RNA or a ribosome regulator.

[0044] In some specific embodiments of the present invention, the modification in the above genetically engineered strain comprises:

[0045] (I), knocking out wcaJ, knocking out lacZ, and adding the gene of the above-mentioned 1,3-fucosyltransferase; or

[0046] (II), knocking out wcaJ, knocking out lacZ, knocking out pfkB, and adding the above-mentioned 1,3-fucosyltransferase genes; or

[0047] (III), knock out wcaJ, knock out lacZ, knock out pfkB, replace the promoter of pfkA with P BIOFAB and adding a protein degradation tag after pfkA and the gene for the above-mentioned 1,3-fucosyltransferase; or

[0048] (IV), knock out wcaJ, knock out lacZ, knock out pfkB, knock out sspB, replace the promoter of pfkA with P BIOFAB and adding a protein degradation tag after pfkA and the gene for the above-mentioned 1,3-fucosyltransferase; or

[0049] (V), knock out wcaJ, knock out lacZ, knock out pfkB, replace the promoter of sspB with P BAD And in P BAD Add araC in front and replace the promoter of pfkA with P BIOFAB A protein degradation tag and the gene for the above-mentioned 1,3-fucosyltransferase were added after pfkA;

[0050] The protein degradation tag includes ssrA;

[0051] The ssrA includes DAS+4.

[0052] The present invention also provides the use of the genetically engineered strain in producing fucosyllactose 3-FL.

[0053] The present invention also provides a method for preparing a genetically engineered strain for producing fucosyllactose 3-FL, comprising: transforming Escherichia coli to obtain the genetically engineered strain for producing fucosyllactose 3-FL;

[0054] The modification includes: knocking out wcaJ, knocking out lacZ, adding the gene of the above-mentioned 1,3-fucosyltransferase, and adding a regulatory system;

[0055] The Escherichia coli includes W3110;

[0056] The regulatory system includes an L-arabinose operator system, a temperature-sensitive operator system, a pH-sensitive operator system, an oxygen-dependent operator system or a growth-dependent operator system.

[0057] The present invention also provides a method for producing fucosyllactose 3-FL, which is produced based on the above-mentioned genetically engineered strain.

[0058] In some specific embodiments of the present invention, at the DNA level, some conditionally controllable promoters (temperature-sensitive, pH-sensitive, oxygen-dependent, growth-dependent) are used to dynamically control gene transcription levels through the transformation of conditions.

[0059] In some embodiments of the invention, the translation rate is regulated at the RNA level by antisense RNA or ribosomal regulators.

[0060] In some specific embodiments of the present invention, at the protein level, conditionally controllable promoters can also be used to dynamically regulate the degradation rate of target proteins.

[0061] The engineering strain for dynamically regulating glucose metabolism to redirect 3-FL production and the construction method thereof of the present invention have the following effects:

[0062] In the biosynthetic pathway of 3-FL, GDP-L-focose is its precursor, and F6P is an intermediate product of the glycolytic pathway and a precursor of GDP-L-focose synthesis. Therefore, in the FOs production process, there is a direct competition between cell growth and carbon metabolism to the product. However, the static knockout strategy has an adverse effect on the physiology of the host strain, resulting in poor growth, low product yield and titer. In order to overcome this problem, the present invention adopts a dynamic knockout strategy to retain the positive characteristics of the host bacteria in growth and glucose uptake, while dynamically regulating the flux of carbon metabolism between bacterial growth and product production.

[0063] Strain 23G-06 uses Pfk-I as a dynamic control node, and controls the steady-state level by adding an sspB-dependent degradation tag ssrA to the coding sequence of Pfk-I, and controlling the expression of sspB in the promoter induced by arabinose. After optimizing the inducer and the timing of induction, at a fixed initial biomass, the carbon flux entering the biomass is reduced and switched to the 3-FL synthesis pathway. The rapid and dynamic nature of this conversion allows the ideal cell phenotype to be maintained during the growth phase of fermentation (rapid growth, high expression of recombinant proteins), while still reducing the flux entering the central metabolism during the production phase, which can double the yield and titer of 3-FL. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0065] Figure 1 The metabolic pathway of 3-FL biosynthesis in recombinant E. coli is shown;

[0066] Figure 2 Shows the inducible Pfk-I degradation control switch;

[0067] Figure 3 pGRB-wcaJ PCR screening is shown;

[0068] Figure 4 wcaJ knockout screening is shown;

[0069] Figure 5 pGRB-lacZ PCR screening is shown;

[0070] Figure 6 lacZ knockout screening;

[0071] Figure 7 Shown is the plasmid map of pGEX-GST-3FL;

[0072] Figure 8 pGRB-pfkB PCR screening is shown;

[0073] Fig. 9 pfkB knockout identification is shown;

[0074] Fig.10 pGRB-pfkA PCR screening is shown;

[0075] Fig.11 pfkA knockout screening is shown;

[0076] Fig.12 pGRB-heter PCR;

[0077] Fig.13 P BIOFAB -pfkA-ssrA (DAS+4) insertion screening;

[0078] Fig.14 pGRB-sspB PCR screening is shown;

[0079] Fig.15 sspB knockout screening is shown;

[0080] Fig.16 araC-P BAD - sspB insertion screening;

[0081] Fig.17 The fermentation growth of the strain was shown;

[0082] Fig.18 The changes of 3-FL production during the fermentation process are shown. DETAILED DESCRIPTION

[0083] The present invention discloses an engineering strain and a method for constructing the same for dynamically regulating glucose metabolism to redirect 3-FL production. Those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve the desired effect. It should be noted in particular that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0084] The present invention uses a genetically encoded metabolic switch, focusing on dynamically regulating and controlling the level of phosphofructokinase (Pfk-I), so that the metabolic state is purposefully converted from the cell growth mode based on the metabolic pathway of the wild-type strain to the 3-FL production mode based on the synthetic metabolic pathway of Escherichia coli, thereby rewriting the gene regulatory network. Finally, the conditions for converting the metabolic state from the cell growth mode to the production mode in the batch fermentation of 3-FL are optimized, and the production titer and yield of 3-FL directly fermented from glucose are improved.

[0085] Specifically:

[0086] F6P is a key precursor for GDP-L-focose synthesis and plays an important role in glycolysis. The carbon flow of F6P to metabolic central carbons is the main reason for the low production of 3-FL in glucose. Since the pfkA gene is responsible for 90% of Pfk-I activity, previous studies have attempted to attenuate the expression of pfkA to save more F6P for 3-FL synthesis. However, the attenuation cannot be too strong to ensure cell growth and cell metabolism, and knocking out pfkB alone does not bring much difference to cell growth. This result is consistent with the fact that the expression of pfkA is responsible for 90% of Pfk-I activity, while pfkB only accounts for a small amount of activity. At the same time, pfkA and pfkB significantly affected cell growth and production using different carbon sources. Therefore, the present invention selects the pfkA gene in Pfk-I as the target gene for designing a metabolic conversion switch, which dynamically regulates the Pfk-I level without affecting cell growth, so that the metabolic state is converted between the growth mode of cell metabolism and the 3-FL production mode of anabolism, thereby improving the production titer and yield of 3-FL.

[0087] In Escherichia coli, proteins tagged with ssrA can be degraded by binding to the ClpXP protease through the sspB ligand protein. In order to achieve dynamic knockout of Pfk-I, the present invention adopts a system based on controlled protein degradation, that is, the ssrA tag is fused to the C-terminus of Pfk-I, and the expression of sspB is controlled by an arabinose-induced promoter. In the presence of the ligand protein sspB, the target protein is rapidly degraded. In addition, the natural promoter sequence expressed by Pfk-I is destroyed, which contains the binding site of the transcription factor Cra, controls the transcription of genes in the main pathways of carbon and energy metabolism, and selects a constituent promoter from the BIOFAB module library for expression. This strategy can cause rapid changes in the steady-state level of Pfk-I, and then control the glucose flux and growth rate by controlling the degradation of Pfk-I, and realize the high-titer biosynthesis of 3-FL ( Figure 2 ).

[0088] The sequence information involved in the present invention is as follows:

[0089] Table 1: Primer information

[0090]

[0091]

[0092] The 1,3-fucosyltransferase involved in the present invention uses the amino acid sequence of the 1,3-fucosyltransferase from Helicobacter pylori as a reference sequence, and obtains the following amino acid sequence (SEQ ID NO: 43) through sequence similarity analysis based on the metagenome:

[0093]

[0094] The coding gene sequence of SEQ ID NO:43 is as follows (SEQ ID NO:44):

[0095]

[0096] The reference sequence is as follows (SEQ ID NO: 45):

[0097]

[0098] Unless otherwise specified, the raw materials, reagents, consumables and instruments involved in the present invention are all common commercial products and can be purchased from the market.

[0099] The present invention will be further described below in conjunction with embodiments:

[0100] Example 1: Construction of 3-FL synthetic pathway

[0101] 1.1wcaJ gene knockout

[0102] 1.1.1 gRNA plasmid construction

[0103] Use Synthego-Knockout Guide Designer to design the target sequence; after selecting the appropriate gRNA target sequence, design the gRNA primer (the capitalized part is the gRNA target sequence).

[0104] PCR amplification was performed using the system shown in Table 2:

[0105] Table 2: PCR amplification system

[0106] Components volume 2×Phanta Max Master Mix 25μL Primer-01(10μM) 1μL Primer-02 (10 μM) 1μL Template plasmid (pGRB) <10ng <![CDATA[ddH 2 The]]> Up to 50μL

[0107] Recover the PCR product and digest the template plasmid using the system shown in Table 3:

[0108] Table 3: Template plasmid digestion system

[0109] Components volume 10×Buffer 1μL QuickCut DpnI 1μL PCR products 8μL

[0110] The system was placed at 37°C for 30 min, and then the UltraOne Step Cloning Kit was used to construct plasmid recombination, and the reaction system is shown in Table 4:

[0111] Table 4: Homologous recombination system

[0112] Components volume 2×ClonExpress Mix 2.5μL Digestion products 2.5μL

[0113] The recombinant system was reacted at 50℃ for 15min, and then placed in an ice bath for 2min. 5μL of the reaction solution was added to 50μL of DH-5α transfected competent cells, and gently mixed and ice bathed for 30min. Heat shock was performed at 42℃ for 45s, and then ice bathed for 2min. 900μL SOC was added and revived at 37℃ for 1h. Centrifuged at 5000rpm for 3min, part of the supernatant was discarded, and 100μL of the cells were resuspended and then applied to the Amp r Plates were plated and cultured overnight at 37°C. After a single colony grew on the plate, positive recombinants were selected by colony PCR identification (the colony PCR screening system is shown in Table 5).

[0114] Table 5: Colony PCR screening system

[0115]

[0116]

[0117] The positive recombinant plasmid of the wcaJ site gRNA was screened by PCR, with a positive of 539 bp and a negative of 1137 bp, see Figure 3 All selected single clones were positive recombinants.

[0118] 1.1.2 Donor DNA design

[0119] Using the genome as a template, primers Primer-05 and Primer-06 amplify the upstream homology arm, and primers Primer-07 and Primer-08 amplify the downstream homology arm. The recovered upstream and downstream homology arm fragments are fused with primers Primer-05 and Primer-08, and the PCR product with a single band is purified and recovered, which is the donor DNA fragment.

[0120] 1.1.3 Conversion

[0121] The plasmid pREDCas9 was electroporated into E. coli str.K-12substr.W3110 competent cells. W3110 cells carrying pREDCas9 were cultured in LB medium until OD 600When the p-value was about 0.1, isopropyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 0.1 mM to induce the expression of the λ-Red system. For genome editing, 100 ng of pGRB-gRNA plasmid and 400 ng of donor DNA were added to 100 μl of competent cells, electroporated in a pre-cooled 1 mm electroporation cuvette (Bio-Rad, 1850 V), and immediately suspended in 1 ml of fresh LB medium. After the cells were incubated at 30°C for 2 hours, all cells were spread on LB plates containing spectinomycin (100 μg / ml) and ampicillin (100 μg / ml) and cultured overnight at 30°C.

[0122] 1.1.4 Positive strain screening

[0123] A single colony was randomly selected from the transformation plate and screened by PCR with primers Primer-05 and Primer-08. The wild-type strain was used as a control. The positive result was 1356 bp and the negative result was 2727 bp. Figure 4 , gene knockout occurred in 5 of the 7 transformants identified.

[0124] 1.1.5 Tool plasmid elimination

[0125] The positive strain with successful gene editing was inoculated into LB medium containing arabinose (10mM) and spectinomycin (100μg / ml) to eliminate the pGRB-gRNA plasmid; cultured overnight at 30°C and 200rpm, and a loopful of bacterial liquid was streaked on a solid LB plate containing spectinomycin (100μg / ml); after mature single colonies grew, single clones were picked and screened on LB plates containing spectinomycin and ampicillin resistance, and single colonies that grew on the spectinomycin plate but not on the ampicillin resistance plate were selected.

[0126] The pGRB-gRNA-eliminated colony was inoculated into liquid LB medium, incubated at 42°C and 200 rpm for 3 hours, and then a loop of bacterial liquid was streaked on an LB plate without resistance and cultured overnight at 37°C. Single clones were selected and screened on LB plates with and without spectinomycin, and single colonies that did not grow on plates containing spectinomycin resistance but grew on plates without resistance were selected.

[0127] 1.2 lacZ gene knockout

[0128] The gRNA plasmid pGRB-lacZ of the lacZ gene locus was constructed with primers Primer-09 and Primer-10. After screening with primers Primer-03 and Primer-04, the positive result was 539 bp and the negative result was 1137 bp. Figure 5 Among the selected monoclonal clones, there were three relatively obvious positive recombinants.

[0129] Using the genome as a template, primers Primer-11 and Primer-12 amplify the upstream homology arm, and primers Primer-13 and Primer-14 amplify the downstream homology arm. The recovered upstream and downstream homology arm fragments are fused using primers Primer-11 and Primer-14, and the PCR product with a single band is purified and recovered, which is the donor DNA fragment.

[0130] The wcaJ knockout bacteria were prepared as competent cells and electroporated to transform the gRNA plasmid and donor DNA fragment for lacZ knockout. The transformants were screened by PCR with primers Primer-11 and Primer-14. The positive result was 1160 bp and the negative result was 4211 bp. Figure 6 , 7 transformants were screened and one positive result was obtained.

[0131] For other details and procedures, refer to 1.1.

[0132] 1.3 Construction of heterologous 3-FL synthesis pathway

[0133] The 1,3-fucosyltransferase was synthesized into the vector pGEX-5X-2, see Figure 7 The amino acid sequence of the 1,3-fucosyltransferase is shown in SEQ ID NO:43.

[0134] Example 2: Construction of an inducible Pfk-I degradation control switch

[0135] 2.1 pfkB gene knockout

[0136] The gRNA plasmid pGRB-pfkB of the pfkB gene locus was constructed with primers Primer-15 and Primer-16. After screening with primers Primer-03 and Primer-04, the positive result was 539 bp and the negative result was 1137 bp. Figure 8 , there were four positive recombinants among the selected single clones.

[0137] Using the genome as a template, primers Primer-17 and Primer-18 amplify the upstream homology arm, and primers Primer-19 and Primer-20 amplify the downstream homology arm. The recovered upstream and downstream homology arm fragments are fused with primers Primer-17 and Primer-20, and the PCR product with a single band is purified and recovered, which is the donor DNA fragment.

[0138] Prepare competent cells and electroporate to transform the gRNA plasmid and donor DNA fragment for pfkB gene knockout. Transformants were screened by PCR with primers Primer-17 and Primer-20. The positive result was 1921 bp and the negative result was 1015 bp. Fig. 9 , a positive knockout strain was screened out from 7 transformants.

[0139] For other details and procedures, refer to 1.1.

[0140] 2.2 pfkA gene editing

[0141] The gRNA plasmid pGRB-pfkA of the pfkA gene locus was constructed with primers Primer-21 and Primer-22. After screening with primers Primer-03 and Primer-04, the positive result was 539 bp and the negative result was 1137 bp. Fig.10 , the selected single clone contains the correct positive recombinant.

[0142] Using the genome as a template, primers Primer-23 and Primer-24 amplify the upstream homology arm, primers Primer-25 and Primer-26 amplify the downstream homology arm, and at the same time introduce exogenous gRNA sites; the recovered upstream and downstream homology arm fragments are fused with primers Primer-23 and Primer-26, and the PCR product with a single band is purified and recovered, which is the donor DNA fragment.

[0143] Prepare competent cells and electroporate to transform the gRNA plasmid and donor DNA fragment for pfkA gene knockout. Transformants were screened by PCR with primers Primer-23 and Primer-26. The positive result was 1159 bp and the negative result was 2252 bp. Fig.11 , knockout occurred in all 6 transformants.

[0144] Primers Primer-27 and Primer-28 were used to construct the gRNA plasmid pGRB-heter of the exogenous site. After screening with primers Primer-03 and Primer-04, the positive result was 539 bp and the negative result was 1137 bp. Fig.12 .

[0145] Using the genome as a template, primers Primer-23 and Primer-29 amplified the upstream homology arm, primers Primer-32 and Primer-26 amplified the downstream homology arm, and primers Primer-30 and Primer-31 amplified the pfkA gene. BIOFAB , sequence is tcgacatcaggaaaatttttctgatacttacagccat, SEQ ID NO:46) and a protein degradation tag; the recovered upstream and downstream homology arm fragments are fused with primers Primer-23 and Primer-26, and the PCR product with a single band is purified and recovered, which is the donor DNA fragment.

[0146] Prepare competent cells and electroporate to transform the gRNA plasmid and donor DNA fragment of the exogenous site. Transformants were screened by PCR with primers Primer-23 and Primer-26. The positive result was 2197 bp and the negative result was 1159 bp. Fig.13 .

[0147] For other details and procedures, refer to 1.1.

[0148] 2.3sspB gene editing

[0149] The gRNA plasmid pGRB-sspB of the sspB gene locus was constructed with primers Primer-33 and Primer-34. After screening with primers Primer-03 and Primer-04, the positive result was 539 bp and the negative result was 1137 bp. Fig.14 .

[0150] Using the genome as a template, primers Primer-35 and Primer-36 amplify the upstream homology arm, primers Primer-37 and Primer-38 amplify the downstream homology arm, and at the same time introduce exogenous gRNA sites; the recovered upstream and downstream homology arm fragments are fused with primers Primer-35 and Primer-38, and the PCR product with a single band is purified and recovered, which is the donor DNA fragment.

[0151] Prepare competent cells and electroporate to transform the gRNA plasmid and donor DNA fragment for sspB gene knockout. Transformants were screened by PCR with primers Primer-35 and Primer-38. The positive result was 1095 bp and the negative result was 1563 bp. Fig.15 .

[0152] Using the genome as a template, primers Primer-35 and Primer-39 amplified the upstream homology arm, primers Primer-42 and Primer-38 amplified the downstream homology arm, and primers Primer-40 and Primer-41 amplified araC-P BAD -sspB; the recovered upstream and downstream homology arm fragments were fused with primers Primer-35 and Primer-38, and the PCR product with a single band was purified and recovered, which was the donor DNA fragment.

[0153] Prepare competent cells and electroporate to transform the gRNA plasmid and donor DNA fragment of the exogenous site. Transformants were screened by PCR with primers Primer-35 and Primer-38. The positive result was 2753 bp and the negative result was 1095 bp. Fig.16 .

[0154] For other details and procedures, refer to 1.1.

[0155] Example 3: Application of Pfk-I dynamic switch in 3-FL fermentation production

[0156] The seed culture for fed-batch fermentation was prepared in a 5 L bioreactor with a volume of 2 L and cultured at 37 °C until the cell OD 600 At about 15 o'clock, the seed culture was transferred to a 15L bioreactor with an inoculation volume of 10% and a final liquid volume of 8L. The reactor was operated at 30°C and 650rpm. The pH was maintained at 6.80-7.20 by ammonia water, the dissolved oxygen was 36.4, and the ventilation was 1.0m 3 / h. During the fermentation process, glucose (80%) and β-lactose were added in batches to supply synthesis reactions and maintain basal cell metabolism.

[0157] At 12 h of fermentation, 0.3 mM IPTG was added to induce the expression of fucT enzyme for each strain, and 10 mM arabinose was added to induce sspB expression at 35 h of fermentation to control the switch between growth and production modes.

[0158] Table 6: Seed culture medium

[0159] raw material Ratio (g / L) Tryptone Oxoid 10.0 Yeast Extract Oxoid 5.0 NaCl 10.0

[0160] Table 7: Fermentation medium

[0161] raw material Ratio (g / L) glucose 10.0 β-Lactose 10.0 Citric Acid 1.7 <![CDATA[(NH 4 ) 2 HPO 4 ]]> 8.0 <![CDATA[KH 2 AFTER 4 ]]> 13.3 <![CDATA[MgSO 4 ·7H 2 Oh]]> 1.2 Yeast Extract Oxoid 7.5 Trace Elements 10mL / L

[0162] Table 8: Trace elements

[0163]

[0164]

[0165] Table 9: Strains and plasmids

[0166]

[0167] The strain 23G-01 reached OD at 37 h. 600 The growth trend fluctuates with the consumption and addition of glucose (see Fig.17 , the corresponding data are shown in Table 10); combined Fig.18(The corresponding data are shown in Table 11). The 3-FL yield was about 12.6 g / L at 97 h of fermentation. At the same time, it can be seen that the accumulation trend of 3-FL is completely different from the growth trend, that is, growth and production are uncoupled. The pfkB gene was knocked out in strain 23G-02, and its growth trend was similar to that of 23G-01, with a slight hysteresis, while the pfkA gene was knocked out in strain 23G-03, and its growth was seriously affected. This was mainly due to the obstruction of the EMP pathway, and the weak growth was maintained by relying on the HMP and ED pathways, which also confirmed the difference in the functions of the pfkA and pfkB genes; at the same time, it can be seen from the yield of 3-FL that the knockout of the pfkB gene increased the carbon flux entering the production synthesis pathway without affecting the biomass, which brought about an increase in the yield of 3-FL; strain 23G-03 simultaneously knocked out pfkA and pfkB, although the carbon flux entering the EMP pathway was reduced, and the carbon flux of the production synthesis pathway may increase, but its low biomass seriously limits the yield of 3-FL. When the P BIOFAB -pfkA-ssrA (DAS+4), i.e., strain 23G-04, did not recover its growth. The reason is that after Pfk-I was marked by ssrA, endogenous sspB guided Pfk-I to be degraded by ClpXP protease. The 3-FL production increased compared with 23G-03, but it was also trapped by low biomass. When the endogenous sspB gene was knocked out, i.e., strain 23G-05, its growth was recovered, and the logarithmic phase was shorter than that of 23G-01, and the biomass was higher, which was mainly due to P BIOFAB The constitutive promoter and the binding site for the transcription factor Cra in the native sequence were disrupted; however, 3-FL production did not increase as much as expected, which is understandable because of excessive carbon flux into the growth pathway. BAD -sspB, the expression of sspB was regulated, that is, strain 23G-06, its growth was still superior to 23G-01, but its growth trend was slightly lagging behind that of 23G-05, which was the result of leaky expression. When arabinose was added at 35h to induce sspB expression, its growth trend was not significantly affected, while 3-FL accumulated rapidly after 35h, eventually reaching 24.5g, an increase of 94% over 23G-01. This was the result of directing carbon flux to the production synthesis pathway while ensuring the precursor of biomass.

[0168] Table 10

[0169]

[0170]

[0171] Table 11

[0172]

[0173] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. 1,3-fucosyltransferase, characterized in that have: (1), the amino acid sequence shown in SEQ ID NO: 43; or (2) An amino acid sequence obtained by replacing, deleting or adding one or more residues of the amino acid sequence shown in (1), and having the same or similar function as (1); or (3) an amino acid sequence having at least 65% homology to the amino acid sequence shown in (1) or (2); The plurality is 2 to 20.

2. A nucleic acid molecule, characterized in that The method comprises the following steps: comprising: having a nucleotide sequence encoding the 1,3-fucosyltransferase according to claim 1.

3. An expression vector, characterized in that It comprises the nucleic acid molecule as claimed in claim 2 and an acceptable genetic element.

4. An expression vector combination, characterized in that: include: (I), an expression vector for knocking out wcaJ, an expression vector for knocking out lacZ, and an expression vector as claimed in claim 3; or (II), an expression vector for knocking out wcaJ, an expression vector for knocking out lacZ, an expression vector for knocking out pfkB, and the expression vector as claimed in claim 3; or (III), expression vector for knocking out wcaJ, expression vector for knocking out lacZ, expression vector for knocking out pfkB, expression vector for replacing the promoter of pfkA with P BIOFAB An expression vector having a protein degradation tag added after pfkA and the expression vector as claimed in claim 3; or (IV), expression vector for knocking out wcaJ, expression vector for knocking out lacZ, expression vector for knocking out pfkB, expression vector for knocking out sspB, expression vector for replacing the promoter of pfkA with P BIOFAB An expression vector having a protein degradation tag added after pfkA and the expression vector as claimed in claim 3; or (V), expression vector for knocking out wcaJ, expression vector for knocking out lacZ, expression vector for knocking out pfkB, expression vector for replacing the promoter of sspB with P BAD And in P BAD The expression vector with araC added to the front is used to replace the promoter of pfkA with P BIOFAB and adding a protein degradation tag after pfkA to an expression vector and the expression vector as claimed in claim 3; The protein degradation tag includes ssrA; The ssrA comprises DAS+4; The P BIOFAB have: (a), the nucleotide sequence shown in SEQ ID NO:46; or (b) a nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (a), and having the same or similar function as (a); or (c) a nucleotide sequence having at least 65% homology to the nucleotide sequence shown in (a) or (b); The plurality is 2 to 10.

5. Use of any of the following in the preparation of a genetically engineered strain for producing fucosyllactose 3-FL or in the production of fucosyll oligosaccharide 3-FL: (i) The 1,3-fucosyltransferase according to claim 1; (ii) the nucleic acid molecule according to claim 2; (iii) the expression vector according to claim 3; (iv) The expression vector combination as described in claim 4.

6. A genetically engineered strain, characterized in that: is a modified Escherichia coli; The modification includes: knocking out wcaJ, knocking out lacZ, adding the gene of 1,3-fucosyltransferase as claimed in claim 1, and adding a regulatory system; The Escherichia coli includes W3110; The regulatory system includes an L-arabinose operon, a temperature-sensitive promoter, a pH-sensitive promoter, an oxygen-dependent promoter, a growth-dependent promoter, an antisense RNA or a ribosome regulator.

7. The genetically engineered strain according to claim 6, characterized in that The transformation includes: (I), knocking out wcaJ, knocking out lacZ, and adding the gene of the 1,3-fucosyltransferase as claimed in claim 1; or (II), knocking out wcaJ, knocking out lacZ, knocking out pfkB, and adding the gene of the 1,3-fucosyltransferase as claimed in claim 1; or (III), knock out wcaJ, knock out lacZ, knock out pfkB, replace the promoter of pfkA with P BIOFAB and adding a protein degradation tag after pfkA and the gene of the 1,3-fucosyltransferase as claimed in claim 1; or (IV), knock out wcaJ, knock out lacZ, knock out pfkB, knock out sspB, replace the promoter of pfkA with P BIOFAB and adding a protein degradation tag after pfkA and the gene of the 1,3-fucosyltransferase as claimed in claim 1; or (V), knock out wcaJ, knock out lacZ, knock out pfkB, replace the promoter of sspB with P BAD And in P BAD Add araC in front and replace the promoter of pfkA with P BIOFAB and adding a protein degradation tag after pfkA and a gene for the 1,3-fucosyltransferase as claimed in claim 1; The protein degradation tag includes ssrA; The ssrA includes DAS+4.

8. Use of the genetically engineered strain according to claim 6 or 7 in producing fucosyllactose 3-FL.

9. A method for preparing a genetically engineered strain for producing fucosyllactose 3-FL, characterized in that: Transforming Escherichia coli to obtain the genetically engineered strain for producing fucosyllactose 3-FL; The modification includes: knocking out wcaJ, knocking out lacZ, adding the gene of 1,3-fucosyltransferase as claimed in claim 1, and adding a regulatory system; The Escherichia coli includes W3110; The regulatory system includes an L-arabinose operator system, a temperature-sensitive promoter, a pH-sensitive promoter, an oxygen-dependent promoter, a growth-dependent promoter, antisense RNA or a ribosome regulator.

10. A method for producing fucosyllactose 3-FL, characterized in that: Produced based on the genetically engineered strain as claimed in claim 6 or 7.

Images