Avicennia marina salt-tolerant gene AmNAC8 and application thereof

Abstract

The invention discloses an avicennia marina salt-tolerant gene AmNAC8 and application thereof. The AmNAC8 gene disclosed by the invention is separated from halophyte Avicennia marina, the nucleotide sequence of the AmNAC8 gene is as shown in SEQ ID NO.1, and the coded amino acid sequence of the AmNAC8 gene is as shown in SEQ ID NO.2. A plant expression vector is constructed, the AmNAC8 gene is transferred into arabidopsis thaliana to obtain transgenic arabidopsis thaliana, the germination rate of transgenic arabidopsis thaliana seeds under salt stress can be improved, it is indicated that the AmNAC8 gene has the function of improving the salt tolerance characteristic of plants, and the AmNAC8 gene has important significance for revealing the molecular mechanism that the avicennia marina adapts to the high-salt habitat and cultivating salt-tolerant crops.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to a salt-tolerant gene AmNAC8 ​​of Avicennia marina and an application thereof. Background Art

[0002] Salt stress is a non-biological stress that is particularly significant in arid and semi-arid land areas and agricultural areas that rely on irrigation systems. According to statistics, the total area of ​​saline-alkali land in the world is about 954 million hectares. In China, the area of ​​saline-alkali land has reached 99.13 million hectares, reflecting the prevalence and severity of China's saline-alkali land problem. Saline-alkali land refers to soil composed of salt, and the salt content in the soil affects the normal growth of crops [Zhou Zhenling, 2024]. With the intensification of human activities and global warming, the ecological environment has suffered serious damage, making the salinization of the land increasingly serious. Salt stress mainly causes harm to plants through a series of secondary stresses such as osmotic stress, ion stress, and nutritional deficiencies caused by high salt, so that the growth and development of plants will be inhibited [Zhou Zhenling, 2024]. Therefore, while understanding the salt tolerance of plants, it is very important to study how to improve the stress resistance of plants [Lu Haifeng, 2023]. In order to solve problems such as plant salt stress, we can identify plant salt-tolerant genes and improve plant salt tolerance through genetic engineering. Effectively improving plant salt stress and saline-alkali soil utilization problems is an effective way to improve the utilization rate of saline-alkali land.

[0003] Gene expression regulation is the basis for plants to adapt to the external environment and the key to plant growth and development [Song Songbo, 2024]. When plants face the harsh challenge of salt stress, the transcription factors that play a key role in the body can sense the changes in salt concentration in the environment and respond quickly. By regulating gene expression, a set of response regulation mechanisms are formed to cope with abiotic stress. NAC family members play a very important role in plant abiotic stress response [Zhai Yunru, 2024; Nakashima et al., 2012; Yuan et al., 2019; Ren et al., 2021; Diao et al., 2020; Liu et al., 2022]. With the development of research, many genes in this family have been found in species such as Arabidopsis, rice, soybean, grape, and tomato [Song Jieqiong, 2023; Scharf et al., 2012; Gong et al., 2020; Kidokoro et al., 2022]. Studies have found that some NAC genes in soybean are involved in the response to salt stress [Li et al., 2021]. For example, NAC181 directly regulates the expression of NINa in soybean to promote symbiotic nodulation and salt tolerance [Yuan Jiazhi, 2023]. After Arabidopsis thaliana was induced by salt stress, researchers found that AtNAC40 mutations led to an increase in its seed germination rate. In pepper salt-tolerant materials, the expression of CaNAC36 in some roots and stems was significantly increased [Zheng Yuqing, 2023]. After in-depth analysis, researchers speculated that CaNAC36 transcription factors played a key role in the initial perception of salt stress. This type of gene can not only perceive changes in the salt environment, but also quickly transmit salt signals and regulate the response of related salt-tolerant genes [Zheng Yuqing, 2023]. There are 40 NAC family members in rice that regulate the expression of a large number of stress-related genes during the response to salt stress. However, in the halophyte Avicennia marina, NAC transcription factors have not been identified and their functions have not been elucidated.

[0004] Avicennia marina, scientifically known as Avicennia marina, is a salt-secreting mangrove plant distributed in the intertidal zone of tropical and subtropical coasts [Ye Wenjing, 2006]. Its leaf or stem epidermal cells can differentiate into salt glands to remove excess salt in the body, keep the salt content in the plant at a low level, and reduce the damage of salt stress to the plant [Carola et al., 1999]. Under the influence of many adverse factors such as low temperature, high salt, flooding, soil hypoxia and tidal impact for a long time, Avicennia marina has formed a series of adaptive regulatory mechanisms to cope with adverse factors in the long-term evolution process [Lin Peng, 2002], including morphological structure, water, photosynthesis, transpiration, stomatal conductance, etc. [Huang Lingyu, 2014]. However, as a true halophyte, the genome of Avicennia marina has been published, but its salt-tolerance genes have rarely been identified, and its salt-tolerance molecular mechanism remains to be elucidated [Friis et al., 2021; Natarajan et al., 2021]. At present, there are no reports on the functional research of NAC family genes in the response of Avicennia marina to adverse stress, and there is a lack of research on the functions of NAC family members in mangrove plants. Summary of the invention

[0005] In view of this, one of the purposes of the present invention is to provide a salt-tolerance gene from Avicennia marina, AmNAC8, whose nucleotide sequence is shown in SEQ ID NO. 1 and the amino acid sequence encoded by it is shown in SEQ ID NO. 2. The AmNAC8 ​​gene is a NAC family gene and contains a NAM conserved motif.

[0006] The second object of the present invention is to provide a recombinant expression vector, which is composed of the above-mentioned salt-tolerant gene AmNAC8 ​​connected to a plant expression vector.

[0007] Preferably, the plant expression vector is pBinGlyRed.

[0008] The third object of the present invention is to provide a recombinant Agrobacterium cell containing the above-mentioned salt-tolerance gene AmNAC8 ​​or the above-mentioned recombinant expression vector.

[0009] The fourth object of the present invention is to provide a transgenic Arabidopsis thaliana, which contains the above-mentioned salt-tolerant gene AmNAC8, or the above-mentioned recombinant expression vector, or the above-mentioned recombinant Agrobacterium cell. It can be obtained by the following method: using PCR cloning to obtain the full-length coding sequence of the AmNAC8 ​​gene, and obtaining the AmNAC8-pBinGlyRed recombinant plant overexpression vector by homologous recombination; using the freeze-thaw method to transform the recombinant plasmid into Agrobacterium GV3101, and genetically transforming Arabidopsis thaliana by the pollen tube channel method; and obtaining transgenic Arabidopsis thaliana with overexpression of AmNAC8 ​​by red fluorescent protein marker screening and real-time quantitative PCR detection.

[0010] The fifth object of the present invention is to provide the application of the above-mentioned Avicennia marina salt-tolerance gene AmNAC8 ​​in improving the salt-tolerance characteristics of plants.

[0011] Preferably, the plant is Arabidopsis thaliana.

[0012] Preferably, the salt tolerance characteristic is salt tolerance at the seed germination stage, that is, the germination rate of transgenic AmNAC8 ​​Arabidopsis seeds under salt stress is improved.

[0013] The present invention identifies a new NAC family gene AmNAC8, and obtains the full-length coding sequence of the gene by cloning. Through heterologous transformation of Arabidopsis thaliana, it is found that the gene can confer salt stress tolerance during seed germination of Arabidopsis thaliana. This indicates that the AmNAC8 ​​gene has the function of improving the salt tolerance of plants, which is of great significance for revealing the molecular mechanism of Avicennia marina adapting to high-salt habitats and cultivating salt-tolerant crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is the PCR amplification diagram of the full-length sequence of AmNAC8 ​​gene in the present invention;

[0015] Figure 2 This is the NAM conservative motif diagram of the AmNAC8 ​​gene in the present invention;

[0016] Figure 3 This is the gene expression diagram of the AmNAC8 ​​gene under salt stress conditions of the present invention;

[0017] Figure 4 This is a diagram of screening positive seeds of T0 generation Arabidopsis thaliana after genetic transformation of AmNAC8 ​​gene of the present invention;

[0018] Figure 5 This is a graph showing the expression level of the AmNAC8 ​​gene in transgenic Arabidopsis thaliana of the present invention;

[0019] Figure 6 The germination phenotype and statistical diagram of the transgenic Arabidopsis seeds of the present invention when subjected to salt stress. DETAILED DESCRIPTION

[0020] The present invention will be described in detail below in conjunction with the examples, which are only illustrative and are not limited to the scope of application of the present invention. The present invention is not limited to the following embodiments or examples, and any modifications and variations made without violating the spirit of the present invention should be included within the scope of the present invention. Unless otherwise specified, the experimental materials used in the following examples are commercially available; wherein, the Avicennia marina experimental material was collected from the Dongzhaigang Mangrove Research Center in Haikou City, Hainan Province, China.

[0021] Example 1: Sequence analysis of Avicennia marina regulatory gene AmNAC8 ​​and construction of expression vector

[0022] S1: Using the genome sequence data of Avicennia marina and the basic principles of primer design, the local software PrimerPremier 5.0 was used to design PCR primers for full-length cloning of the AmNAC8 ​​gene. The primer sequences are as follows:

[0023] F:5′ATGGAACTTCCACCGGGT 3′

[0024] R:5′TCAAAAATCCCACAAGCAATC 3′

[0025] The AmNAC8 ​​gene fragment was amplified using Avicennia marina cDNA as a PCR template. The kit used in the process was 2×phata Maxmaster Mix (Nanjing Novozyme). The reaction system was 50 μL (Table 1) and the amplification process (Table 2) was as follows:

[0026] Table 1 AmNAC8 ​​gene PCR amplification system

[0027]

[0028]

[0029] Table 2 AmNAC8 ​​gene PCR amplification program

[0030]

[0031] The amplified product was detected by electrophoresis with 1.5% agarose gel and recovered. The agarose gel recovery was performed using EasyPure Quick Gel Extraction Kit DNA gel rapid purification kit, and the specific steps were carried out according to the instructions.

[0032] S2: The plant overexpression vector pBinGlyRed was double-digested with restriction endonucleases XmaⅠ and EcoRⅠ, and the AmNAC8 ​​gene fragment obtained by gel recovery and the linearized overexpression vector were connected into a recombinant plasmid by homologous recombination. The recombinant plasmid was transformed into Escherichia coli competent DH5α by heat shock method, and positive transformants were obtained by resistance screening and colony PCR identification. The recombinant plasmid in the positive transformant was obtained and sent to Nanshan Biology for sequencing. The comparison results of the sequencing sequence proved that the full-length sequence of the AmNAC8 ​​gene coding region was obtained. The agarose gel electrophoresis results of AmNAC8 ​​gene amplification are shown in Figure 1 As shown, the band positions are as expected.

[0033] S3: The analysis revealed that the coding region of the gene is 762 bp in length, encoding a polypeptide chain consisting of 253 amino acids. The amino acid sequence of the AmNAC8 ​​gene was submitted to the Conserved Domain Database (CDD) on the NCBI website to analyze the conserved motifs of the sequence. The results showed that the regulatory factor contains a NAM conserved domain unique to the NAC family ( Figure 2 ).

[0034] Example 2: Application of AmNAC8 ​​gene in regulating plant salt tolerance

[0035] 1. Expression of AmNAC8 ​​gene under salt stress conditions

[0036] S1: Three-month-old Avicennia marina seedlings were treated with aqueous solutions containing 0 mM and 500 mM NaCl, respectively. Young leaves and root tissues were collected at 0 h, 6 h, 12 h, 24 h and 48 h after treatment for RNA extraction from Avicennia marina. RNA was extracted using RNAprepPure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (Tiangen, China) (refer to the experimental instructions for specific methods).

[0037] Integrity and quality detection of total RNA from Avicennia marina: Take 1 μL of the RNA solution extracted above, and use a micro-ultraviolet nucleic acid protein detector to measure its light absorption values ​​at wavelengths of 260, 280 and 230 nm to calculate the A260 / A280 ratio of the RNA solution; at the same time, take 3 μL of the RNA solution for agarose gel electrophoresis to detect the integrity of the RNA; if the A260 / A280 ratio of the RNA sample is between 1.8 and 2.0, and the agarose gel electrophoresis results show that the 28S rRNA band is clear and the brightness is about 1.5-2.0 times that of 18S rRNA, it indicates that the RNA quality is good and can be used for subsequent experiments.

[0038] The cDNA was synthesized using the RNA as a template. The cDNA chain was synthesized using the TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix Kit (Quanshijin, Beijing), and the operation process was carried out according to the instructions. The specific reaction system is shown in Table 3.

[0039] Table 3 cDNA synthesis reaction system

[0040]

[0041] The cDNA obtained above was diluted 5 times with DNase-free ddH2O as a template for quantitative PCR. S2: Real-time quantitative PCR primers (F: 5′GTCCTTCACAGGGGAGTCGT 3′, R: 5′ATGCTCGGACCATTTGTTTC 3′) were designed, and cDNAs of roots and leaves of Avicennia marina treated with 0mM and 500mM NaCl for 0h, 6h, 12h, 24h and 48h were used as templates. Real-time fluorescence quantitative PCR (qPCR) was performed using the ChamQ Universal SYBR qPCR Master Mix kit. The qPCR reaction system was as follows: 2×ChamQ Universal SYBR qPCR Master Mix*10μL, 0.5μL of each forward and reverse primer of the target gene, 8μL of sterile water, and 1μL of cDNA from different parts of Avicennia marina. The expression of the target gene in different salt treatment concentrations and different treatment time points of Avicennia marina was detected; three biological replicates were set for each tissue sample; the reaction procedure is shown in Table 4.

[0042] Table 4 Real-time quantitative PCR reaction program

[0043]

[0044] The results are as follows Figure 3 As shown, compared with the control group, the AmNAC8 ​​gene was significantly induced by salt stress during salt stress treatment.

[0045] 2. Obtaining Arabidopsis strains overexpressing AmNAC8

[0046] The recombinant plasmid containing the target gene obtained in Example 1 was transformed into competent cells of Agrobacterium tumefaciens GV3101 strain, and positive transformants were obtained through resistance screening and PCR identification. The positive transformants were genetically transformed into Arabidopsis Columbia ecotype (wild type, WT) by the flower inoculation method, and the mature seeds were collected as T0 generation seeds. The red seeds were selected under the irradiation of green halogen lamps as positive transgenic seeds ( Figure 4 , where A is T0 generation Arabidopsis seeds under natural light, and B is T0 generation Arabidopsis seeds under halogen lamp). Plant T1 generation and use Plant Tissue PCR Kit (Beijing Quanshijin) was used to perform PCR amplification and agarose gel electrophoresis using T1 leaves and target gene-specific primers, and the strains that could obtain the target gene were identified as positive transgenic strains. The results showed that the target gene had been successfully transferred into Arabidopsis, and T1 seeds were harvested for planting T2 and preservation.

[0047] 3. Analysis of AmNAC8 ​​gene expression level in transgenic Arabidopsis

[0048] The transgenic Arabidopsis strain overexpressing the target gene was named AmNAC8-OE-x, and a total of 15 independent transgenic strains were obtained. The wild-type and transgenic strains were planted in an artificial climate chamber at the same time. When they grew to about one month old, leaves were collected from each plant and quickly frozen in liquid nitrogen for RNA extraction. Three biological replicates were set for each strain.

[0049] Total RNA was extracted from the above materials, reverse transcribed to obtain cDNA, and diluted and then used for real-time quantitative PCR to detect the expression of AmNAC8 ​​in transgenic Arabidopsis. -ΔΔCt The calculation method was used, and the sequences of the internal reference gene primers were as follows:

[0050] Atactin-F:5′GTGTTATGGTTGGGATGGGTCAG3′

[0051] Atactin-R:5′CAGGAGCAACACGGAGTTCATT3′

[0052] The results are as follows Figure 5 (WT is wild-type Arabidopsis, 8OE-1 / 2 / 3 are three transgenic lines) as shown, the expression levels of the target genes in the AmNAC8-OE-1 / 2 / 3 overexpression lines were significantly higher than those in the wild type, indicating that a transgenic Arabidopsis line overexpressing the target gene AmNAC8 ​​has been obtained.

[0053] The above three lines were planted to obtain T2 positive transgenic seeds. After surface disinfection with 75% alcohol and then rinsed with sterile water, they were vernalized at 2-4°C for 2-4 days, and then sown in 1 / 2MS medium containing 0mM and 200mM NaCl, respectively. The wild type was used as a control, and each treatment was repeated three times. The sown culture dishes were placed in an artificial climate incubator for culture. The seed germination rates were counted on the 0th, 1st, 2nd, 3rd, 4th, 5th, 6th, and 7th day after sowing, and photos were taken on the 7th day. The results are shown in the figure. Figure 6 (A and B are photos taken on the 7th day of germination under different NaCl concentrations, respectively; C and D are statistical graphs of germination rates of transgenic Arabidopsis and wild-type Arabidopsis under different NaCl concentrations. Among them, CK is the culture medium containing 0mM NaCl; Control is wild-type Arabidopsis, and 8OE-1 / 2 / 3 are three transgenic lines.) As shown in the figure, the statistical results show that on the 1 / 2MS medium without NaCl, the germination rates of wild-type and transgenic lines are not much different, and are basically consistent; under the 200mM concentration treatment condition, the seed germination rate of the transgenic line is significantly higher than that of the wild type during the entire experimental period ( Figure 6 ), indicating that the introduction of the target gene improved the tolerance of transgenic Arabidopsis thaliana to salt stress during the seed germination stage.

[0054] The conventional techniques and schemes not described in detail in the above embodiments are well known in the art, so they will not be described in detail here. The above embodiments and / or experimental examples describe the preferred embodiments of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, the technical scheme of the present invention can be subjected to a variety of simple modifications, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. A salt-tolerance gene AmNAC8 ​​of Avicennia marina, characterized in that: The nucleotide sequence is shown in SEQ ID NO.1, or the amino acid sequence encoded by it is shown in SEQ ID NO.

2.

2. A recombinant expression vector, characterized in that: The salt-tolerant gene AmNAC8 ​​according to claim 1 is connected to a plant expression vector.

3. The recombinant expression vector according to claim 2, characterized in that The plant expression vector is pBinGlyRed.

4. A recombinant Agrobacterium cell, characterized in that It contains the gene according to claim 1 or the recombinant expression vector according to claim 2 or 3.

5. A transgenic Arabidopsis thaliana, characterized in that: It contains the gene according to claim 1, or the recombinant expression vector according to claim 2 or 3, or the recombinant Agrobacterium cell according to claim 4.

6. Application of the salt-tolerance gene AmNAC8 ​​of Avicennia marina to improve the salt tolerance of plants, characterized in that: The nucleotide sequence of the AmNAC8 ​​gene is shown as SEQ ID NO.1, or the amino acid sequence encoded by it is shown as SEQ ID NO.

2.

7. The use according to claim 6, characterized in that The plant is Arabidopsis thaliana.

8. The use according to claim 7, characterized in that The salt tolerance characteristic refers to the salt tolerance during the seed germination stage.

Images