Application of reagent for detecting markers in tilapia mossambica in preparation of detection product for detecting streptococcus agalactiae infection of tilapia mossambica

Abstract

The invention belongs to the technical field of bacterial infection reagents, and particularly relates to application of a reagent for detecting markers in tilapia in preparation of a detection product for detecting tilapia streptococcus agalactiae infection. According to the application disclosed by the invention, the expression levels of Hap and IL-6 in blood and Hep and IL-6 in spleen of the streptococcus agalactiae infected tilapia mossambica are more obviously changed compared with that of the tilapia mossambica which is not infected by the streptococcus agalactiae; whether tilapia is infected with streptococcus agalactiae or not can be accurately judged according to expression levels of Hap in tilapia blood, IL-6 in tilapia blood, Hep in tilapia spleen and IL-6 in tilapia spleen.

Description

Technical Field

[0001] The invention belongs to the technical field of bacterial infection reagents, and particularly relates to application of a reagent for detecting markers in tilapia in preparing a detection product for detecting tilapia Streptococcus agalactiae infection. Background Art

[0002] The acute phase reaction is a series of rapid physiological responses produced by the body in response to abnormal conditions such as injury, infection, and inflammation. These reactions can promote damage repair, eliminate pathogens, and ultimately restore homeostasis. In the reaction process, various cytokines such as IL-1, IL-6, TNF-α, etc. play an important role. They are produced by innate immune cells such as neutrophils and macrophages and regulate protein synthesis in hepatocytes. These cytokines then enter the plasma to participate in the acute phase reaction, so these cytokines are also called acute phase proteins. According to the different changes produced, acute phase proteins are generally divided into two categories: those whose expression increases by more than 25% after stimulation are called positive acute phase proteins, and those whose expression decreases by more than 25% after stimulation are called negative acute phase proteins. The changes in acute phase proteins between different species are roughly similar, but there are still great differences in specific characteristics. Therefore, different species have different major acute phase proteins, which may provide important information in disease diagnosis.

[0003] Many teleost fish have reported on their acute phase proteins, such as carp, rainbow trout, zebrafish, and channel catfish. In tilapia, Charlie-Silva et al. reported on the regulatory role of tilapia-related acute phase proteins after infection with Aeromonas hydrophila. In addition, the function and expression of heme-binding proteins in tilapia infected with Streptococcus agalactiae or Aeromonas hydrophila have also been reported. and Cengizler also found that there were certain changes in plasma acute phase proteins in tilapia infected with Streptococcus agalactiae. However, there is still a gap in the research on the infection of tilapia with Streptococcus agalactiae. Therefore, based on this model, the present invention measured the changes in the gene expression levels of several common acute phase proteins in serum, liver, spleen and brain tissues, and used these changes as important indicators for detecting whether tilapia is infected with Streptococcus agalactiae. This provides a new perspective for disease diagnosis methods. Summary of the invention

[0004] The present invention finds that the expression levels of Hap and IL-6 in the blood and Hep and IL-6 in the spleen of tilapia infected with Streptococcus agalactiae are more obvious than those of tilapia not infected with Streptococcus agalactiae, and Hap and IL-6 in the blood and Hep and IL-6 in the spleen can be used as markers of Streptococcus agalactiae infection.

[0005] In order to achieve the above object, the present invention can adopt the following technical solutions:

[0006] On the one hand, the present invention provides an application of a reagent for detecting markers in tilapia in preparing a detection product for detecting Streptococcus agalactiae infection in tilapia. The markers in tilapia include one or more combinations of the following markers: (a) Hap in tilapia blood; (b) IL-6 in tilapia blood; (c) Hep in tilapia spleen; and (d) IL-6 in tilapia spleen.

[0007] Preferably, the above-mentioned detection product includes a detection reagent, a detection kit or a microfluidic chip.

[0008] Preferably, the above detection reagent is a RT-qPCR detection reagent.

[0009] Preferably, the above detection kit is a RT-qPCR detection kit.

[0010] Preferably, in the above RT-qPCR,

[0011] The primer pair for detecting Hap is:

[0012] F:AAGGCTCTGTGTTAGCCTCC; R:GAATGGCCTCCCCGACTCTTC;

[0013] The primer pair for detecting Hep is:

[0014] F:CCATTTGCTGGGGTGCAAGA; R:GGAAAGATGGCTCTGACGCT;

[0015] The primer pair for detecting IL-6 is:

[0016] F:GTGTGGCAGGTGACTTCTCA; R:GGAAATGGTGCTCAAACGCT.

[0017] The beneficial effects of the present invention include at least: the present invention finds that the expression levels of Hap and IL-6 in the blood of tilapia infected with Streptococcus agalactiae and Hep and IL-6 in the spleen are more obvious than those of tilapia not infected with Streptococcus agalactiae; whether the tilapia is infected with Streptococcus agalactiae can be accurately judged by the expression levels of Hap in the blood of tilapia, IL-6 in the blood of tilapia, Hep in the spleen of tilapia and IL-6 in the spleen of tilapia. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the analysis of the conserved domains of 6 acute phase proteins;

[0019] Figure 2 The corresponding position distribution of each conserved motif in the acute phase protein;

[0020] Figure 3The identity percentage matrix analysis and phylogenetic tree of acute phase proteins are shown;

[0021] Figure 4 is the gene expression in different tissues of healthy tilapia, the ordinate represents 2 -ΔCt , ΔCt is the Ct difference between the test gene and the reference gene;

[0022] Figure 5 The gene expressions of acute phase proteins in liver, spleen, kidney, blood and brain at different time points (0-24h) after infection; different letters represent significant differences (p<0.05);

[0023] Figure 6 The gene expression of acute phase proteins in liver, spleen, kidney, blood and brain at different time points (0-72h) after infection; different letters represent significant differences (p<0.05). DETAILED DESCRIPTION

[0024] The examples are provided to better illustrate the present invention, but the present invention is not limited to the examples. Therefore, those skilled in the art may make non-essential improvements and adjustments to the implementation scheme according to the above invention content, which still fall within the protection scope of the present invention.

[0025] The terms used herein are only used to describe specific embodiments and are not intended to limit the present disclosure. Unless the context has a significantly different meaning, expressions in the singular include expressions in the plural. As used herein, it should be understood that terms such as "include", "have", "include" are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials or combinations. The terms of the present invention are disclosed in the specification, and are not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials or combinations thereof may exist or may be added. As used herein, " / " may be interpreted as "and" or "or", depending on the circumstances.

[0026] On the one hand, the present invention provides an application of a reagent for detecting markers in tilapia in preparing a detection product for detecting Streptococcus agalactiae infection in tilapia. The markers in tilapia include one or more combinations of the following markers: (a) Hap in tilapia blood; (b) IL-6 in tilapia blood; (c) Hep in tilapia spleen; and (d) IL-6 in tilapia spleen.

[0027] It should be noted that Streptococcus agalactiae belongs to the genera Bacillus, Lactobacillus and Streptococcus. Streptococcus agalactiae is a Gram-positive bacterium that can infect a variety of species, such as cattle, cats and crocodiles. In addition, people with weak immunity are also at risk of infection. Nile tilapia is a susceptible host of Streptococcus agalactiae among aquaculture species. It has been reported that outbreaks of tilapia agalactiae disease have occurred in China, Brazil, Thailand and other places, causing huge economic losses. If the Streptococcus agalactiae pathogen can be detected and corresponding measures can be taken before a large-scale outbreak of the disease, and potential losses can be minimized, it is likely to promote the further development of the tilapia farming industry.

[0028] It should also be noted that infection with Streptococcus agalactiae can cause significant changes in the expression levels of Cp, Hap, Hep, Hx, IL-1β, and IL-6 in the liver, spleen, kidney, blood, and brain of tilapia. Among them, the changes in Hap and IL-6 in the blood and Hep and IL-6 in the spleen are particularly obvious. The expression levels of these genes reached about 20 times the normal level after infection and lasted for 8 hours. Therefore, Hap and IL-6 in the blood, Hep and IL-6 in the spleen have the potential to be used as indicators for detecting Streptococcus agalactiae infection in tilapia.

[0029] It should also be noted that the present invention identified six related acute phase protein genes of Nile tilapia, namely Cp, Hap, Hep, Hx, IL-1β and IL-6, and analyzed their conserved motifs and two-dimensional topological structures of proteins. By measuring the changes in gene expression of these six acute phase proteins in the liver, spleen, kidney, blood and brain tissues of tilapia infected with Streptococcus agalactiae, it was used as an indicator for detecting Streptococcus agalactiae infection. The experimental results showed that in the tissues of healthy tilapia, the six acute phase proteins were distributed most in the intestine, followed by the liver. According to the RT-qPCR results, the expression levels of all detected genes in the test tissues changed significantly after infection. In addition, the changes in Hap and IL-6 in the blood, and Hep and IL-6 in the spleen were larger and lasted longer, making them more suitable as infection detection indicators.

[0030] In some specific examples, the above-mentioned detection products include detection reagents, detection kits or microfluidic chips.

[0031] It should be noted that the above-mentioned detection products may be products known in the art, such as detection reagents, detection kits or microfluidic chips.

[0032] In some specific examples, the above detection reagent is a RT-qPCR detection reagent.

[0033] In some specific examples, the above-mentioned detection kit is an RT-qPCR detection kit.

[0034] In some specific examples, in the above RT-qPCR,

[0035] The primer pair for detecting Hap is:

[0036] F:AAGGCTCTGTGTTAGCCTCC; R:GAATGGCCTCCCCGACTCTTC;

[0037] The primer pair for detecting Hep is:

[0038] F:CCATTTGCTGGGGTGCAAGA; R:GGAAAGATGGCTCTGACGCT;

[0039] The primer pair for detecting IL-6 is:

[0040] F:GTGTGGCAGGTGACTTCTCA; R:GGAAATGGTGCTCAAACGCT.

[0041] In order to better understand the present invention, the content of the present invention is further explained below in conjunction with specific examples, but the content of the present invention is not limited to the following examples.

[0042] In the following test, 40 healthy tilapia (about 16±1.0g) with uniform body shape were selected; before the experiment, the tilapia was cultured in a circulating water system for at least 2 weeks to adapt to the environment, the water temperature was controlled at 25°C, the pH value was maintained at 7.0-8.0, and the levels of dissolved oxygen, hydrogen sulfide and nitrite were checked regularly; commercial feed was fed 3 times a day at 2% of the total weight of the fish for 2 weeks; during the domestication process, dead fish and feces were cleaned up in time to keep the water clean; the Streptococcus agalactiae strain was isolated and preserved by this laboratory and confirmed by 16S sequencing before use.

[0043] In the following tests, the challenge and sampling included: inoculating Streptococcus agalactiae into brain heart infusion medium (formula: tryptone 10.0 g / L, beef heart infusion powder 17.5 g / L, sodium chloride 5.0 g / L, glucose 2.0 g / L, sodium hydrogen phosphate 2.5 g / L, pH = 7.4 ± 0.2, 25 ° C, purchased from: https: / / www.hopebiol.com / asphtml / product2130.htm) and incubating on a shaker at 37 ° C and 180 rpm for 12 hours; randomly selecting 3 healthy tilapia, collecting tail vein blood under sterile conditions, and dissecting and separating the liver, spleen and brain; the remaining fish were intraperitoneally injected with 100 μL of Streptococcus agalactiae solution (10 7CFU / mL). At 8 time points (1h, 2h, 4h, 6h, 12h, 24h, 48h and 72h) after S. agalactiae injection, three tilapia were randomly selected at each time point for blood collection, and the liver, spleen and brain were dissected. The same tissue samples of the three tilapia collected at the same time point were mixed in a centrifuge tube, and finally 9 groups of samples were collected, with 4 tissues in each group. Serum was collected after venous blood coagulation and stored at -20℃, and the remaining tissue samples were stored at -80℃.

[0044] In the following tests, total RNA extraction, reverse transcription, and RT-qPCR were performed according to the following steps:

[0045] Based on the gene sequences published on the NCBI website, primers for the following genes were designed ( Table 1 ): Hap, Hep, Cp, Hx, IL-1β, IL-6, and EF1α.

[0046] Table 1 Primers used in the examples of the present invention

[0047]

[0048]

[0049] The total RNA of each tissue was extracted by Trizol lysis method, as follows: the tissue sample was ground into a homogenate using an electric tissue grinder, and Trizol (Tsingke, China) was added to 1 ml; then 200 μL of chloroform was added, shaken, and allowed to stand at room temperature for 3 min; then, centrifuged at 12000 rpm for 15 min at 4°C, the upper aqueous phase was carefully aspirated into a new enzyme-free centrifuge tube, an equal volume of isopropanol was added, and gently mixed; after standing for 10 min, centrifuged again according to the above steps; the supernatant was discarded, and 1 mL of 75% anhydrous ethanol was added to wash the RNA precipitate; after centrifugation, the supernatant was discarded, and the residual ethanol was allowed to stand at room temperature for 5 min to completely evaporate; enzyme-free water was added to dissolve the precipitate. All RNA samples were stored at -80°C for future use.

[0050] The RNA was converted into cDNA using a cDNA reverse transcription kit (Yugong Biolabs, China); the experimental steps and reaction system were as follows: 3 μL total RNA, 1 μL dsDNase and 1 μL 10×dsDNase buffer were mixed in an enzyme-free PCR tube, and enzyme-free water was added to a total volume of 10 μL. Incubate at 37°C for 2 min, incubate at 65°C for 2 min, then add 4 μL ALL-in-One-first-strand Synthesis MasterMix to the above reaction solution, and add enzyme-free water to a total volume of 20 μL; incubate at 50°C for 15 min, and incubate at 85°C for 5 min before stopping the reaction; the obtained cDNA was stored at -80°C for future use.

[0051] The cDNA concentration was detected using a multifunctional microplate reader (BioTek) and diluted to 100 ng / μL with enzyme-free water. The instrument used for real-time fluorescence quantitative PCR was LightCycler 96 (Roche Diagnostics). The total reaction system was 10 μL, and the system components included: 1 μL cDNA, 0.5 μL forward and reverse primers, 3 μL enzyme-free water, and 5 μL Taq-HS SYBR Green qPCR Premix (Yugong Biology). The reaction procedure was as follows: 95°C pre-denaturation for 10 min, a total of 40 cycles (95°C denaturation for 15 s, 60°C annealing, and extension for 30 s), and melting curve analysis (uniform temperature increased from 60°C to 95°C, 2°C per minute). Each reaction was repeated 3 times to ensure the accuracy of the results. EF1α was used as the internal reference gene, and the Ct value was calculated using the 2-ΔΔCt method to obtain the relative expression level of the corresponding gene. One-way ANOVA was performed using GraphPad Prism 8.0 software, supplemented by LSD test. The data are expressed as mean ± standard deviation (SD), and different lowercase letters indicate statistical significance.

[0052] 1. Bioinformatics analysis of relevant acute phase proteins

[0053] The accession numbers of the amino acid sequences of the six acute phase proteins in NCBI are XP_003458996.1 (Cp), XP_003445796.2 (Hap), XP_003450578.1 (Hep), XP_003440941.1 (Hx), XP_019221386.1 (IL-1β), and XP_019205932.1 (IL-6).

[0054] The results of CDD analysis showed that the amino acid sequences of the six acute phase proteins all had conserved domains, namely, the cupredoxin superfamily domain in Cp, the trypsin serine protease superfamily domain in Hap, the hepcidin superfamily domain in Hep, the heme binding protein superfamily domain in Hx, the interleukin-1 superfamily domain in IL-1β, and the interleukin-6 superfamily domain in IL-6 ( Figure 1 ).

[0055] Conserved motif analysis showed that, except for Hep protein, the number of conserved motifs in other acute phase proteins was 5. In terms of the proportion of conserved motif length of each acute phase protein, each motif constituted 23.3% of Cp, 78.3% of Hap, 94.4% of Hep, 45.5% of Hx, 82.3% of IL-1β and 56.8% of IL-6 ( Figure 2 ).

[0056] 2. Sequence Similarity Analysis and Construction of Phylogenetic Tree

[0057] The results of identity percentage matrix analysis showed that Hep and IL-1β from Oreochromis niloticus had the highest homology with the corresponding proteins from Maylandia zebra; Hap had the highest homology with the corresponding proteins from Neolamprologus brichardi; Hx had the highest homology with the corresponding proteins from Simochromisdiagramma; Cp had the highest homology with the corresponding proteins from Pundamilia nyerei; IL-6 had the highest homology with the corresponding proteins from Sander lucioperca ( Figure 3 ). The results of phylogenetic tree analysis were consistent with those of identity percentage matrix analysis.

[0058] 3. Gene expression profile of healthy tilapia tissues

[0059] The expression levels of acute phase protein-related genes (Cp, Hap, Hep, Hx, IL-1β, IL-6) in various tissues (head kidney, gill, intestine, body kidney, blood, liver, spleen, brain) of healthy tilapia were detected by RT-qPCR. Figure 4 ). The expression of these six genes was detected in different tissues. However, there were significant differences in the expression levels of the same gene in different tissues. For example, compared with other tissues, the expression levels of Cp and Hap in the intestine, liver and brain were relatively high, and their expression levels were the lowest in the head kidney. The tissue with the highest expression levels of Hep, Hx, IL-1β and IL-6 was the intestine. Among these genes, except for IL-1β, which had the lowest expression level in the brain, the other three genes all reached the lowest expression levels in the blood.

[0060] 4. Changes in the expression of acute phase protein genes in the early stage of Streptococcus agalactiae infection

[0061] Expression of acute phase protein genes in tilapia within 24 hours of infection with Streptococcus agalactiae Figure 5 Generally speaking, if the expression of some genes changes significantly after infection, it indicates that they may be used as indicators for detecting S. agalactiae infection.

[0062] In the kidney, Cp expression showed dramatic fluctuations: significantly lower than normal levels at 1h, 4h and 24h after infection, and significantly higher than normal levels at 2h and 6h after infection. Except for the brain where expression was almost undetectable 2h after infection, Cp expression in other tissues was always above normal levels.

[0063] In the kidney, the expression level of Hap was mostly lower than normal. In the liver, spleen and blood, Hap expression was mostly higher than normal. In the brain, except for 2h and 4h after infection, Hap had no significant difference compared with normal levels. Hep in the blood showed significant upregulation most of the time after infection.

[0064] In the liver, spleen, and kidney, Hep expression levels dropped to a minimum around 1 h after infection and then increased again, essentially above normal levels. The trend of Hep expression in the brain was similar, but the minimum was reached 2 h after infection. Hx showed varying degrees of upregulation in the tissues tested: in the liver and kidney, a significant increase in expression levels was observed around 12 h after infection. In the brain, upregulation was concentrated between 1 and 4 h after infection.

[0065] In the blood, Hx expression levels were always significantly higher than normal levels, while in the spleen, significant upregulation of expression levels was only observed at 1h, 2h, and 6h after infection.

[0066] Within the first few hours of infection, IL-1β expression decreased in all tissues.

[0067] However, IL-1β expression levels rebounded rapidly at 4 or 6 hours after infection and most of them significantly exceeded normal levels. The expression patterns of IL-6 showed three types: in the liver, spleen and blood, the expression levels were always above normal levels; in the kidneys, the expression level first decreased and then increased; and in the brain, in contrast to the pattern in the kidneys, the IL-6 expression level first increased and then decreased.

[0068] 5. Changes in the expression of acute phase protein genes in the middle and late stages of Streptococcus lactis infection

[0069] RT-qPCR was used to detect the expression levels of six acute phase protein genes in tilapia 24, 48 and 72 h after infection with Streptococcus agalactiae. Figure 6). Among them, the expression of Cp in the liver, spleen and blood showed an increasing trend. However, in the kidney and brain, the expression level at 48h after infection was lower than that at 24h. In the liver, spleen and brain, the expression of Hap increased significantly at 24 and 48h after infection, and returned to normal levels at 72h after infection, while in the blood, Hap continued to show an upward trend. However, in the kidney, Hap was always lower than the normal level. The expression level of Hep increased to above the normal level at 24h and 48h after infection. At 72h after infection, the expression levels of Hep in different tissues were different. The expression level in the kidney was consistent with the normal level, while the expression level in the liver was significantly lower than the normal level. In the spleen, blood and brain, the expression level of Hep was still significantly higher than the normal level. The changing trends of the expression levels of Hx in different tissues were different. In the liver, the expression level of Hx showed a continuous upward trend and stabilized after 48h after infection. In spleen, blood and brain, Hx was significantly upregulated at 24h after infection, but it began to decrease to near normal levels from 48h and was significantly upregulated again at 72h. In kidney samples, Hx expression levels were not significantly different from normal levels at 24h, but increased significantly after 48h. For IL-1β, its expression level initially increased in kidney and then decreased to near normal levels. In other tissues, IL-1β expression levels showed a continuous significant increase in the first 48h after infection, and then decreased significantly at 72h. In fact, IL-1β expression in liver, spleen and brain decreased to undetectable levels. Finally, IL-6 expression levels in spleen and blood were always significantly higher than normal levels. In liver and kidney, IL-6 expression levels initially increased significantly and then decreased to near normal levels. In brain, IL-6 expression levels initially decreased significantly and then increased significantly.

[0070] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution of the present invention, which should be covered by the scope of the claims of the present invention.

Claims

1. Use of a reagent for detecting markers in tilapia in the preparation of a detection product for detecting Streptococcus agalactiae infection in tilapia, wherein the markers in tilapia include one or more combinations of the following markers: (a) Hap in tilapia blood; (b) IL-6 in tilapia blood; (c) Hep in tilapia spleen; (d) IL-6 in tilapia spleen.

2. The use according to claim 1, characterized in that: Detection products include detection reagents, detection kits or microfluidic chips.

3. The use according to claim 2, characterized in that: The detection reagent is RT-qPCR detection reagent.

4. The use according to claim 2, characterized in that: The detection kit is an RT-qPCR detection kit.

5. The use according to claim 3 or 4, characterized in that: In RT-qPCR, The primer pair for detecting Hap is: F: AAGGCTCTGTGTTAGCCTCC; R: GAATGGCCTCCCGACTCTTC; The primer pair for detecting Hep is: F: CCATTTGCTGGGGTGCAAGA; R: GGAAAGATGGCTCTGACGCT; The primer pair for detecting IL-6 is: F: GTGTGGCAGGTGACTTCTCA; R: GGAAATGGTGCTCAAACGCT.

Images