Glyceraldehyde-3-phosphate dehydrogenase B cell epitope and application thereof in detecting mycoplasma hyopneumoniae infection

Abstract

The invention discloses a B cell epitope on the surface of glyceraldehyde-3-phosphate dehydrogenase protein, a nucleic acid molecule of the B cell epitope and application of the B cell epitope to detection of mycoplasma hyopneumoniae infection. The B cell epitope can be expressed on the surface of an inert carrier S9 thallus in a functional exhibition mode, an LN7-antibody direct-mediated agglutination test detection method established based on the LN7 expressed on the surface of the S9 thallus in the functional exhibition mode is adopted, the LN7 only specifically recognizes a mycoplasma hyopneumoniae infected serum antibody and a vaccine immune serum antibody containing a GAPDH antigen, a specific binding reaction is conducted, and the mycoplasma hyopneumoniae infected serum antibody and the vaccine immune serum antibody containing the GAPDH antigen can be detected. And cross reaction and non-specific binding reaction with other mycoplasma pathogens, porcine respiratory disease pathogen infection serum and vaccine immune serum are avoided. The diagnosis method is expected to become an important technical means for accurate diagnosis of mycoplasma hyopneumoniae infection and monitoring and evaluation of the immune effect of the mycoplasma hyopneumoniae vaccine.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine and immune diagnosis and detection, and particularly relates to a glyceraldehyde-3-phosphate dehydrogenase B cell epitope and an application thereof in detecting Mycoplasma hyopneumoniae infection. Background Art

[0002] Enzootic pneumonia (EP) is a respiratory disease caused by infection with Mycoplasma hyopneumoniae (Mhp), which is also considered to be one of the main pathogens of porcine respiratory disease complex (PRDC), with wide prevalence and high incidence. Both domestic pigs and wild boars are susceptible, mainly affecting fattening and adult commercial pigs, resulting in reduced growth rate and feed conversion rate, and causing economic losses of up to $1 billion to the pig industry each year. Currently, commercial Mycoplasma hyopneumoniae vaccine immunization can only inhibit the colonization of Mycoplasma hyopneumoniae in the lower respiratory tract and prevent the spread between pathogen groups to a limited extent, while the continuous use of preventive drugs and the abuse of therapeutic drugs will lead to the generation of acquired resistance of Mycoplasma hyopneumoniae and increase the risk of food safety. In the face of the severe epidemic prevention and control situation, the purification of Mycoplasma hyopneumoniae pathogens should be an effective means of epidemic prevention and control. Detection / elimination methods are commonly used methods for disease purification. Existing methods for detecting Mycoplasma hyopneumoniae include isolation and culture of Mycoplasma hyopneumoniae pathogens, nucleic acid probe technology, PCR, and Enzyme linked immunosorbent assay (ELISA). The isolation and culture of Mycoplasma hyopneumoniae pathogens takes a long time and is easily contaminated by other microorganisms. Mycoplasma hyopneumoniae is one of the most difficult pathogens to isolate and culture. The number of pathogens in pigs after drug treatment or recovery is small, which greatly reduces the success rate of pathogen isolation. The trachea of ​​pigs is curved, and it is difficult to sample live with cotton swabs, which restricts the application of pathogen isolation and culture in live detection. The detection results of nucleic acid probe technology are easily interfered by Mycoplasma suis, which has a high homology with Mycoplasma hyopneumoniae, and are not suitable for live detection. Traditional PCR is not as sensitive as Real Time-PCR (RT-PCR), and RT-PCR detection is costly, requiring expensive instruments and systematically trained detection personnel. PCR technology also faces the problem of difficult sampling. The sample collection method and the limited distribution of samples seriously affect the detection results of PCR. The existing ELISA detection of serum antibodies has low specificity and is prone to cross-reaction with antibodies of Mycoplasma flocculus and Mycoplasma hyorhinis. In summary, these current detection methods have many shortcomings, which seriously restrict the accurate diagnosis and purification procedures of Mycoplasma hyopneumoniae. Therefore, a Mycoplasma hyopneumoniae detection method with strong specificity, high sensitivity, convenience and speed is needed.

[0003] Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a protease in the glycolysis reaction, composed of 4 30-40kDa subunits, with a molecular weight of about 146kDa. The enzyme is highly expressed in almost all tissues, and the expression level in the protein of the same cell is generally constant. Studies have found that the expression level in the strong strain of Mycoplasma hyopneumoniae is higher than that in the weak strain, indicating that GAPDH may be related to the virulence of Mhp. Recombinantly expressed r-GAPDH can bind to porcine kidney cells PK-15, and this binding process can be blocked by anti-r-GAPDH antibodies. GAPDH is stably expressed, expressed at all stages of the cell infection process, and on the surface of the bacteria, stimulating the body to produce an early immune response, and is an important adhesion virulence factor for Mhp. Therefore, GAPDH can be considered as the antigen detection target. However, the traditional classic serological detection method is based on the intact protein antigen as the detection antigen. Since the surface of the intact protein antigen includes antigenic epitopes that specifically recognize and bind to antibody reactions, there are also many redundant protein components, which are easy to cross-react with other components and different antibodies, resulting in non-specific reactions of the detection method. Screening specific B cell epitopes and constructing B cell epitope-mediated direct detection methods can effectively solve the problem of non-specific reactions and improve the specificity of the detection method. Summary of the invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide a highly specific and conserved B cell epitope on the surface of glyceraldehyde-3-phosphate dehydrogenase protein of Mycoplasma hyopneumoniae GAPDH.

[0005] The technical problem that the present invention needs to solve is to provide a nucleic acid molecule encoding the B cell epitope on the surface of the glyceraldehyde-3-phosphate dehydrogenase protein.

[0006] The technical problem that the present invention needs to solve is to provide a recombinant gene fragment or a recombinant protein encoding the recombinant gene fragment.

[0007] The technical problem that the present invention needs to solve is to provide an expression cassette, a recombinant vector, a recombinant cell or a recombinant strain.

[0008] The technical problem that the present invention needs to solve is to provide an anti-LN7 Mycoplasma hyopneumoniae specific antibody detection system.

[0009] The technical problem that the present invention needs to solve is to provide a method for constructing a recombinant vector or a recombinant strain.

[0010] The technical problem that the present invention also aims to solve is to provide the use of the B cell epitope, the nucleic acid molecule, the recombinant gene fragment, the expression cassette, the recombinant vector, the recombinant cell or the recombinant strain, and the anti-LN7 Mycoplasma hyopneumoniae specific antibody detection system in the preparation of a reagent or a kit for detecting anti-LN7 Mycoplasma hyopneumoniae specific antibodies.

[0011] The technical problem that the present invention also aims to solve is to provide a reagent or a kit for detecting anti-LN7 Mycoplasma hyopneumoniae specific antibodies.

[0012] Technical solution: In order to solve the above technical problems, the present invention provides a B cell epitope on the surface of glyceraldehyde-3-phosphate dehydrogenase protein, the amino acid sequence of the B cell epitope is LKDNGKN, referred to as LN7.

[0013] The present invention also includes a nucleic acid molecule encoding the B cell epitope on the surface of the glyceraldehyde-3-phosphate dehydrogenase protein, and the DNA sequence of the nucleic acid molecule is TTAAAAGATAACGGGAAAAAT, referred to as TT21.

[0014] The present invention also includes a recombinant gene fragment, which is a chimeric gene fragment obtained by inserting the nucleic acid molecule into a vector containing the Peg pili gene sequence. The sequence of the recombinant gene fragment is shown in SEQ ID NO.3 or SEQ ID NO.5.

[0015] SEQ ID NO.3 (recombinant PegA protein encoding gene):

[0016] ATGAAACGTTCACTTATTGCTGCTTCTGTATTGTCTGCTGTATTTATGAGCGCTGGGGTTTTTGCTGCTGATGAAGATATGGGGGAATTAAAAATAAACGGAGAAGTGGTGGGAACATCCTGTACTTTCGAAG GTGCAAATAGCGCGACTATTGAATTATCCCAGGTAGGTGTTGATAGATTGACTGACTTAAACCCTGGCGATATATATACAGGATACACTAGCCCAGAAGCGATTTTAAAAGTAAGATGTACGAATACAGCTAAT CCACGAATTAGTTTTAACCGTTCTCAATTTGTGGATAACATGCAAATCACCAAAAATAATGCTACTAATAATGGTGCGGGCTTCGCTGTTTATCTTGATGGTATTCAGTTAAAAGATAACGGGAAAAATAAGT TTGAACTGAATTCAAGTAAGTTTGAAAATGGTGTATATACCCTGAACTTTTCTGCCCGCTATGCCGCCGTTGAAAATACTGTAACACCAGGTTCTGTTGAATCTGTACTGACGATGACGGTATTAACTGATTAA

[0017] The present invention also includes a recombinant protein encoding the recombinant gene fragment, and the amino acid sequence of the recombinant protein is shown in SEQ ID NO.4.

[0018] SEQ ID NO.4 (recombinant PegA protein sequence):

[0019] MKRSLIAASVLSAVFMSAGVFAADEDMGELKINGEVVGTSCTFEGANSATIELSQVGVDRLTDLNPGDIYTGYTSPEAILKVRCTNTANPRISFNRSQFVDNMQITKNNATNNGAGFAVYLDGIQLKDNGKNKFELNSSKFENGVYTLNFSARYAAVENTVTPGSVESVLTMTVLTD

[0020] The present invention also includes an expression cassette, a recombinant vector, a recombinant cell or a recombinant strain, which contains the nucleic acid molecule or the recombinant gene fragment. The recombinant strain is obtained by introducing the recombinant vector into a carrier bacterium.

[0021] The present invention also includes an anti-LN7 Mycoplasma hyopneumoniae specific antibody detection system, which includes the expression cassette, recombinant vector, recombinant cell or recombinant strain.

[0022] The present invention also includes a method for constructing the recombinant vector, comprising the following steps:

[0023] (1) Obtaining the B cell epitope DNA sequence of GAPDH of Mycoplasma hyopneumoniae; the DNA sequence is TTAAAAGATAACGGGAAAAAT;

[0024] (2) Inserting the DNA sequence obtained in step (1) into a vector containing the Peg pili gene sequence to construct a recombinant vector.

[0025] Furthermore, the recombinant vector is constructed by inserting the nucleic acid molecule of the B cell epitope into the vector pBR322 plasmid containing the Peg pili encoding gene sequence to obtain the recombinant vector pBR-Peg-GAPDH-TT21 containing GAPDH-TT21.

[0026] The construction method comprises introducing the recombinant vector into the carrier bacteria by electrotransformation.

[0027] The present invention also includes the use of the B cell epitope, the nucleic acid molecule, the chimeric gene fragment, the expression cassette, the recombinant vector, the recombinant cell or the recombinant strain, and the anti-LN7 Mycoplasma hyopneumoniae-specific antibody detection system in the preparation of a reagent or a kit for detecting anti-LN7 Mycoplasma hyopneumoniae-specific antibodies.

[0028] The present invention also includes a reagent or kit for detecting anti-LN7 Mycoplasma hyopneumoniae-specific antibodies, wherein the reagent or kit comprises the B cell epitope, the recombinant protein, the expression cassette, the recombinant vector, the recombinant cell or the recombinant strain or the anti-LN7 Mycoplasma hyopneumoniae-specific antibody detection system.

[0029] Mechanism of the invention: The present invention uses bioinformatics software and structural biology technology to clarify that GAPDH is highly conserved in Mycoplasma hyopneumoniae, and the reported amino acid sequence analysis sequence identity is 99.4% ± 0.6%, which can be understood as complete conservation, and contains the conserved B cell epitope LKDNGKN (LN7). Therefore, based on the prediction, analysis and verification of the characteristic B cell epitope LKDNGKN (LN7) of GAPDH, the present application establishes a reagent or kit based on the LN7-antibody direct-mediated agglutination test to detect anti-LN7 Mycoplasma hyopneumoniae-specific antibodies in Mycoplasma hyopneumoniae infected or immunized pigs, providing a more convenient and quick Mycoplasma hyopneumoniae-specific antibody detection system, and verifies the specificity and sensitivity of the detection system.

[0030] Beneficial effects: Compared with the existing detection technology, the present invention has the following significant advantages: the B cell epitope LN7 of Mycoplasma hyopneumoniae described in the present invention comes from the conserved antigen epitope determinant cluster domain of GAPDH, and the functional specific B cell epitope is expressed by using Peg pili, and an agglutination test based on LN7-antibody direct mediation is established to detect anti-LN7 Mycoplasma hyopneumoniae specific antibodies in Mycoplasma hyopneumoniae infected or immunized pigs. The functional B cell epitope LN7 expressed on the surface of the bacteria specifically recognizes and binds to the antibody of the anti-GAPDH B cell epitope, thereby realizing specific, sensitive, convenient and fast detection or monitoring of Mycoplasma hyopneumoniae antibodies. The anti-LN7 Mycoplasma hyopneumoniae antibody detection system only has a specific recognition and binding reaction with Mycoplasma hyopneumoniae infected serum antibodies and vaccine immune serum antibodies containing the B cell epitope of GAPDH, and does not have cross-reactions and non-specific reactions with other mycoplasma antibodies, respiratory pathogens and other pathogen antibodies. In view of the strong specificity, high sensitivity and simple operation of the present invention, the detection results can be read out quickly and conveniently, and it is easy to promote in the clinical front line and use it for the detection of Mycoplasma hyopneumoniae antibodies in the breeding front line. It is expected to become a technology and platform for the early diagnosis of Mycoplasma hyopneumoniae infection, monitoring of vaccine immunity levels, and purification of Mycoplasma hyopneumoniae pathogens. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 , The results of bioinformatics analysis of GAPDH B cell epitopes of Mycoplasma hyopneumoniae. There are significant differences between the GAPDH amino acid sequences of Mycoplasma hyopneumoniae and other mycoplasmas and the GAPDH amino acid sequences in pig genes. The light yellow part of the first row shows the linear B cell epitope amino acid sequence of GAPDH of Mycoplasma hyopneumoniae provided by the present invention.

[0032] Figure 2, PCR amplification and identification electrophoresis of the complete operon gene of the recombinant vector peg-GAPDH-TT21 inserted into GAPDH-TT21. Lane M is Trans 2K Plus II DNA Marker, lane 1 is the genome of the avian pathogenic Escherichia coli isolate APEC-XM as a negative control; lane 2 is the PCR amplification product of the peg operon gene, and the template DNA comes from the standard strain of Salmonella pullorum CVCC 526 as a positive control; lane 3 is the PCR amplification product of peg-GAPDH-TT21 (4868bp).

[0033] Figure 3 , Electrophoresis diagram of enzyme digestion identification of the recombinant plasmid pBR-Peg-GAPDH-TT21 containing the peg-GAPDH-TT21 gene. Lane M is Trans 2K Plus II DNA Marker; Lane 1 is pBR322 circular plasmid; Lane 2 is pBR-Peg-GAPDH-TT21 circular plasmid; Lane 3 is the Nhe I and BamH I double enzyme digestion product of pBR-Peg-GAPDH-TT21.

[0034] Figure 4 , Schematic diagram of the recombinant plasmid pBR-Peg-GAPDH-TT21 containing GAPDH-TT21.

[0035] Figure 5 , The agglutination reaction results of the Mycoplasma hyopneumoniae specific antibody detection system S9-pBR-Peg-GAPDH-TT21 and the Peg pili empty vector control S9-pBR-Peg with Mycoplasma hyopneumoniae antibody positive serum and negative serum respectively. A: The agglutination reaction results of the Mycoplasma hyopneumoniae antibody detection system (right) and the control system (left) with the antibody positive serum after immunization with the Mycoplasma hyopneumoniae whole-cell vaccine, and the white arrows indicate the agglutinated particles; B: The Mycoplasma hyopneumoniae antibody detection system (right) and the control system (left) did not agglutinate with the SPF pig serum (without Mhp infection); C: The Mycoplasma hyopneumoniae antibody detection system (right) and the control system (left) did not agglutinate with the serum of 7-day-old pigs that were not immunized and had no clinical symptoms related to Mycoplasma hyopneumoniae; D: The Mycoplasma hyopneumoniae antibody detection system (right) and the control system (left) did not agglutinate with the serum positive for porcine reproductive and respiratory syndrome virus antibody; E: The Mycoplasma hyopneumoniae antibody detection system (right) and the control system (left) did not agglutinate with the Escherichia coli F4 monoclonal antibody; F: The Mycoplasma hyopneumoniae antibody detection system (right) and the control system (left) did not agglutinate with the serum positive for pseudorabies virus antibody. DETAILED DESCRIPTION

[0036] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are intended to describe specific specific embodiments rather than to limit the scope of protection of the present invention. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the examples, according to the technical staff of the present art's grasp of the prior art and the description of the present invention, any methods, equipment, and materials of the prior art that are similar or equivalent to the methods, equipment, and materials in the examples of the present invention can also be used to implement the present invention.

[0037] Example 1 Conservative comparison analysis of the GAPDH gene sequence of Mycoplasma hyopneumoniae

[0038] The GAPDH gene information of Mycoplasma hyopneumoniae was retrieved through the NCBI (https: / / www.ncbi.nlm.nih.gov / ) nucleic acid database (Nucleotide), and the GAPDH gene sequences of 11 strains of Mycoplasma hyopneumoniae were selected. Then, the GAPDH gene sequence of Mycoplasma Hyopneumoniae 168-L (Mycoplasma Hyopneumoniae 168-L, complete genome, GenBank accession number: AGM21810.1) (location: AGM21810.1: 38423-39433, the expression product was annotated as "Glyceraldehyde 3-phosphate dehydrogenase") was used as the reference sequence, and the amino acid sequences of the above 11 strains of Mycoplasma hyopneumoniae were aligned and data analyzed using bioinformatics software (DNAStar MegAlign). The results are shown in Table 1. The conservation of the amino acid sequence of Mycoplasma hyopneumoniae GAPDH is 99.4% ± 0.6%. The amino acid sequence of the regions with complete identity are 1-19, 21-174, 176-218, 220-307, 309-331. In addition, seven different mycoplasma representative strains of GAPDH amino acid sequences were selected for comparison, including the GAPDH sequence of Mycoplasma hyopneumoniae 168-L strain (GenBank accession number: AGM21810.1), the GAPDH sequence of Mycoplasma synoviae B1 strain (GenBank accession number: UTO26250.1), the GAPDH sequence of Mycoplasma hyorhinis 4236J19c strain (GenBank accession number: UVT32234.1), the GAPDH sequence of Mycoplasma hyopneumoniae NCTC10119 strain (GenBank accession number: VEU57030.1), and the GAPDH sequence of Mycoplasma synoviae B1 strain (GenBank accession number: UTO26250.1). The GAPDH sequences of Mycoplasma hyopneumoniae strain 168-L (GenBank accession number: AGM21810.1) were used as reference sequences. The GAPDH sequences of the seven mycoplasmas were 74.5%±15.7% identical. The amino acid sequences of the first six mycoplasmas in the above seven mycoplasmas were 66.65%±7.85% identical. The amino acid sequence of GAPDH of Mycoplasma hyopneumoniae 168-L strain (GenBank accession number: AGM21810.1) is 44.2% identical to the amino acid sequence of GAPDH of European wild boar (Sus scrofa) (GenBank accession number: NP001193288).The amino acid sequence of GAPDH of Mycoplasma hyopneumoniae 168-L strain (GenBank accession number: AGM21810.1) and the amino acid sequence of GAPDH of Mycoplasma suis ATCC 27399 strain (GenBank accession number: AJC49610.1) are 90.2% identical. Further analysis determined that the different sites of the GAPDH amino acid sequences of the two are amino acids 29, 40, 59, 60, 64, 73, 75, 80, 87, 91, 92, 113, 145, 146, 147, 197, 253-267, 277, 289, 301, 302, 314, 332, and 335. In order to ensure the specificity of the selected B cell epitope, the GAPDH-specific B cell epitope of Mycoplasma hyopneumoniae should contain the amino acids of the above variant sites, which are different from those of other mycoplasmas.

[0039] Table 1. Conservative analysis results of different GAPDH amino acid sequences

[0040]

[0041]

[0042] Example 2 Prediction of Conserved B Cell Epitopes of Mycoplasma hyopneumoniae GAPDH

[0043] The B cell epitope prediction tool of the Immunological Epitope Database (Bepipred Linear Epitope Prediction 2.0, http: / / tools.iedb.org / bcell / ) was used to predict the B cell linear epitopes contained in GAPDH of Mycoplasma hyopneumoniae. The above 8 different GAPDH amino acid sequences were compared and analyzed using MEGA 11 software. The analysis results of the two softwares were combined, such as Figure 1 As shown, a conserved and specific B cell epitope LKDNGKN (LN7) of Mycoplasma hyopneumoniae could be identified.

[0044] Example 3 Construction of Peg pili expression vector carrying the GAPDH conserved B cell epitope LN7 and verification of its functional expression

[0045] The DNA sequence TT21 of the conserved B cell epitope LN7 of GAPDH of Mycoplasma hyopneumoniae was inserted into the Peg fimbriae gene sequence of Salmonella pullorum to construct the recombinant vector pBR-Peg-GAPDH-TT21, which was introduced into Escherichia coli for amplification and expression, and the functional display of Peg-GAPDH-TT21 on the surface of the vector bacteria was verified.

[0046] The specific implementation procedure is as follows: Nanjing Qingke Biotechnology Co., Ltd. synthesized Peg (reference sequence is Salmonella enterica SP strain, GenBank accession number CP077668.1, 1831920-1827125) and GAPDH-TT21 chimeric gene, GAPDH-TT21 replaced the site AATTACACTCTGAATTCAAGT of the peg operon gene sequence, and the obtained chimeric gene was named peg-GAPDH-TT21. The peg-GAPDH-TT21 gene sequence is as follows: (SEQ ID NO.5)

[0047]

[0048] The primer information for peg operon amplification is as follows: upstream primer SP Peg Up: 5'-CGC GCTAGC ATGAAACGTTCACTTATTGCTGCT-3' downstream primer SP Peg Down: 5'-CGT GGATCC TTAATTATAAGATACCACGATTAATGC-3', the underlined sequences represent Nhe I and BamH I restriction enzyme sites, respectively. The above primers were synthesized by Nanjing Qingke Biotechnology Co., Ltd. The chimeric gene was used as a template (SEQ ID NO. 5, 1 μL, containing 1 ng of the chimeric gene), the APEC-XM genome of avian pathogenic Escherichia coli isolate (Liu Jiaqi, Wu Hucong, Yin Yi, Zhang Dong, Xia Pengpeng, Ren Wenkai, Zhu Guoqiang. Construction of a mouse model of neonatal Escherichia coli meningitis caused by avian Escherichia coli [J]. China Poultry, 2019, 41(10): 26-30.) was used as a negative control, and the genome of the standard strain of Salmonella pullorum CVCC 526 (purchased from China Veterinary Drug Administration, China Veterinary Microbiological Culture Collection Center) was used as a positive control. PCR amplification was performed using the upstream and downstream primers SP Peg Up / Down. The amplification system was: pfu high-fidelity DNA Polymerase (Beijing Quanshijin Biotechnology Co., Ltd., 2.5 U / μL) 2 μL, 5×pfu DNA polymerase buffer 10 μL, dNTPs 5μL, 2μL of upstream and downstream primers (10mM), 2μL of chimeric gene, APEC-XM genome or CVCC 526 genome (250ng / μL), 27μL of ultrapure water. After mixing the above system evenly, PCR amplification was performed using a thermal cycler (Bio-Red). The procedure was as follows: pre-denaturation at 94°C for 5min, amplification stage for a total of 30 cycles, including denaturation at 94°C for 30s; annealing at 52°C for 30s and extension at 72°C for 5min, further amplification at 72°C for 10min, and the temperature was lowered to 12°C after the amplification. A 1.5% agarose gel was prepared, and after electrophoresis at 110V for 45min, it was stained with ethidium bromide and imaged under a UV imager. The PCR results are shown in the figure. Figure 2 As shown, the amplified size of the positive control is 4850 bp; the PCR product of peg-GAPDH-TT21 is 4868 bp; and there is no amplified band in the negative control. The PCR amplified product (4868 bp) of peg-GAPDH-TT21 was recovered using a universal DNA purification kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0049] The PCR amplification product of Peg-GAPDH-TT21 and the pBR322 plasmid were double-digested with Nhe I and BamH I restriction endonucleases (NEB), and then the linear DNA fragments were ligated in a 16°C metal bath overnight with T4 DNA ligase (NEB). The next day, the ligation product was transformed into S9 competent cells (Zhu Guoqiang, Yang Bin, Yang Yang, Meng Xia, Xia Pengpeng, Duan Qiangde, Zhu Xiaofang, An inert carrier Salmonella and its potential application, national invention patent, patent number: ZL201910424369.8) to construct the recombinant engineered strain S9-pBR-Peg-GAPDH-TT21, and resistance screening was carried out by coating a solid medium containing 100 μg / mL ampicillin. Pick a single colony from the plate and inoculate it into LB liquid medium containing 100 μg / mL ampicillin to grow to the stationary phase. After the plasmid is recovered, it is double-digested with two restriction endonucleases, Nhe I and BamH I. Prepare a 1.5% agarose gel, electrophoresed at 110V for 45 minutes, stained with ethidium bromide, and imaged under a UV imager. The results are as follows: Figure 3 As shown, the Nhe I and BamH I double restriction digestion product of the recombinant plasmid pBR-Peg-GAPDH-TT21 contains a 4215 bp linear vector and a PCR amplification product Peg-GAPDH-TT21 linear DNA fragment of 4856 bp, which is consistent with the expected size. The schematic diagram of the expression vector pBR-Peg-GAPDH-TT21 plasmid is shown in Figure 4 shown.

[0050] The S9 engineered bacteria S9-pBR-Peg-GAPDH-TT21 carrying the recombinant plasmid pBR-Peg-GAPDH-TT21 were grown to the stationary phase in LB liquid medium containing 100 μg / mL ampicillin, centrifuged at 4000 rpm for 5 min, and the supernatant was discarded. The suspension was resuspended with an equal volume of sterile saline, and centrifuged and washed twice in this way to prepare a bacterial suspension (final concentration 1×10 10CFU / mL). The recombinant S9 engineered bacteria carrying the above recombinant plasmid were subjected to agglutination tests with Peg pili positive serum (10 copies, stored in this laboratory), Mycoplasma hyopneumoniae antibody negative serum (10 copies of SPF pig serum, provided by Zhejiang University Animal Hospital) and Mycoplasma hyopneumoniae antibody positive serum (10 copies of Mycoplasma hyopneumoniae vaccine immune serum, provided by Taizhou Huaweite Biopharmaceutical Co., Ltd.), and the bacterial suspension of S9 engineered bacteria S9-pBR-Peg containing pBR-Peg (Zhu Guoqiang, Yang Bin, Yang Yang, Meng Xia, Xia Pengpeng, Duan Qiangde, Zhu Xiaofang, A kind of inert carrier Salmonella and its potential application, national invention patent, patent number: ZL201910424369.8) was used as a control system. The results are shown in Table 2. Both bacterial suspensions had obvious agglutination reactions with Peg pili positive serum, indicating that the surface of S9 engineered bacteria successfully functionally displayed Peg pili. The bacterial suspensions of all strains did not react with the negative serum of Mycoplasma hyopneumoniae antibody; the recombinant S9 engineered bacteria suspension carrying the recombinant plasmid pBR-Peg-GAPDH-TT21 showed obvious agglutination with the positive serum of Mycoplasma hyopneumoniae antibody, with large agglutination particles and clear background; while the S9 engineered bacteria suspension containing only pBR-Peg did not agglutinate with the positive serum of Mycoplasma hyopneumoniae antibody, with no agglutination particles and turbid background. This result shows that the B cell epitope LN7 from the GAPDH protein of Mycoplasma hyopneumoniae can realize the functional expression of the bacterial surface through Peg pili, and can specifically detect antibodies against the B cell epitope LN7 of the GAPDH protein of Mycoplasma hyopneumoniae.

[0051] In this antibody detection system, S9-pBR-Peg bacterial suspension is used as a control system. The antibody detection system only adds the B cell epitope LN7, which specifically recognizes and binds to specific antibodies and excludes nonspecific reactions, thereby ensuring accurate individual diagnosis. S9-pBR-Peg-GAPDH-TT21 bacterial suspension is used as a Mycoplasma hyopneumoniae-specific antibody detection system, which can specifically recognize and bind antibodies against consistent conserved B cell epitopes in Mycoplasma hyopneumoniae GAPDH.

[0052] Table 2. Functional verification results of Peg-GAPDH-TT21 expressed on the surface of vector bacteria S9

[0053]

[0054] Note: “-” indicates negative agglutination reaction; “+” indicates positive agglutination reaction.

[0055] Example 4 Specificity and sensitivity test of Mycoplasma hyopneumoniae specific antibody detection system

[0056] Based on the functional verification of Peg-GAPDH-TT21 expressed on the surface of the vector bacteria S9, the specificity and sensitivity of the Mycoplasma hyopneumoniae specific antibody detection system were tested. The specific implementation procedures are as follows:

[0057] The control system S9-pBR-Peg bacterial suspension and the detection system S9-pBR-Peg-GAPDH-TT21 bacterial suspension were prepared according to the method described in Example 3. The above two bacterial suspensions were subjected to agglutination tests with sera with different background information to verify the specificity of the Mycoplasma hyopneumoniae antibody detection system. The sera involved in the test and their sources included: 10 sera from pigs immunized with round-worm bivalent vaccine (provided by Taizhou Huawei Biopharmaceutical Co., Ltd.), 5 sera from 7-day-old piglets that were not immunized and had no clinical symptoms (provided by Taizhou Huawei Biopharmaceutical Co., Ltd.), 7 sera from ducks infected with Escherichia coli (obtained by our laboratory using Escherichia coli F418 to infect SPF ducks), 1 Escherichia coli F4 monoclonal antibody (prepared and stored in our laboratory), 7 sera positive for Salmonella enterica serovar Gallus domesticus (stored in our laboratory), 6 sera positive for Escherichia coli in mice (obtained by our laboratory using Escherichia coli F418 to infect SPF mice), 20 clinical bovine sera (stored in our laboratory), 52 sera from SPF pigs (provided by Zhejiang University Animal Hospital), 5 sera positive for porcine reproductive and respiratory syndrome virus antibody (provided by Zhejiang Meibaolong Biotechnology Co., Ltd.), and 5 sera positive for pseudorabies virus antibody (provided by Zhejiang Meibaolong Biotechnology Co., Ltd.). The test results are shown in Table 3. The S9-pBR-Peg control system did not agglutinate with all the tested sera, and the S9-pBR-Peg-GAPDH-TT21 test system only agglutinated with serum positive for Mycoplasma hyopneumoniae antibodies, and did not agglutinate with serum positive for antibodies against other pathogens. Figure 5 .

[0058] Table 3. Results of specificity validation test of Mycoplasma hyopneumoniae specific antibody detection system

[0059]

[0060] Note: “-” indicates negative agglutination reaction; “+” indicates positive agglutination reaction;

[0061] The sensitivity test of the present invention is to determine the earliest detection time of Mycoplasma hyopneumoniae antibodies by detecting the pig serum at different days after immunization with Mycoplasma hyopneumoniae vaccine. The specific implementation procedure is as follows: the present invention is used to perform agglutination test on the serum collected before immunization (0 day) and 14 days, 21 days, and 28 days after immunization, 10 samples are collected each time, and a total of 40 samples of serum are collected. The serum determined to be positive continues to be diluted in multiples, that is, 20 μL of sterile saline is added to each well of the 96-well plate, and then 20 μL of Mycoplasma hyopneumoniae antibody-positive serum is drawn and added to the first well of each row. After being fully mixed with sterile saline, 20 μL of the diluted serum is drawn and added to the next well, and diluted to 2 5 The serum of each dilution was subjected to agglutination test with the control system S9-pBR-Peg bacterial suspension and the Mycoplasma hyopneumoniae antibody detection system S9-pBR-Peg-GAPDH-TT21 bacterial suspension, and the last dilution at which agglutinated particles appeared was taken as the titer of the serum agglutination antibody. The positive rate of the agglutination test is shown in Table 4.

[0062] Table 4. Results of sensitivity validation test of Mycoplasma hyopneumoniae specific antibody detection system

[0063]

[0064] As can be seen from Table 4, 80% (8 / 10) of the immune pig sera reacted positively with the S9-pBR-Peg-GAPDH-TT21 antibody detection system 14 days after immunization, indicating that specific antibodies can be detected 14 days after immunization, and the positive rate of agglutination test increases with the immunization time. Antibody titer detection shows that the antibody titer also increases with time within 28 days. In summary, the specificity and sensitivity of the Mycoplasma hyopneumoniae S9-pBR-Peg-GAPDH-TT21 antibody detection system of the present invention are good. Compared with the results reported by the current commercial antibody detection kit, the sensitivity of the present invention is significantly improved, and the specific antibody titer can be quantitatively detected.

Claims

1. A B cell epitope on the surface of glyceraldehyde-3-phosphate dehydrogenase protein, characterized in that: The amino acid sequence of the B cell epitope is LKDNGKN.

2. A nucleic acid molecule encoding a B cell epitope on the surface of the glyceraldehyde-3-phosphate dehydrogenase protein according to claim 1, characterized in that: The DNA sequence of the nucleic acid molecule is TTAAAAGATAACGGGAAAAAT.

3. A recombinant gene fragment, characterized in that: The recombinant gene fragment is a chimeric gene fragment obtained by inserting the nucleic acid molecule according to claim 2 into a vector containing the Peg pili gene sequence, and the sequence of the recombinant gene fragment is shown in SEQ ID NO.3 or SEQ ID NO.

5.

4. A recombinant protein encoding the recombinant gene fragment according to claim 3, characterized in that: The amino acid sequence of the recombinant protein is shown in SEQ ID NO.

4.

5. An expression cassette, a recombinant vector, a recombinant cell or a recombinant strain, characterized in that: It comprises the nucleic acid molecule according to claim 2 or the recombinant gene fragment according to claim 3, and the recombinant strain is obtained by introducing the recombinant vector into a carrier bacterium.

6. An anti-LN7 Mycoplasma hyopneumoniae specific antibody detection system, characterized in that: The anti-LN7 Mycoplasma hyopneumoniae-specific antibody detection system comprises the expression cassette, recombinant vector, recombinant cell or recombinant strain according to claim 5.

7. The method for constructing the recombinant vector according to claim 5, characterized in that: The following steps are involved: (1) Obtaining the B cell epitope DNA sequence of GAPDH of Mycoplasma hyopneumoniae; the DNA sequence is TTAAAAGATAACGGGAAAAAT; (2) Inserting the DNA sequence obtained in step (1) into a vector containing the Peg pilus gene sequence to construct a recombinant vector.

8. The method for constructing the recombinant strain according to claim 5, characterized in that: The construction method comprises introducing the recombinant vector of claim 5 into a carrier bacterium by electrotransformation.

9. Use of the B cell epitope according to claim 1, the nucleic acid molecule according to claim 2, the recombinant gene fragment according to claim 3, the expression cassette, recombinant vector, recombinant cell or recombinant strain according to claim 5, and the anti-LN7 Mycoplasma hyopneumoniae specific antibody detection system according to claim 6 in the preparation of a reagent or kit for detecting anti-LN7 Mycoplasma hyopneumoniae specific antibodies.

10. A reagent or kit for detecting anti-LN7 Mycoplasma hyopneumoniae-specific antibodies, characterized in that: The reagent or kit comprises the B cell epitope according to claim 1, the recombinant protein according to claim 4, the expression cassette, recombinant vector, recombinant cell or recombinant strain according to claim 5 or the anti-LN7 Mycoplasma hyopneumoniae specific antibody detection system according to claim 6.

Images