Use of flufenamic acid for the preparation of a medicament for the treatment of peripheral neuropathy

Abstract

The application provides application of flufenamic acid in preparation of a medicine for treating peripheral nerve adhesion diseases, and relates to the technical field of biomedicine, and the technical scheme is characterized in that: application of flufenamic acid (2-(3-trifluoromethyl anilino) benzoic acid) in preparation of a medicine for treating peripheral nerve adhesion diseases, the peripheral nerve adhesion diseases including sciatic nerve adhesion. The application provides application of flufenamic acid in preparation of a medicine for treating peripheral nerve adhesion diseases, and the application proves that 2-(3-trifluoromethyl anilino) benzoic acid (flufenamic acid, FFA, CAS: 530-78-9) can effectively promote the motor balance ability and nerve conduction rate of a mouse, promote recovery of adhesion nerves, and has a positive treatment effect on peripheral nerve adhesion diseases.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biomedical technology, and particularly relates to application of flufenamic acid in preparation of a drug for treating peripheral nerve adhesion diseases. BACKGROUND

[0002] The peripheral nervous system is widely distributed in the body and plays a role in signal transmission between target organs and the central nervous system. Peripheral nerve adhesion is a common clinical symptom, especially the adhesion of damaged nerves and muscles caused by accidents such as traffic accidents, wars, and earthquakes, which leads to diseases caused by the inability of nerve impulses to transmit.

[0003] In the prior art, the treatment scheme for peripheral nerve adhesion injury covers general treatment, drug treatment, physical treatment, surgical treatment, and rehabilitation treatment, aiming to promote nerve repair, reduce adhesion, restore function, and improve the quality of life of patients. Peripheral nerve adhesion injury is serious and needs to find specific drugs. SUMMARY

[0004] The present application aims to provide a drug for treating peripheral nerve adhesion injury.

[0005] In order to achieve the above-mentioned purpose, the present application adopts the following technical scheme:

[0006] Application of flufenamic acid (2-(3-trifluoromethyl aniline) benzoic acid) in preparation of a drug for treating peripheral nerve adhesion diseases.

[0007] Preferably, the peripheral nerve adhesion disease includes sciatic nerve adhesion.

[0008] Preferably, the flufenamic acid promotes motor balance ability and nerve conduction rate.

[0009] Preferably, the flufenamic acid is used to reduce nerve adhesion and relieve muscle atrophy.

[0010] The present application also provides a drug for treating peripheral nerve adhesion diseases, which contains flufenamic acid.

[0011] Preferably, the drug is one of an injection / powder or a capsule.

[0012] Compared with the prior art, the present application has the following beneficial effects:

[0013] The application provides application of flufenamic acid in preparation of a medicine for treating peripheral nerve adhesion diseases, and proves through specific verification experiments that 2-(3-trifluoromethyl anilino) benzoic acid (flufenamic acid, FFA, CAS: 530-78-9) can effectively promote the motor balance ability and nerve conduction rate of mice, promote the recovery of adhesion nerves, and has a positive treatment effect on peripheral nerve adhesion diseases. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 A photograph for comparing the adhesion degrees of the experimental group and the control group in an embodiment of the application;

[0015] Figure 2 A photograph for comparing the muscle atrophy differences of the experimental group and the control group in an embodiment of the application;

[0016] Figure 3 A rotarod test graph of the experimental group and the control group in an embodiment of the application;

[0017] Figure 4 An electrophysiological detection comparison graph of the experimental group and the control group in an embodiment of the application;

[0018] Figure 5 A nerve function index comparison graph of the experimental group and the control group in an embodiment of the application;

[0019] Figure 6 A myelin structure comparison graph of the experimental group and the control group in an embodiment of the application;

[0020] Figure 7 A related schematic diagram for proving that 2-(3-trifluoromethyl anilino) benzoic acid (flufenamic acid, FFA, CAS: 530-78-9) is beneficial to the development and repair of sciatic nerve myelin of mice in an embodiment of the application;

[0021] Figure 8 A related RNA expression level comparison graph in an embodiment of the application. DETAILED DESCRIPTION

[0022] The application will be further described in detail below in combination with specific embodiments.

[0023] Application of flufenamic acid (2-(3-trifluoromethyl anilino) benzoic acid) in preparation of a medicine for treating peripheral nerve adhesion diseases, wherein the peripheral nerve adhesion diseases include sciatic nerve adhesion.

[0024] The chemical formula of the flufenamic acid is C 14 H 10 F3NO2, and the structural formula is as follows:

[0025]

[0026] In an embodiment, the flufenamic acid promotes motor balance ability and nerve conduction rate.

[0027] The flufenamic acid is used to reduce nerve adhesion and relieve muscle atrophy.

[0028] Based on the application of flufenamic acid, the application further provides a medicine for treating peripheral nerve adhesion diseases, wherein the medicine contains flufenamic acid and is in the form of injection or powder.

[0029] The above content is described in combination with specific verification experiments.

[0030] Since the sciatic nerve is the most important and intuitive material for studying peripheral nerve adhesion, the sciatic nerve is used in the subsequent experiments in the application.

[0031] Experimental materials:

[0032] 2-(3-trifluoromethyl aniline) benzoic acid (flufenamic acid, FFA, CAS: 530-78-9), bovine serum albumin, glutaraldehyde, DMSO are purchased from Sigma Company, real-time quantitative PCR dye is purchased from Roche Biological Company, and primers are from Shanghai Shenguo Biological Company.

[0033] Example 1: Construction of sciatic nerve adhesion model

[0034] The mice used in the application are 8-week-old ICR mice purchased from Nanjing University Animal Center. The model is constructed as follows:

[0035] Subcutaneous injection of 3% sodium pentobarbital (1 mL / kg) for anesthesia. Incision of the skin below the hip, blunt dissection of the muscle with a fine surgical scissors and forceps, and exposure of the right sciatic nerve in the middle of the thigh.

[0036] 20 μL of adhesion agent (45% bovine serum albumin + 12% glutaraldehyde) is dropped between the sciatic nerve and the muscle to construct the sciatic nerve adhesion model.

[0037] Drug experiment group: intraperitoneal injection of 12.5 μg / g of flufenamic acid (FFA) for 7 consecutive days;

[0038] Control group: intraperitoneal injection of 20 μL of DMSO for 7 consecutive days.

[0039] All animal experiment schemes are approved by the Nantong University Animal Protection and Utilization Committee and the Jiangsu Province Animal Protection Ethics Committee. The establishment of the mouse sciatic nerve adhesion model is carried out in accordance with the approved guidelines.

[0040] Example 2: Observation of mouse adhesion and muscle atrophy

[0041] After 6 weeks of model construction, the sciatic nerve adhesion and muscle atrophy of the mice in the control group and the drug experimental group were compared to determine the effect of flufenamic acid (FFA) on nerve adhesion in mice. Subcutaneous injection of 3% sodium pentobarbital (1 ml / kg) was used for anesthesia. The skin below the hips was incised, and the skin and muscle tissue were separated to directly observe the phenotype differences between the two groups of mice.

[0042] See Figure 1 and Figure 2 , 2-(3-trifluoromethyl aniline) benzoic acid (flufenamic acid, FFA, CAS: 530-78-9) can effectively reduce the degree of nerve adhesion and alleviate muscle atrophy

[0043] Example 3: Animal behavior detection:

[0044] To determine the effect of FFA on the recovery of sciatic nerve adhesion in mice, we performed the rotarod test, electrophysiological test, and gait test.

[0045] The specific experimental steps are as follows:

[0046] Rotarod test: An accelerated rotating rod device (LE8500 type, Pan laboratory) was used. Before the test, the mice were allowed to acclimate in the test room for 30 minutes. The mice were gently placed on the rotating rod by gently swinging them, and trained for 3 days in an accelerated mode (4-40 rpm) at 3 and 5 minute intervals. Repeat training at a constant speed (16 rpm) until the mice can stay on the rod for at least 300 seconds. For the formal test, the mice were placed on the rotating drum, and the rotating rod was set to the accelerated mode, i.e., accelerated at a speed of 4 to 40 rpm within 5 minutes. The time spent moving on the rotating rod was recorded before measuring the fall.

[0047] Gait test: The gait dynamics of quadruped animals were evaluated by analyzing the footprints of mice using the Digigait imaging system. The hindlimb stride was evaluated at a speed of 8 cm / s. The footprints were analyzed by the following four measurement methods: distance from the contralateral foot, footprint length, maximum toe extension between the first and fifth toes, and claw extension between the centers of the second and fourth toes.

[0048] Electrophysiological experiment: In this study, mice were anesthetized with a compound anesthetic. Then, the conduction velocity (NCV) was measured using an electromyography device (Neuropack S1 MEB-9402, Nihon-Kohden, Tokyo, Japan). The needle electrode was inserted into the gastrocnemius muscle of the mouse, and the ground electrode was clamped on the exposed skin. The stimulation intensity was gradually increased from 0.1 mA to 3.0 mA, and the trigger waveform was used. The stimulation was performed at a frequency of 1 Hz for 1 ms. The corresponding data were recorded for further analysis. During the entire experiment, the body temperature of the mouse was maintained at 37°C ± 0.5°C using a heating lamp.

[0049] Motor behavior analysis: The changes in motor balance and nerve conduction rate of mice after FFA treatment were analyzed. The results showed that the motor balance of mice after FFA treatment recovered better, and the nerve conduction rate was faster. Figures 3-5

[0050] Example 4: Electron microscopy observation of sciatic nerve tissue

[0051] To further clarify the protective effect of FFA on sciatic nerve adhesion, the myelin sheath structure of the sciatic nerve of mice in different groups was observed by transmission electron microscopy. The specific steps are as follows:

[0052] Randomly selected 3 mice with sciatic nerve adhesion for 6 weeks in different groups (FFA treatment group and control group), under deep anesthesia, the sciatic nerve tissue at the adhesion site was taken and cut into electron microscopy specimen size (1.2 mm x 1 mm x 1 mm), immersed in 4% glutaraldehyde solution for fixation, 1% osmium acid for secondary fixation, uranyl acetate staining, gradient ethanol dehydration, epoxy resin embedding, semi-thin section positioning, ultrathin section with citric acid lead reagent, transmission electron microscopy observation. The obtained photos were measured on the image analysis system of the instrument to measure the diameter of the myelinated nerve and the diameter of the axon, and the thickness of the myelin sheath was measured by the value of the diameter of the axon / diameter of the myelinated nerve (g-ratio), so as to deduce the protective effect of FFA on damaged nerves.

[0053] Please refer to Figure 6 and Figure 7 , the myelin sheath structure of the adhesion nerve after drug treatment is more orderly, and the newly generated myelin sheath is thicker.

[0054] Example 5: Immune factor expression detection:

[0055] Long-term inflammation of the nerve is an important factor affecting the recovery of nerve adhesion. In order to confirm the biological mechanism of FFA regulating sciatic nerve adhesion, the effect of FFA on the expression of inflammatory factors was analyzed.

[0056] The specific steps are as follows:

[0057] ​Total RNA of sciatic nerve tissue was extracted using Trizol reagent of Invitrogen Company, and then first strand of cDNA was synthesized using reverse transcription kit of Roche Company. SYBR Green Supermix of Roche Company was used for gene expression analysis, and iQ5 Multicolor Real-Time PCR Detection System of Bio-Rad Company was used for instrument. mRNA level was calculated by 2 -△△Ct -ΔΔCt method. 18S housekeeping gene was used to calibrate mRNA level. The primer sequences used are as follows:

[0058] 18S rRNA forward primer: AGCTCCAATAGCGTATATTAAAG

[0059] 18S rRNA reverse primer: CGGTCCTATTCCATTATTCCTA

[0060] IL1α forward primer: GTGTTGCTGAAGGAGTTG

[0061] IL1α reverse primer: ATCTGGAAGTCTGTCATAGAG

[0062] IL12α forward primer: TTCTCCCATCACATCTCATC

[0063] IL12α reverse primer: TGCTCTTCTGCTAACACAT

[0064] TNFα forward primer: GCTTTCAACAACTACTCAGAA

[0065] TNFα reverse primer: GATCTTATCCAGCCTCATTCT

[0066] The results are shown in the following table: Figure 8 As shown in the table, FFA can effectively inhibit the expression of proinflammatory factors, significantly inhibit the occurrence and development of inflammation, maintain the immune microenvironment, and benefit the recovery of nerves.

[0067] In summary, the application provides the use of flufenamic acid in the preparation of drugs for treating peripheral nerve adhesion diseases. The specific verification experiments prove that 2-(3-trifluoromethyl aniline) benzoic acid (flufenamic acid, FFA, CAS: 530-78-9) can effectively promote the motor balance ability and nerve conduction rate of mice, promote the recovery of adhesion nerves, and has a positive therapeutic effect on peripheral nerve adhesion diseases.

Claims

1. The use of flufenamic acid in the preparation of a medicament for the treatment of peripheral nerve adhesion-related conditions.

2. The use of flufenamic acid according to claim 1 for the preparation of a medicament for the treatment of peripheral neuropathy-related diseases, characterized in that: The peripheral nerve adhesion-related conditions include sciatic nerve adhesion.

3. The use of flufenamic acid according to claim 1 for the preparation of a medicament for the treatment of peripheral neuropathy-related diseases, characterized in that: The flufenamic acid promotes motor balance ability and nerve conduction rate.

4. The use of flufenamic acid according to claim 1 for the preparation of a medicament for the treatment of peripheral neuropathy-related diseases, characterized in that: The flufenamic acid is used to reduce nerve adhesion and relieve muscle atrophy.

Images