Tri-fused ring compound as well as preparation method and application thereof

Abstract

The invention discloses a three-ring compound capable of being used as an SARM1 enzyme activity inhibitor and a preparation method and application thereof, and particularly discloses a compound shown in a formula (I), and the compound has excellent SARM1 enzyme inhibition activity and can be used for treating or preventing neurological diseases or symptoms mediated or related by SARM1 enzyme. # imgabs0 #

Description

Technical Field

[0001] The present invention relates to the field of medicine, and in particular to a tricyclic compound that can be used as a SARM1 enzyme activity inhibitor. The compound can be used to treat or prevent neurological diseases or conditions mediated by or related to the SARM1 enzyme. Background Art

[0002] Pathological axonal degeneration is an early and common sign of many neurodegenerative diseases. Axonal degeneration can further lead to the death and degeneration of nerve cell bodies, and is closely related to the occurrence of various neurodegenerative diseases, such as central nervous system diseases such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis, Huntington's disease, and peripheral nerve diseases caused by chemotherapy and diabetes.

[0003] Axon degeneration is a special programmed cell death process, which is different from traditional cell death pathways such as apoptosis, pyroptosis and necrosis. Current studies have shown that nicotinamide adenine dinucleotide (NAD+, a metabolite that plays a key role in energy metabolism and cell signaling) is essential for maintaining axon stability and integrity. Correspondingly, two proteases related to NAD+ metabolism play a key regulatory role in this process. Among them, NMNAT (Nicotinamide nucleotide adenylyltransferase) protein protects axons by synthesizing NAD+; on the contrary, Sarm1 (Sterile alpha and Toll / interleukin-1receptor motif-containing protein 1) protein promotes axon degeneration by degrading NAD+. The core position of SARM1 protein in axon degeneration makes it an important target for drug development for neurodegenerative diseases. If we can effectively inhibit its activity in degrading NAD+, weaken or even block axonal degeneration, and maintain the integrity of neuronal structure and function, it will be expected to inhibit the occurrence and development of various neurodegenerative diseases.

[0004] Currently, the existing treatment drugs for neurodegenerative diseases with high incidence, such as Parkinson's disease (PD) and Alzheimer's disease (AD), are symptomatic treatments and cannot alleviate or reverse the course of the disease. There are no effective treatments for nerve injury diseases, such as chemotherapy-induced peripheral neuropathy, diabetic peripheral neuropathy, traumatic brain injury, etc., and only analgesics can relieve pain. SIP1 regulators and other drugs cannot completely cure rare diseases such as multiple sclerosis and amyotrophic lateral sclerosis (ALS). Although there are dozens of drugs for the treatment of neurodegenerative diseases, they cannot reverse the condition of the disease and have very limited efficacy, resulting in a large number of unmet clinical needs. Therefore, the development of drugs for the treatment of neurodegenerative diseases has great clinical significance and social and economic value. Summary of the invention

[0005] The purpose of the present invention is to provide a novel SARM1 enzyme activity inhibitor.

[0006] In the first aspect of the present invention, there is provided a compound of formula (I), a stereoisomer, a tautomer or a pharmaceutically acceptable salt thereof,

[0007]

[0008] in,

[0009] W is selected from S and O;

[0010] Ring A is selected from C 3-8 Cycloalkyl and 3-8 membered heterocyclic group;

[0011] Ring B and Ring C are each independently selected from a 3-10 membered heterocyclic group, a C 6-10 Aryl and 5-10 membered heteroaryl;

[0012] X 1 Selected from -CR 5 R 6 -、-NR 7 -, -O- and bond; X 2 Selected from -CR 8 R 9 -、-NR 10 -, -O-, -S-, -SO-, -SO 2 -、C 3-8 Cycloalkyl and 3-8 membered heterocyclic group, the -CR 8 R 9 - one or more carbon atoms are optionally further selected from -O-, -S-, -SO-, -SO 2 -、-NR 10-、-C(O)-、-C(O)N(R 10 )-、-N(R 10 )C(O)-, -C(O)O-, -OC(O)-, -SO 2 N(R 10 )- and -N(R 10 )SO 2 - is replaced by a group;

[0013] Each R 1 are independently selected from hydrogen, deuterium, halogen, cyano, amino, C 1-6 Alkyl, halogenated C 1-6 Alkyl, hydroxy C 1-6 Alkyl, C 1-6 Alkoxy, halogenated C 1-6 Alkoxy and hydroxy C 1-6 Alkoxy;

[0014] Each R 2 are independently selected from hydrogen, deuterium, halogen, hydroxyl, amino, cyano, nitro, =O, =N-OH, C 1-6 Alkyl, C 3-8 Cycloalkyl, C 1-6 Alkoxy, -C(O)NH 2 and -C(O)OH, the above groups are optionally further substituted with one or more selected from deuterium, halogen, hydroxyl, cyano, nitro, azido, C 1-6 Alkyl, C 1-6 Alkoxy, C 3-8 Cycloalkyl, 3-8 membered heterocyclic group, C 6-10 substituted by aryl and 5-6 membered heteroaryl groups;

[0015] R 3 Selected from hydrogen, deuterium, cyano, hydroxyl, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-8 Cycloalkyl, 3-8 membered heterocyclic group, C 6-10 Aryl, 5-8 membered heteroaryl, -C(O)R 11 and -S(O) 2 R 11 ;

[0016] Each R 4 are independently selected from hydrogen, deuterium, halogen, cyano, hydroxyl, nitro, amino, azido, =O, C 1-6 Alkyl, C 1-6 Alkoxy, halogenated C 1-6 Alkyl and halogenated C 1-6 Alkoxy;

[0017] R 5, R 6 , R 7 , R 8 , R 9 , R 10 are each independently selected from hydrogen, deuterium, halogen, amino, hydroxyl, cyano, nitro, azido, C 1-6 Alkyl, halogenated C 1-6 Alkyl, hydroxy C 1-6 Alkyl, cyano C 1-6 Alkyl, C 1-6 Alkoxy, halogenated C 1-6 Alkoxy and -C(O)R 11 ;

[0018] or R 3 and R 5 The atoms directly connected to it and the atoms between them together form a 3-10 membered heterocyclic group, or R 3 and R 7 The atoms directly connected to it and the atoms between them together form a 3-10 membered heterocyclic group, or R 3 and R 8 The atoms directly connected to it and the atoms between them together form a 3-10 membered heterocyclic group, or R 3 and R 10 The atoms directly connected to it and the atoms between them together form a 3-10 membered heterocyclic group, or R 5 and R 9 Together with the atoms directly connected to it, they form C 3-8 Cycloalkyl or 3-10 membered heterocyclic group, or R 5 and R 10 The atoms directly connected to it together form a 3-10 membered heterocyclic group, and the above group is optionally further substituted by one or more selected from deuterium, halogen, cyano, nitro, hydroxyl, carbonyl, azido, C 1-6 Alkyl, C 1-6 Alkoxy, halogen substituted C 1-6 Alkyl, halogenated C 1-6 Alkoxy, deuterium substituted C 1-6 Alkyl, hydroxy substituted C 1-6 substituted by an alkyl substituent;

[0019] Each R 11 independently selected from hydrogen, deuterium and C 1-6 alkyl;

[0020] is a single bond or a double bond;

[0021] m and q are each independently selected from 0, 1, 2, 3 or 4;

[0022] n is selected from 0, 1, 2, 3, 4 or 5.

[0023] In another preferred embodiment, The structure is as follows:

[0024] in,

[0025] Y 1 , Y 2 , Y 3 Each independently is N or CR 1 , where R 1 As stated in this article;

[0026] Z 1 , Z 2 , Z 3 , Z 4 , Z 5 , Z 6 , Z 7 , Z 8 , Z 9 Each independently is CR 2 'R 2 ”, O, S, SO, SO 2 , CO and NR 12 ;

[0027] R 12 Selected from hydrogen, deuterium, C 1-6 Alkyl, halogenated C 1-6 Alkyl, C 1-6 Alkoxy and halogenated C 1-6 Alkoxy;

[0028] R 2 '、R 2 " are each independently selected from hydrogen, deuterium, halogen, hydroxyl, amino, cyano, nitro, =O, =N-OH, C 1-6 Alkyl, C 3-6 Cycloalkyl, C 1-6 Alkoxy, -C(O)NH 2 and -C(O)OH, the above groups are optionally further substituted with one or more selected from deuterium, halogen, hydroxyl, cyano, nitro, azido, C 1-6 Alkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, 3-6 membered heterocyclic group, C 6-8 aryl and 5-6 membered heteroaryl groups.

[0029] In another preferred embodiment, Y 1 , Y 2 , Y 3 One of them is CR 1, others are N or Y 1 , Y 2 , Y 3 One of them is N, and the others are CR 1 .

[0030] In another preferred embodiment, Y 2 N, Y 1 , Y 3 Each independently is CR 1 or N.

[0031] In another preferred embodiment, Y 1 , Y 2 , Y 3 Not N at the same time.

[0032] In another preferred embodiment, Y 2 N, Y 1 , Y 3 All CR 1 .

[0033] In another preferred embodiment, Y 2 N, Y 1 , Y 3 One of them is N and the other is CR 1 .

[0034] In another preferred embodiment, Z 1 , Z 2 All CR 2 'R 2 ”.

[0035] In another preferred embodiment, Z 3 , Z 4 , Z 5 One of them is O, S, SO, SO 2 、CO、NR 12 , others are CR 2 'R 2 ”.

[0036] In another preferred embodiment, Z 3 for O, S, SO, SO 2 、CO、NR 12 , Z 4 , Z 5 All CR 2 'R 2 ”.

[0037] In another preferred embodiment, Z 6 , Z 7 , Z 8 , Z 9 One of them is O, S, SO, SO2 、CO、NR 12 , others are CR 2 'R 2 ”.

[0038] In another preferred embodiment, Z 6 for O, S, SO, SO 2 、CO、NR 12 , Z 7 , Z 8 , Z 9 All CR 2 'R 2 ”.

[0039] In another preferred embodiment, ring B is selected from pyridyl and pyridazinyl.

[0040] In another preferred embodiment, Select from the following structures

[0041]

[0042] R 12 Selected from hydrogen, deuterium, C 1-6 Alkyl, halogenated C 1-6 Alkyl, C 1-6 Alkoxy and halogenated C 1-6 Alkoxy; m is each independently selected from 0, 1, 2 or 3;

[0043] R 1 , R 2 and q are as defined herein.

[0044] In another preferred embodiment, Selected from the following structures:

[0045]

[0046] R 12 Selected from hydrogen, deuterium, C 1-4 Alkyl, halogenated C 1-4 Alkyl, C 1-4 Alkoxy and halogenated C 1-4 Alkoxy; m is each independently selected from 0, 1, 2 or 3;

[0047] R 2 As defined in claim 1.

[0048] In another preferred embodiment, Selected from the following structures:

[0049]

[0050] In another preferred embodiment, the compound is selected from the following compounds:

[0051]

[0052] Among them, R 1 , R 4 As stated in this article,

[0053] Z 2 , Z 3 , Z 5 , Z 6 Each independently is CR 2 'R 2 ”, O, S, NR 12 , where R 2 '、R 2 ”、R 12 As stated in this article;

[0054] X 1 Selected from -CR 5 R 6 -, -NH- and bond; X 2 Selected from -CH 2 -, -NH-;

[0055] R 3 Selected from hydrogen, deuterium, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl;

[0056] R 5 , R 6 are each independently selected from hydrogen, deuterium, halogen, C 1-6 Alkyl, halogenated C 1-6 Alkyl, hydroxy C 1-6 Alkyl, C 1-6 Alkoxy, halogenated C 1-6 Alkoxy;

[0057] or R 3 and R 5 The atoms directly connected to it and the atoms between them together form a 5-membered heterocyclic group, or The structural unit is

[0058] And, the condition is that when Z 3 O, S or NR 12 When Z 5 CR 2 'R 2 "; When Z 5 O, S or NR 12 When Z 5 CR 2 'R 2”.

[0059] In another preferred embodiment, the compound is selected from the following compounds:

[0060]

[0061] R 12 Selected from hydrogen, deuterium, C 1-6 Alkyl, halogenated C 1-6 Alkyl, C 1-6 Alkoxy and halogenated C 1-6 Alkoxy;

[0062] Ring C, R 1 , R 2 , R 3 , R 4 , X 1 , X 2 , W, q, m and n are as defined herein.

[0063] In another preferred embodiment, the compound is selected from the following compounds:

[0064]

[0065] R 12 Selected from hydrogen, deuterium, C 1-4 Alkyl, halogenated C 1-4 Alkyl, C 1-4 Alkoxy and halogenated C 1-4 Alkoxy;

[0066] Ring C, R 2 , R 3 , R 4 , X 1 , X 2 , W, m and n are as defined herein.

[0067] In another preferred embodiment, each R 1 are independently selected from hydrogen, deuterium, halogen, cyano, amino, C 1-4 Alkyl, halogenated C 1-4 Alkyl, hydroxy C 1-4 Alkyl, C 1-4 Alkoxy, halogenated C 1-4 Alkoxy and hydroxy C 1-4 Alkoxy.

[0068] In another preferred embodiment, each R 1 are independently selected from the group consisting of hydrogen, deuterium, amino, fluorine, chlorine, bromine, methyl, ethyl, propyl, isopropyl, trifluoromethyl, difluoromethyl, fluoromethyl, trifluoroethyl, difluoroethyl, fluoroethyl, methoxy, ethoxy, isopropoxy, trifluoromethoxy, difluoromethoxy, fluoromethoxy, trifluoroethoxy, difluoroethoxy, and fluoroethoxy.

[0069] In another preferred embodiment, each R 2 , R 2 '、R 2 ”、R 12 are independently selected from hydrogen, deuterium, halogen, hydroxyl, amino, cyano, C 1-4 Alkyl, =O, =N-OH, C 3-6 Cycloalkyl, C 1-4 Alkoxy, -C(O)NH 2 and -C(O)OH, the above groups are optionally further substituted with one or more selected from deuterium, halogen, hydroxyl, cyano, nitro, azido, C 1-4 Alkyl, C 1-4 Alkoxy, C 3-6 Cycloalkyl, 3-6 membered heterocyclic group and C 6-8 substituted with an aromatic group;

[0070] Preferably, each R 2 , R 2 '、R 2 ”、R 12 are independently selected from hydrogen, deuterium, halogen, hydroxyl, amino, cyano, C 1-6 Alkyl, =O, =N-OH, C 3-6 Cycloalkyl, C 1-6 Alkoxy, -C(O)NH 2 , -NHR' and -C(O)OH, wherein R' is independently deuterium, halogen, hydroxyl, cyano, nitro, C 1-6 Alkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, 3-6 membered heterocyclic group and C 6-8 Aryl.

[0071] Preferably, each R 2 , R 2 '、R 2 ”、R 12 independently selected from hydrogen, deuterium, fluorine, chlorine, bromine, cyano, nitro, hydroxyl, amino, fluorine, chlorine, bromine, =O, =N-OH, methyl, ethyl, propyl, isopropyl, trifluoromethyl, difluoromethyl, fluoromethyl, trifluoroethyl, difluoroethyl, fluoroethyl, methoxy, ethoxy, isopropoxy, trifluoromethoxy, difluoromethoxy, fluoromethoxy, trifluoroethoxy, difluoroethoxy, fluoroethoxy, methylamino, -C(O)NH 2 and -C(O)OH, or selected from

[0072] In another preferred embodiment, X 1 Selected from -CR 5 R 6 -、-NR7 -, -O- and bond; X 2 Selected from -CR 8 R 9 -、-NR 10 -, -O-, -S-, -SO-, -SO 2 -、C 3-6 Cycloalkyl and 3-6 membered heterocyclic groups.

[0073] In another preferred embodiment, R 3 Selected from hydrogen, deuterium, cyano, C 1-4 Alkyl, 3-6 membered heterocyclic group, C 5-6 Aryl, 5-6 membered heteroaryl, -C(O)R 11 and -S(O) 2 R 11 .

[0074] In another preferred embodiment, R 5 , R 6 , R 7 , R 8 , R 9 , R 10 are each independently selected from hydrogen, deuterium, halogen, amino, hydroxyl, cyano, C 1-4 Alkyl, halogenated C 1-4 Alkyl, hydroxy C 1-4 Alkyl, cyano C 1-4 Alkyl, C 1-4 Alkoxy, halogenated C 1-4 Alkoxy and -C(O)R 11 , or R 3 and R 5 The atoms directly connected to it and the atoms between them together form a 3-8 membered heterocyclic group, or R 3 and R 7 The atoms directly connected to it and the atoms between them together form a 3-8 membered heterocyclic group, or R 3 and R 8 The atoms directly connected to it and the atoms between the atoms connected to it together form a 3-8 membered heterocyclic group.

[0075] In another preferred embodiment, each R 11 are independently selected from hydrogen and C 1-6 alkyl.

[0076] In another preferred embodiment, R 3 Selected from hydrogen, deuterium, cyano, C 1-6 Alkyl and -C(O)R 11 .

[0077] In another preferred embodiment, R 3 With R 3Directly connected nitrogen atoms, C(W) and R 5 With R 5 The directly connected carbon atoms together form a 3-8 membered heterocyclic group.

[0078] In another preferred embodiment, R 3 With R 3 Directly connected nitrogen atoms, C(W) and R 7 With R 7 The directly connected N atoms together form a 3-8 membered heterocyclic group.

[0079] In another preferred embodiment, R 3 With R 3 Directly connected nitrogen atoms, C(W), X 1 and R 8 With R 8 The directly connected carbon atoms together form a 4-8 membered heterocyclic group.

[0080] In another preferred embodiment, R 3 With R 3 Directly connected nitrogen atoms, C(W), X 1 and R 10 With R 10 The directly connected nitrogen atoms together form a 4-8 membered heterocyclic group.

[0081] In another preferred embodiment, X 1 Selected from -CR 5 R 6 、-NR 7 - and key; X 2 Selected from -CR 8 R 9 -、-NR 10 -、-O-、-S-、-SO 2 -、C 3-6 Cycloalkyl and 3-6 membered heterocyclic groups.

[0082] In another preferred embodiment, R 3 is selected from hydrogen, methyl, ethyl, n-propyl, isopropyl and -C(O)R 11 .

[0083] In another preferred embodiment, R 5 , R 6 , R 7 , R 8 , R 9 , R 10 are each independently selected from hydrogen, fluorine, chlorine, bromine, amino, methyl, ethyl, hydroxymethyl, hydroxyethyl and -C(O)R 11 , or R 3 and R 5The atoms directly connected to it and the atoms between them together form a 3-6 membered heterocyclic group, or R 3 and R 7 The atoms directly connected to it and the atoms between them together form a 3-6 membered heterocyclic group, or R 3 and R 8 The atoms directly connected to it and the atoms between the atoms connected to it together form a 3-6 membered heterocyclic group.

[0084] In another preferred embodiment, R 11 Selected from methyl and ethyl.

[0085] In another preferred embodiment, the structural unit Selected from the following groups:

[0086]

[0087] In another preferred embodiment, ring C is selected from 3-10 membered heterocyclic group, C 6-8 Aryl and 5-10 membered heteroaryl.

[0088] In another preferred embodiment, ring C is selected from 5-10 membered heterocyclic group, C 6-8 Aryl and 5-10 membered heteroaryl.

[0089] In another preferred embodiment, each R 4 are independently selected from hydrogen, deuterium, hydroxyl, halogen, cyano, nitro, amino, C 1-4 Alkyl, C 1-4 Alkoxy, halogenated C 1-4 Alkyl and halogenated C 1-4 Alkoxy.

[0090] In another preferred embodiment, ring C is selected from phenyl, pyridyl, thienyl and

[0091] In another preferred embodiment, each R 4 are independently selected from the group consisting of hydrogen, deuterium, hydroxy, amino, fluorine, chlorine, bromine, cyano, methyl, ethyl, propyl, isopropyl, trifluoromethyl, difluoromethyl, fluoromethyl, trifluoroethyl, difluoroethyl, fluoroethyl, methoxy, ethoxy, isopropoxy, trifluoromethoxy, difluoromethoxy, fluoromethoxy, trifluoroethoxy, difluoroethoxy and fluoroethoxy.

[0092] In another preferred embodiment, W, ring A, ring B, R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R9 , R 10 Each is independently the corresponding group in Compounds 1-53 in Examples.

[0093] In another preferred embodiment, the compound is selected from the following compounds:

[0094]

[0095]

[0096]

[0097]

[0098]

[0099] In another preferred embodiment, the compound is selected from the following compounds:

[0100]

[0101]

[0102]

[0103]

[0104]

[0105] In the second aspect of the present invention, a pharmaceutical composition is provided, comprising the compound according to the first aspect of the present invention, its stereoisomers, tautomers or pharmaceutically acceptable salts thereof and a pharmaceutically acceptable carrier.

[0106] In the third aspect of the present invention, there is provided use of the compound described in the first aspect of the present invention, its stereoisomer, tautomer or pharmaceutically acceptable salt thereof, or the pharmaceutical composition in the second aspect of the present invention in the preparation of a medicament for treating and / or preventing diseases mediated or related to the SARM1 enzyme.

[0107] In another preferred embodiment, the disease mediated or associated with the SARM1 enzyme is a neurological disease or disorder.

[0108] In another preferred embodiment, the neurological disease or disorder is selected from the group consisting of Alzheimer's disease, Parkinson's disease, multiple sclerosis, amyotrophic sclerosis, peripheral neuropathy, or a combination thereof.

[0109] In the fourth aspect of the present invention, there is provided the use of the compound described in the first aspect of the present invention, its stereoisomers, tautomers or pharmaceutically acceptable salts thereof or the pharmaceutical composition in the second aspect of the present invention in the preparation of a medicament for preventing and / or treating neurological diseases or conditions.

[0110] In the fifth aspect of the present invention, there is provided the use of the compound described in the first aspect of the present invention, its stereoisomers, tautomers or pharmaceutically acceptable salts thereof or the pharmaceutical composition in the second aspect of the present invention in the preparation of drugs for preventing and / or treating Alzheimer's disease, Parkinson's disease, multiple sclerosis, amyotrophic sclerosis and / or peripheral neuropathy.

[0111] In the sixth aspect of the present invention, a SARM1 enzyme inhibitor is provided, wherein the inhibitor comprises the compound according to the first aspect of the present invention, its stereoisomer, tautomer or pharmaceutically acceptable salt thereof or the pharmaceutical composition according to the second aspect of the present invention.

[0112] In the seventh aspect of the present invention, a method for treating and / or preventing diseases mediated or associated with the SARM1 enzyme is provided, the method comprising: administering to a subject in need thereof the compound of the first aspect of the present invention, its stereoisomers, tautomers or pharmaceutically acceptable salts thereof, or the pharmaceutical composition of the second aspect of the present invention.

[0113] In another preferred embodiment, the disease mediated or associated with the SARM1 enzyme is a neurological disease or disorder.

[0114] In another preferred embodiment, the neurological disease or disorder is selected from the group consisting of Alzheimer's disease, Parkinson's disease, multiple sclerosis, amyotrophic sclerosis, peripheral neuropathy, or a combination thereof.

[0115] In another preferred embodiment, the subject includes a human or a non-human mammal.

[0116] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. DETAILED DESCRIPTION

[0117] The present inventors have conducted extensive and in-depth research, and through a large number of screenings and tests, provided a class of novel SARM1 enzyme activity inhibitors, on the basis of which the present invention was completed.

[0118] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0119] As used herein, "comprising" or "including" may be open, semi-closed, or closed. In other words, the term also includes "consisting essentially of" or "consisting of."

[0120] The term "alkyl" refers to a straight or branched saturated aliphatic hydrocarbon group, preferably a straight or branched alkyl group having 1 to 10, 1 to 6, or 1 to 4 carbon atoms, including, but not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, 1,1-dimethylpropyl, 1,2-dimethylpropyl, 2,2-dimethylpropyl, 1-ethylpropyl, 2-methylbutyl, 3-methylbutyl, n-hexyl, 1-ethyl-2-methylpropyl, 1,1,2-trimethylpropyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl, 2,2-dimethylbutyl, 1,3-dimethylbutyl, 2-ethylbutyl, 2-methylpentyl, , 3-methylpentyl, 4-methylpentyl, 2,3-dimethylbutyl, n-heptyl, 2-methylhexyl, 3-methylhexyl, 4-methylhexyl, 5-methylhexyl, 2,3-dimethylpentyl, 2,4-dimethylpentyl, 2,2-dimethylpentyl, 3,3-dimethylpentyl, 2-ethylpentyl, 3-ethylpentyl, n-octyl, 2,3-dimethylhexyl, 2,4-dimethylhexyl, 2,5-dimethylhexyl, 2,2-dimethylhexyl, 3,3-dimethylhexyl, 4,4-dimethylhexyl, 2-ethylhexyl, 3-ethylhexyl, 4-ethylhexyl, 2-methyl-2-ethylpentyl, 2-methyl-3-ethylpentyl or various branched chain isomers thereof. “C 1-10 "Alkyl" refers to straight chain alkyl and branched chain alkyl groups including 1 to 10 carbon atoms. 1-4 The term "alkyl" refers to straight chain alkyl groups and branched chain alkyl groups having 1 to 4 carbon atoms.

[0121] The alkyl group may be optionally substituted or unsubstituted. When substituted, the substituents are preferably one or more (preferably 1, 2, 3 or 4) of the following groups independently selected from deuterium, halogen, cyano, nitro, azido, C 1-10 Alkyl, C 2-10 Alkenyl, C 2-10 Alkynyl, halogen substituted C 1-10 Alkyl, deuterium substituted C 1-10 Alkyl, C 3-12 Cycloalkyl, 3-12 membered heterocyclic group, C 6-10 Aryl, 5-10 membered heteroaryl, =O, -SF 5 、-S(O) r R 13 、-OR 14 、-C(O)OR 14 、-C(O)R 15 、-OC(O)R15 、-NR 16 R 17 、-C(=NR 16 )R 15 、-N(R 16 )-C(=NR 17 )R 15 、-C(O)NR 16 R 17 and -N(R 16 )-C(O)R 15 substituted by a substituent.

[0122] "Alkylene" refers to a straight or branched chain saturated aliphatic group having a specified number of carbon atoms and connecting at least two other groups, i.e., a divalent hydrocarbon group. The two groups connected to the alkylene group can be connected to the same or different atoms on the alkylene group. For example, a straight chain alkylene group can be -(CH 2 ) n -, wherein n is 1, 2, 3 or 4. Representative alkylene groups include, but are not limited to, methylene, ethylene, propylene, isopropylene, butylene, isobutylene, and sec-butylene.

[0123] "Cycloalkyl" or "carbocycle" refers to a saturated or partially unsaturated monocyclic or polycyclic hydrocarbon substituent, wherein the partially unsaturated cyclic hydrocarbon refers to a cyclic hydrocarbon that may contain one or more (preferably 1, 2 or 3) double bonds, but no ring has a completely conjugated π electron system, and the cycloalkyl group is divided into a monocyclic cycloalkyl group and a polycyclic cycloalkyl group, preferably a cycloalkyl group containing 3 to 12, 3 to 8 or 3 to 6 carbon atoms, for example, "C 3-12 "Cycloalkyl" refers to a cycloalkyl group containing 3 to 12 carbon atoms. 3-6 "Cycloalkyl" refers to a cycloalkyl radical comprising 3 to 6 carbon atoms, wherein:

[0124] Monocyclic cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cyclohexadienyl, cycloheptyl, cycloheptatrienyl, cyclooctyl, and the like.

[0125] Polycyclic cycloalkyl groups include cycloalkyl groups of spiro rings, fused rings and bridged rings. "Spiroalkyl" refers to a polycyclic group in which a carbon atom (called a spiro atom) is shared between the single rings. These may contain one or more (preferably 1, 2 or 3) double bonds, but no ring has a completely conjugated π electron system. Spiroalkyl groups are divided into monospiroalkyl, dispiroalkyl or polyspiroalkyl groups according to the number of spiro atoms shared between the rings. Spiroalkyl groups include but are not limited to:

[0126]

[0127] "Fused cycloalkyl" refers to a full-carbon polycyclic group in which each ring in the system shares a pair of adjacent carbon atoms with other rings in the system, wherein one or more rings may contain one or more (preferably 1, 2 or 3) double bonds, but no ring has a completely conjugated π electron system. According to the number of constituent rings, it can be divided into bicyclic, tricyclic, tetracyclic or polycyclic fused cycloalkyl, and fused cycloalkyl includes but is not limited to:

[0128]

[0129] "Bridged cycloalkyl" refers to a full-carbon polycyclic group in which any two rings share two carbon atoms that are not directly connected. These may contain one or more (preferably 1, 2 or 3) double bonds, but none of the rings has a completely conjugated π electron system. According to the number of constituent rings, it can be divided into bicyclic, tricyclic, tetracyclic or polycyclic bridged cycloalkyl. Bridged cycloalkyl includes but is not limited to:

[0130]

[0131] The cycloalkyl ring may be fused to an aryl, heteroaryl or heterocycloalkyl ring, wherein the ring connected to the parent structure is a cycloalkyl, including but not limited to indanyl, tetrahydronaphthyl, benzocycloheptanyl and the like.

[0132] Cycloalkyl may be optionally substituted or unsubstituted. When substituted, the substituents are preferably one or more (preferably 1, 2, 3 or 4) of the following groups independently selected from deuterium, halogen, cyano, nitro, azido, C 1-10 Alkyl, C 2-10 Alkenyl, C 2-10 Alkynyl, halogen substituted C 1-10 Alkyl, deuterium substituted C 1-10 Alkyl, C 3-12 Cycloalkyl, 3-12 membered heterocyclic group, C 6-10 Aryl, 5-10 membered heteroaryl, =O, -SF 5 、-SF 5 、-S(O) r R 13 、-OR 14 、-C(O)OR 14 、-C(O)R 15 、-OC(O)R 15 、-NR 16 R 17 、-C(=NR 16 )R 15 、-N(R 16 )-C(=NR 17 )R 15 、-C(O)NR 16 R 17 and -N(R16 )-C(O)R 15 substituted by a substituent.

[0133] "Heterocyclyl" or "heterocycle" refers to a saturated or partially unsaturated monocyclic or polycyclic hydrocarbon substituent, wherein the partially unsaturated cyclic hydrocarbon refers to a cyclic hydrocarbon that may contain one or more (preferably 1, 2 or 3) double bonds, but no ring has a completely conjugated π electron system, wherein one or more (preferably 1, 2, 3 or 4) ring atoms are selected from nitrogen, oxygen or S(O) r (where r is an integer of 0, 1, or 2) but not including the ring portion of -OO-, -OS-, or -SS-, and the remaining ring atoms are carbon. The C and N atoms in the heterocyclic group may be optionally oxidized to form C=O, N + -O - Structure. Preferably, the heterocyclic group includes 3 to 12, 3 to 8 or 3 to 6 ring atoms, for example, "3-6 membered heterocyclic group" refers to a ring group containing 3 to 6 ring atoms, "4-6 membered heterocyclic group" refers to a ring group containing 4 to 6 ring atoms, "4-10 membered heterocyclic group" refers to a ring group containing 4 to 10 ring atoms, and "3-12 membered heterocyclic group" refers to a ring group containing 3 to 12 ring atoms.

[0134] Monocyclic heterocyclyl groups include, but are not limited to, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, homopiperazinyl, oxetanyl, tetrahydrofuranyl, and the like.

[0135] Polycyclic heterocyclic groups include spiro, fused and bridged heterocyclic groups. "Spiro heterocyclic group" refers to a polycyclic heterocyclic group in which the single rings share one atom (called spiro atom), wherein one or more (preferably 1, 2, 3 or 4) ring atoms are selected from nitrogen, oxygen or S(O) r (where r is an integer of 0, 1, or 2) with the remaining ring atoms being carbon. These may contain one or more double bonds (preferably 1, 2, or 3), but no ring has a completely conjugated π electron system. Spiro heterocyclic groups are classified into mono-, di-, or poly-spiro heterocyclic groups according to the number of spiro atoms shared between the rings. Spiro heterocyclic groups include, but are not limited to:

[0136]

[0137] "Fused heterocyclyl" refers to a polycyclic heterocyclic group in which each ring in the system shares a pair of adjacent atoms with other rings in the system, one or more (preferably 1, 2, 3 or 4) rings may contain one or more (preferably 1, 2 or 3) double bonds, but no ring has a completely conjugated π electron system, wherein one or more (preferably 1, 2, 3 or 4) ring atoms are selected from nitrogen, oxygen or S(O) r(where r is an integer of 0, 1, or 2) and the remaining ring atoms are carbon. According to the number of constituent rings, it can be classified into bicyclic, tricyclic, tetracyclic, or polycyclic fused heterocyclic alkyl groups, and fused heterocyclic groups include but are not limited to:

[0138]

[0139] "Bridged heterocyclic group" refers to a polycyclic heterocyclic group in which any two rings share two atoms that are not directly connected, these may contain one or more (preferably 1, 2 or 3) double bonds, but none of the rings has a completely conjugated π electron system, wherein one or more (preferably 1, 2, 3 or 4) ring atoms are selected from nitrogen, oxygen or S(O) r (where r is an integer of 0, 1, or 2) and the remaining ring atoms are carbon. According to the number of constituent rings, it can be classified into bicyclic, tricyclic, tetracyclic, or polycyclic bridged heterocyclic groups, and bridged heterocyclic groups include but are not limited to:

[0140]

[0141] The heterocyclic ring may be fused to an aryl, heteroaryl or cycloalkyl ring, wherein the ring connected to the parent structure is a heterocyclic ring, including but not limited to:

[0142]

[0143] The heterocyclic group may be optionally substituted or unsubstituted. When substituted, the substituents are preferably one or more (preferably 1, 2, 3 or 4) of the following groups independently selected from deuterium, halogen, cyano, nitro, azido, C 1-10 Alkyl, C 2-10 Alkenyl, C 2-10 Alkynyl, halogen substituted C 1-10 Alkyl, deuterium substituted C 1-10 Alkyl, C 3-12 Cycloalkyl, 3-12 membered heterocyclic group, C 6-10 Aryl, 5-10 membered heteroaryl, =O, -SF 5 、-S(O) r R 13 、-OR 14 、-C(O)OR 14 、-C(O)R 15 、-OC(O)R 15 、-NR 16 R 17 、-C(=NR 16 )R 15 、-N(R 16 )-C(=NR 17 )R 15 、-C(O)NR 16 R 17and -N(R 16 )-C(O)R 15 replaced.

[0144] "Aryl" or "aromatic ring" refers to an all-carbon monocyclic or fused polycyclic (i.e., rings that share adjacent pairs of carbon atoms) group, a polycyclic (i.e., rings with adjacent pairs of carbon atoms) group having a conjugated π electron system, preferably an all-carbon aromatic group containing 5-10 or 5-8 carbon atoms, for example, "C 6-10 "Aryl" refers to all-carbon aromatic groups containing 6-10 carbon atoms, including but not limited to phenyl and naphthyl. 6-8 "Aryl" refers to a full-carbon aromatic group containing 6-8 carbon atoms, wherein the aromatic ring may be fused to a heteroaryl, heterocyclic or cycloalkyl ring, wherein the ring connected to the parent structure is an aromatic ring, including but not limited to:

[0145]

[0146] "Aryl" may be substituted or unsubstituted. When substituted, the substituents are preferably one or more (preferably 1, 2, 3 or 4) of the following groups independently selected from deuterium, halogen, cyano, nitro, azido, C 1-10 Alkyl, C 2-10 Alkenyl, C 2-10 Alkynyl, halogen substituted C 1-10 Alkyl, deuterium substituted C 1-10 Alkyl, C 3-12 Cycloalkyl, 3-12 membered heterocyclic group, C 6-10 Aryl, 5-10 membered heteroaryl, =O, -SF 5 、-S(O) r R 13 、-OR 14 、-C(O)OR 14 、-C(O)R 15 、-OC(O)R 15 、-NR 16 R 17 、-C(=NR 16 )R 15 、-N(R 16 )-C(=NR 17 )R 15 、-C(O)NR 16 R 17 and -N(R 16 )-C(O)R 15 substituted by a substituent.

[0147] "Heteroaryl" refers to a heteroaromatic system containing one or more (preferably 1, 2, 3 or 4) heteroatoms including nitrogen, oxygen and S(O) r(where r is an integer of 0, 1, or 2), the C and N atoms in the heteroaryl group may be optionally oxidized to form C=O, N + -O - Structure, preferably a heteroaromatic system containing 5-10 or 5-8 or 5-6 ring atoms, for example, 5-6 membered heteroaryl refers to a heteroaromatic system containing 5-6 ring atoms, 5-8 membered heteroaryl refers to a heteroaromatic system containing 5-8 ring atoms, 5-10 membered heteroaryl refers to a heteroaromatic system containing 5-10 ring atoms, including but not limited to furanyl, thienyl, pyridyl, pyrrolyl, N-alkylpyrrolyl, pyrimidyl, pyrazinyl, imidazolyl, tetrazolyl, etc. The heteroaryl ring can be fused to an aryl, heterocyclyl or cycloalkyl ring, wherein the ring connected to the parent structure is a heteroaryl ring, including but not limited to:

[0148]

[0149] "Heteroaryl" may be optionally substituted or unsubstituted. When substituted, the substituents are preferably one or more (preferably 1, 2, 3 or 4) of the following groups independently selected from deuterium, halogen, cyano, nitro, azido, C 1-10 Alkyl, C 2-10 Alkenyl, C 2-10 Alkynyl, halogen substituted C 1-10 Alkyl, deuterium substituted C 1-10 Alkyl, C 3-12 Cycloalkyl, 3-12 membered heterocyclic group, C 6-10 Aryl, 5-10 membered heteroaryl, =O, -SF 5 、-S(O) r R 13 、-OR 14 、-C(O)OR 14 、-C(O)R 15 、-OC(O)R 15 、-NR 16 R 17 、-C(=NR 16 )R 15 、-N(R 16 )-C(=NR 17 )R 15 、-C(O)NR 16 R 17 and -N(R 16 )-C(O)R 15 substituted by a substituent.

[0150] "Alkenyl" refers to an alkyl group as defined above consisting of at least two carbon atoms and at least one carbon-carbon double bond, preferably a straight or branched alkenyl group containing 2-10 or 2-4 carbon atoms, for example, C 2-10Alkenyl refers to a straight or branched chain alkenyl containing 2 to 10 carbon atoms. 2-4 Alkenyl refers to a straight or branched alkenyl group containing 2 to 4 carbon atoms, including but not limited to vinyl, 1-propenyl, 2-propenyl, 1-, 2- or 3-butenyl, and the like.

[0151] "Alkenyl" may be substituted or unsubstituted. When substituted, the substituents are preferably one or more (preferably 1, 2, 3 or 4) of the following groups independently selected from deuterium, halogen, cyano, nitro, azido, C 1-10 Alkyl, C 2-10 Alkenyl, C 2-10 Alkynyl, halogen substituted C 1-10 Alkyl, deuterium substituted C 1-10 Alkyl, C 3-12 Cycloalkyl, 3-12 membered heterocyclic group, C 6-10 Aryl, 5-10 membered heteroaryl, =O, -SF 5 、-S(O) r R 13 、-OR 14 、-C(O)OR 14 、-C(O)R 15 、-OC(O)R 15 、-NR 16 R 17 、-C(=NR 16 )R 15 、-N(R 16 )-C(=NR 17 )R 15 、-C(O)NR 16 R 17 and -N(R 16 )-C(O)R 15 Substituted by a substituent.

[0152] "Alkynyl" refers to an alkyl group as defined above consisting of at least two carbon atoms and at least one carbon-carbon triple bond, preferably a straight or branched chain alkynyl group containing 2-10 or 2-4 carbon atoms, for example, C 2-10 Alkynyl refers to a straight or branched chain alkynyl containing 2 to 10 carbon atoms. 2-4 Alkynyl refers to a straight or branched chain alkynyl containing 2 to 4 carbon atoms, including but not limited to ethynyl, 1-propynyl, 2-propynyl, 1-, 2- or 3-butynyl, and the like.

[0153] "Alkynyl" may be substituted or unsubstituted. When substituted, the substituents are preferably one or more (preferably 1, 2, 3 or 4) of the following groups independently selected from deuterium, halogen, cyano, nitro, azido, C 1-10 Alkyl, C 2-10 Alkenyl, C2-10 Alkynyl, halogen substituted C 1-10 Alkyl, deuterium substituted C 1-10 Alkyl, C 3-12 Cycloalkyl, 3-12 membered heterocyclic group, C 6-10 Aryl, 5-10 membered heteroaryl, =O, -SF 5 、-S(O) r R 13 、-OR 14 、-C(O)OR 14 、-C(O)R 15 、-OC(O)R 15 、-NR 16 R 17 、-C(=NR 16 )R 15 、-N(R 16 )-C(=NR 17 )R 15 、-C(O)NR 16 R 17 and -N(R 16 )-C(O)R 15 substituted by a substituent.

[0154] "Alkoxy" refers to an -O-alkyl group in which alkyl is as defined above, for example, "C 1-10 "Alkoxy" refers to an alkyloxy group containing 1 to 10 carbon atoms, C 1-4 The term "alkoxy" refers to an alkyloxy group containing 1 to 4 carbon atoms, including but not limited to methoxy, ethoxy, propoxy, butoxy, and the like.

[0155] "Alkoxy" may be optionally substituted or unsubstituted. When substituted, the substituents are preferably one or more (preferably 1, 2, 3 or 4) of the following groups independently selected from deuterium, halogen, cyano, nitro, azido, C 1-10 Alkyl, C 2-10 Alkenyl, C 2-10 Alkynyl, halogen substituted C 1-10 Alkyl, deuterium substituted C 1-10 Alkyl, C 3-12 Cycloalkyl, 3-12 membered heterocyclic group, C 6-10 Aryl, 5-10 membered heteroaryl, =O, -SF 5 、-S(O) r R 13 、-OR 14 、-C(O)OR 14 、-C(O)R 15 、-OC(O)R 15 、-NR 16 R 17 、-C(=NR16 )R 15 、-N(R 16 )-C(=NR 17 )R 15 、-C(O)NR 16 R 17 and -N(R 16 )-C(O)R 15 substituted by a substituent.

[0156] Each of the above R 13 are independently selected from hydrogen, deuterium, hydroxyl, C 1-10 Alkyl, C 2-10 Alkenyl, C 3-12 Cycloalkyl, 3-12 membered heterocyclic group, C 6-10 Aryl, 5-10 membered heteroaryl and -NR 15 R 16 The above groups are independently optionally further substituted with one or more selected from deuterium, halogen, hydroxyl, oxo, C 1-10 Alkyl, C 1-10 Alkoxy, C 3-12 Cycloalkyl, C 3-12 Cycloalkoxy, 3-12 membered heterocyclic group, 3-12 membered heterocyclic group, C 6-10 Aryl, C 6-10 aryloxy, 5-10 membered heteroaryl, 5-10 membered heteroaryloxy and -NR 15 R 16 substituted by a substituent;

[0157] Each of the above R 14 independently selected from hydrogen, deuterium, C 1-10 Alkyl, C 2-10 Alkenyl, C 3-12 Cycloalkyl, 3-12 membered heterocyclic group, C 6-10 Aryl and 5-10 membered heteroaryl, the above groups are independently optionally further substituted with one or more selected from deuterium, halogen, hydroxyl, oxo, cyano, C 1-10 Alkyl, C 1-10 Alkoxy, C 3-12 Cycloalkyl, C 3-12 Cycloalkoxy, 3-12 membered heterocyclic group, 3-12 membered heterocyclic group, C 6-10 Aryl, C 6-10 aryloxy, 5-10 membered heteroaryl, 5-10 membered heteroaryloxy and -NR 15 R 16 substituted by a substituent;

[0158] Each of the above R 15 Selected from hydrogen, deuterium, hydroxyl, C 1-10 Alkyl, C 1-10 Alkoxy, C2-10 Alkenyl, C 2-10 Alkynyl, C 3-12 Cycloalkyl, C 3-12 Cycloalkoxy, 3-12 membered heterocyclic group, 3-12 membered heterocyclic group, C 6-10 Aryl, C 6-10 aryloxy, 5-10 membered heteroaryl, 5-10 membered heteroaryloxy and -NR 15 R 16 The above groups are independently optionally further substituted with one or more selected from deuterium, halogen, hydroxyl, cyano, C 1-10 Alkyl, C 1-10 Alkoxy, C 3-12 Cycloalkyl, C 3-12 Cycloalkoxy, 3-12 membered heterocyclic group, 3-12 membered heterocyclic group, C 6-10 Aryl, C 6-10 aryloxy, 5-10 membered heteroaryl, 5-10 membered heteroaryloxy and -NR 15 R 16 substituted by a substituent;

[0159] Each of the above R 16 and R 17 are each independently selected from hydrogen, deuterium, hydroxyl, C 1-10 Alkyl, C 2-10 Alkenyl, C 2-10 Alkynyl, C 3-12 Cycloalkyl, 3-12 membered heterocyclic group, C 6-10 Aryl, 5-10 membered heteroaryl, sulfinyl, sulfonyl, methylsulfonyl, isopropylsulfonyl, cyclopropylsulfonyl, p-toluenesulfonyl, aminosulfonyl, dimethylaminosulfonyl, amino, mono-C 1-10 Alkylamino, di-C 1-10 Alkylamino and C 1-10 Alkanoyl, the above groups are independently optionally further substituted with one or more selected from deuterium, halogen, hydroxyl, C 1-10 Alkyl, C 2-10 Alkenyl, C 2-10 Alkynyl, halogen substituted C 1-10 Alkyl, deuterium substituted C 1-10 Alkyl, C 1-10 Alkoxy, C 3-12 Cycloalkyl, C 3-12 Cycloalkoxy, 3-12 membered heterocyclic group, 3-12 membered heterocyclic group, C 6-10 Aryl, C 6-10 Aryloxy, 5-10 membered heteroaryl, 5-10 membered heteroaryloxy, amino, mono C 1-10 Alkylamino, di-C 1-10 Alkylamino and C 1-10 substituted with an alkanoyl substituent;

[0160] Or, R 16 and R 17 The nitrogen atom directly connected thereto forms a 4-10 membered heterocyclic group or a 4-10 membered heteroaryl group, wherein the 4-10 membered heterocyclic group or the 4-10 membered heteroaryl group is optionally further substituted by one or more selected from deuterium, halogen, hydroxyl, C 1-10 Alkyl, C 2-10 Alkenyl, C 2-10 Alkynyl, halogen substituted C 1-10 Alkyl, deuterium substituted C 1-10 Alkyl, C 1-10 Alkoxy, C 3-12 Cycloalkyl, C 3-12 Cycloalkoxy, 3-12 membered heterocyclic group, 3-12 membered heterocyclic group, C 6-10 Aryl, C 6-10 Aryloxy, 5-10 membered heteroaryl, 5-10 membered heteroaryloxy, amino, mono C 1-10 Alkylamino, di-C 1-10 Alkylamino and C 1-10 substituted with an alkanoyl substituent;

[0161] “C 1-10 "Alkanoyl" refers to C 1-10 The monovalent atomic group remaining after removing the hydroxyl group from the alkyl acid is usually expressed as "C 0-9 Alkyl-C(O)-", for example, "C 1 Alkyl-C(O)-" refers to acetyl; "C 2 Alkyl-C(O)-" refers to propionyl; "C 3 Alkyl-C(O)-"means butyryl or isobutyryl.

[0162] "Halogen-substituted C 1-10 The term "alkyl" refers to an alkyl group of 1 to 10 carbon atoms in which the hydrogen atoms on the alkyl group are optionally replaced by fluorine, chlorine, bromine or iodine atoms, including but not limited to difluoromethyl, dichloromethyl, dibromomethyl, trifluoromethyl, trichloromethyl, tribromomethyl and the like.

[0163] "Deuterium replaces C 1-10 "Alkyl" refers to an alkyl group of 1 to 10 carbon atoms in which the hydrogen atoms on the alkyl group are optionally replaced by deuterium atoms, including but not limited to monodeuteriomethyl, dideuteriomethyl, trideuteriomethyl, etc.

[0164] "Halogen" refers to fluorine, chlorine, bromine or iodine.

[0165] "Optional" or "optionally" means that the event or circumstance described later may but need not occur, and the description includes the occasions where the event or circumstance occurs or does not occur, that is, both substituted and unsubstituted situations are included. For example, "a heterocyclic group optionally substituted with an alkyl group" means that an alkyl group may but need not be present, and the description includes the situation where the heterocyclic group is substituted with an alkyl group and the situation where the heterocyclic group is not substituted with an alkyl group.

[0166] "Substituted" means that one or more "hydrogen atoms" in a group are replaced independently of each other by a corresponding number of substituents. It goes without saying that the substituents are only in their possible chemical positions, in accordance with the valence bond theory in chemistry, and those skilled in the art can determine (by experiment or theory) possible or impossible substitutions without undue effort. For example, an amino or hydroxyl group with free hydrogen may be unstable when combined with a carbon atom with an unsaturated bond (such as an olefin).

[0167] "Stereoisomers" are called stereoisomers in English. They refer to isomers produced by different spatial arrangements of atoms in molecules. They can be divided into two types: cis-trans isomers and enantiomers, or into two major categories: enantiomers and diastereomers. Stereoisomers caused by the rotation of single bonds are called conformational stereo-isomers, sometimes also called rotamers. Stereoisomers caused by bond length, bond angle, double bonds in molecules, rings, etc. are called configuration stereo-isomers, and configuration isomers are divided into two categories. Among them, isomers caused by the inability of double bonds or single bonds of ring carbon atoms to rotate freely are called geometric isomers, also called cis-trans isomers, and are divided into two configurations: Z and E. For example, cis-2-butene and trans-2-butene are a pair of geometric isomers. Stereoisomers with different optical properties due to the absence of anti-axial symmetry in the molecule are called optical isomers, which are divided into R and S configurations. In the present invention, the "stereoisomer" is understood to include one or more of the above-mentioned enantiomers, configurational isomers and conformational isomers unless otherwise specified.

[0168] "Tautomers" refer to structural isomers of different energies that can be interconverted through a low energy barrier. For example, proton tautomers include interconversions via proton migration, and valence tautomers include interconversions via reorganization of some of the bonding electrons. For example and In the present invention, if the "tautomer" is not specifically indicated, all tautomeric forms of the compound are within the scope of the present invention.

[0169] "Pharmaceutically acceptable salt" in the present invention refers to pharmaceutically acceptable acid addition salts, including inorganic acid salts and organic acid salts, which can be prepared by methods known in the art.

[0170] "Pharmaceutical composition" means a mixture containing one or more compounds described herein or their physiologically / pharmaceutically acceptable salts or prodrugs and other chemical components, as well as other components such as physiologically / pharmaceutically acceptable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration to an organism, facilitate the absorption of the active ingredient, and thus exert biological activity.

[0171] The compounds of the present application may contain unnatural proportions of atomic isotopes on one or more of the atoms constituting the compound. For example, the compounds may be labeled with radioactive isotopes, such as tritium ( 3 H), iodine-125( 125 I) or C-14( 14 C). For another example, deuterium can be substituted for hydrogen to form a deuterated drug. All isotopic composition changes of the compounds of the present application, whether radioactive or not, are included in the scope of the present application.

[0172] The present invention also provides a pharmaceutical composition comprising a therapeutically effective amount of one or more of the compounds and a pharmaceutically acceptable carrier.

[0173] Since the compounds of the present invention have excellent SARM1 enzyme inhibitory activity, the compounds of the present invention and their various crystal forms, pharmaceutically acceptable inorganic or organic salts, hydrates or solvates, and pharmaceutical compositions containing the compounds of the present invention as the main active ingredient can be used to treat, prevent and alleviate diseases related to SARM1 enzyme inhibition.

[0174] The pharmaceutical composition of the present invention comprises a safe and effective amount of the compound of the present invention or a pharmacologically acceptable salt thereof and a pharmacologically acceptable excipient or carrier. Wherein "safe and effective amount" means: the amount of the compound is sufficient to significantly improve the condition without causing serious side effects. Usually, the pharmaceutical composition contains 1-2000 mg of the compound of the present invention per dose, and more preferably, contains 10-1000 mg of the compound of the present invention per dose. Preferably, the "one dose" is a capsule or tablet.

[0175] "Pharmaceutically acceptable carrier" refers to: one or more compatible solid or liquid fillers or gel substances, which are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here means that the components in the composition can be mixed with the compounds of the present invention and with each other without significantly reducing the efficacy of the compounds. Some examples of pharmaceutically acceptable carriers include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as ), wetting agents (such as sodium lauryl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0176] The pharmaceutical composition is in the form of injection, capsule, tablet, pill, powder or granule.

[0177] There is no particular limitation on the administration of the compound or pharmaceutical composition of the present invention. Representative administrations include, but are not limited to, oral, intratumoral, rectal, parenteral (intravenous, intramuscular or subcutaneous), and topical administration.

[0178] Solid dosage forms for oral administration include capsules, tablets, pills, powders and granules. In these solid dosage forms, the active compound is mixed with at least one conventional inert excipient (or carrier), such as sodium citrate or dicalcium phosphate, or with the following ingredients: (a) fillers or extenders, for example, starches, lactose, sucrose, glucose, mannitol, and silicic acid; (b) binders, for example, hydroxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose, and acacia; (c) humectants, for example, glycerol; (d) disintegrants, for example, agar, calcium carbonate, potato starch or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate; (e) solubilizers, for example, paraffin; (f) absorption accelerators, for example, quaternary ammonium compounds; (g) wetting agents, for example, cetyl alcohol and glyceryl monostearate; (h) adsorbents, for example, kaolin; and (i) lubricants, for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof. In the case of capsules, tablets and pills, the dosage forms may also comprise buffering agents.

[0179] Solid dosage forms such as tablets, pills, capsules, pills and granules can be prepared using coatings and shell materials, such as enteric coatings and other materials known in the art. They may contain opacifiers, and the release of the active compound or compounds in such compositions can be delayed in a certain part of the digestive tract. Examples of embedding components that can be used are polymeric substances and waxes. If necessary, the active compound can also be formed into microencapsulated form with one or more of the above-mentioned excipients.

[0180] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups or tinctures. In addition to the active compound, the liquid dosage form may contain an inert diluent conventionally used in the art, such as water or other solvents, solubilizers and emulsifiers, for example, ethanol, isopropanol, ethyl carbonate, ethyl acetate, propylene glycol, 1,3-butylene glycol, dimethylformamide and oils, in particular cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil and sesame oil or mixtures of these substances.

[0181] Besides such inert diluents, the composition may also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.

[0182] Suspensions, in addition to the active compounds, may contain suspending agents such as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum methanol and agar, or mixtures of these substances, and the like.

[0183] Compositions for parenteral injection may include physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents or excipients include water, ethanol, polyols and suitable mixtures thereof.

[0184] Dosage forms for topical administration of the compounds of the invention include ointments, powders, patches, sprays and inhalants. The active ingredient is mixed under sterile conditions with a physiologically acceptable carrier and any preservatives, buffers, or propellants that may be required.

[0185] The compounds of the present invention may be administered alone or in combination with other pharmaceutically acceptable compounds.

[0186] The treatment method of the present invention can be used alone or in combination with other treatment methods or therapeutic drugs.

[0187] When using the pharmaceutical composition, a safe and effective amount of the compound of the present invention is applied to a mammal (such as a human) in need of treatment, wherein the dosage during administration is a pharmaceutically effective dosage, and for a person weighing 60 kg, the daily dosage is usually 1 to 2000 mg, preferably 50 to 1000 mg. Of course, the specific dosage should also take into account factors such as the route of administration and the health status of the patient, which are all within the skill of a skilled physician.

[0188] The present invention will be further described below in conjunction with specific implementations. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0189] The structures of the compounds of the present invention are determined by nuclear magnetic resonance (NMR) and / or liquid chromatography-mass spectrometry (LC-MS). The NMR chemical shift (δ) is given in parts per million (ppm). The NMR measurements were performed using a Bruker AVANCE-400 / 500 NMR spectrometer, and the measurement solvent was deuterated dimethyl sulfoxide (DMSO-d 6 ), deuterated methanol (CD 3 OD) and deuterated chloroform (CDCl 3 ), and the internal standard was tetramethylsilane (TMS).

[0190] Liquid chromatography-mass spectrometry (LC-MS) was performed using an Agilent 6120 mass spectrometer, and HPLC was performed using an Agilent 1200DAD high pressure liquid chromatograph (Sunfire C18 150×4.6 mm column) and a Waters 2695-2996 high pressure liquid chromatograph (Gimini C18 150×4.6 mm column).

[0191] Thin layer chromatography silica gel plates use Yantai Huanghai HSGF254 or Qingdao GF254 silica gel plates. The specifications used for TLC are 0.15mm-0.20mm, and the specifications used for thin layer chromatography separation and purification products are 0.4mm-0.5mm. Column chromatography generally uses Yantai Huanghai silica gel 200-300 mesh silica gel as the carrier.

[0192] The starting materials in the examples of the present invention are known and can be purchased on the market, or can be synthesized by or according to methods known in the art.

[0193] Unless otherwise specified, all reactions of the present invention are carried out under continuous magnetic stirring in a dry nitrogen or argon atmosphere, the solvent is a dry solvent, and the reaction temperature is in degrees Celsius (°C).

[0194] If the specific conditions are not specified in the examples, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. If the manufacturers of reagents or instruments are not specified, they are all conventional products that can be purchased commercially.

[0195] In the present invention, a pair of enantiomers of Compound 1 is subjected to SFC chiral resolution to obtain two enantiomers, which are respectively denoted as Compound 1A and Compound 1B.

[0196] Preparation of intermediates Synthesis of intermediate A1:

[0197]

[0198] Intermediate A1 was synthesized by the following route:

[0199]

[0200] Step 1: Synthesis of Compound A1-1

[0201] The compound 3-hydroxyisonicotinic acid methyl ester (2.0g, 6.52mmol, 1.0eq) was dissolved in N,N-dimethylformamide (40mL), and potassium carbonate (2.0g, 19.56mmol, 3.0eq) and 4-chlorobutyronitrile (1.0g, 13.04mmol, 2.0eq) were added. The reaction mixture was heated to 70°C for 5 hours under nitrogen protection. After the reaction was monitored, the reaction solution was poured into ice water (30mL), extracted with dichloromethane (30mL×3), and the organic layers were combined. The organic layer was washed with saturated sodium chloride solution (30mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography (petroleum ether: ethyl acetate = 1:1) to obtain compound A1-1 (2.0g, yield 69.8%).

[0202] LC-MS (ESI+) m / z: 221.0 (M+H) + ;

[0203] 1 H NMR (400MHz, d 6 -DMSO)δ8.60(s,1H),8.34(m,1H),7.58(d,J=4.8Hz,1H),4.26(t,J=5.6Hz,2H),3.85(s,3H),2.67(t,J=7.2Hz,2H),2.09-2.01(m,2H).

[0204] Step 2: Synthesis of Compound A1-2

[0205] Compound A1-1 (1.5 g, 6.8 mmol, 1.0 eq) was dissolved in tetrahydrofuran (20 mL) and cooled to 0 ° C. Under nitrogen protection, potassium tert-butoxide tetrahydrofuran solution (2M, 10.2 mL, 20.4 mmol, 3.0 eq) was slowly added to the reaction mixture. The reaction mixture was reacted at 0 ° C for 2 hours. After the reaction was monitored, the reaction solution was poured into a cold saturated ammonium chloride solution (20 mL), extracted with dichloromethane (30 mL × 3), and the organic layers were combined. The organic layer was washed with a saturated sodium chloride solution (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography (dichloromethane: methanol = 20: 1) to obtain compound A1-2 (1.0 g, yield 78%).

[0206] LC-MS (ESI+) m / z: 189.0 (M+H) + ;

[0207] 1H NMR (400MHz, DMSO) δ11.06(br,1H),8.40-8.31(m,2H),7.60(d,J=5.2Hz,1H),4.40(t,J=5.2Hz,2H),2.59(t,J=5.2Hz,2H).

[0208] Step 3: Synthesis of Intermediate A1

[0209] Compound A1-2 (500 mg, 2.66 mmol, 1.0 eq) was dissolved in tert-butanol (10 mL), and hydrazine monohydrate (743 mg, 13.28 mmol, 5.0 eq) was added. The reaction mixture was heated to 110 ° C for 1 hour under nitrogen protection. After the reaction was completed, the reaction solution was poured into a cold saturated ammonium chloride solution (30 mL), extracted with dichloromethane (30 mL × 3), and the organic layers were combined. The organic layer was washed with a saturated sodium chloride solution (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography (dichloromethane: methanol = 10: 1) to obtain intermediate A1 (450 mg, yield 83.7%).

[0210] LC-MS (ESI+) m / z: 203.2 (M+H) + ;

[0211] 1 H NMR (400MHz, d 6 -DMSO) δ12.12(br,1H),8.25(m,2H),7.79(m,1H),4.72(br,2H),4.24(t,J=5.2Hz,2H),2.78(t,J=5.2Hz,2H).

[0212] Synthesis of intermediate A2

[0213]

[0214] The synthesis method of intermediate A2 can refer to the synthesis method of intermediate A1, and intermediate A2 is generated by reacting compound A1-2 with 4-methoxybenzylhydrazine.

[0215] LC-MS (ESI+) m / z: 323.2 (M+H) + ;

[0216] 1 H NMR (400MHz, d 6-DMSO) δ8.22(s,1H),8.14(d,J=5.2Hz,1H),7.90(d,J=5.2Hz,1H),7.19(d,J=8.8Hz,2H),6.89(d,J =8.4Hz,2H),5.33(brs,2H),5.16(s,2H),4.25(t,J=4.8Hz,2H),3.72(s,3H),2.78(t,J=4.8Hz,2H).

[0217] Synthesis of intermediate A3

[0218]

[0219] Intermediate A3 was synthesized by the following route

[0220]

[0221] Step 1: Synthesis of Compound A3-1

[0222] 3-Amino-4-pyridinecarboxylic acid methyl ester (50g, 328.62mmol, 1.0eq) was dissolved in dichloromethane (625mL), and 4-dimethylaminopyridine (4.01g, 32.86mmol, 0.1eq) was added. The temperature was lowered to 0°C, and di-tert-butyl dicarbonate (86.07g, 394.34mmol, 1.2eq) was slowly added to the reaction solution. After the addition was completed, the temperature was raised to room temperature. The reaction was stirred at room temperature overnight. After monitoring the formation of the product, the reaction solution was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 3:1) to obtain compound A3-1 (18.9g, yield 22.80%).

[0223] LC-MS (ESI+) m / z: 253.1 (M+H) + .

[0224] Step 2: Synthesis of Compound A3-2

[0225] Compound A3-1 (18.9 g, 74.92 mmol, 1.0 eq) was dissolved in N,N-dimethylformamide (190 mL), and 4-chlorobutyronitrile (15.52 g, 149.84 mmol, 2.0 eq), potassium carbonate (31.06 g, 224.76 mmol, 3.0 eq) and potassium iodide (13.68 g, 82.41 mmol, 1.1 eq) were added. The reaction was stirred at 70 °C overnight. After the reaction was monitored, a mixed solution of petroleum ether: ethyl acetate = 3:1 (300 mL) was added to the reaction solution for dilution. Water (300 mL×5) was then added for washing. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 1:1) to obtain compound A3-2 (11.21 g, yield 59.35%).

[0226] LC-MS (ESI+) m / z: 320.1 (M+H) + .

[0227] Step 3: Synthesis of Compound A3-3

[0228] Compound A3-2 (14.2 g, 44.46 mmol, 1.0 eq) was dissolved in tetrahydrofuran (170 mL) and cooled to 0 ° C. Potassium tert-butoxide (7.48 g, 66.69 mmol, 1.5 eq) was slowly added. The reaction mixture was reacted at 0 ° C for 1 hour. After the reaction was monitored, the reaction solution was diluted with water (300 mL) and the pH of the solution was adjusted to neutral or weakly acidic with dilute hydrochloric acid (1N). The reaction solution was extracted with ethyl acetate (200 ml × 3) and the organic layers were combined. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane: methanol = 15: 1) to obtain compound A3-3 (10.9 g, yield 85.32%).

[0229] LC-MS (ESI+) m / z: 288.1 (M+H) + .

[0230] Step 4: Synthesis of Intermediate A3

[0231] Compound A3-3 (10.9 g, 37.94 mmol, 1.0 eq) was dissolved in n-butanol (75 ml), and hydrazine monohydrate (9.3 ml, 189.7 mmol, 5 eq) was added. The reaction was stirred at 110°C for 1.5 hours. After the reaction was completed, the reaction solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (dichloromethane: methanol = 10: 1) to obtain intermediate A3 (5.1 g, yield 44.61%).

[0232] LC-MS (ESI+) m / z: 302.1 (M+H)+ ;

[0233] 1 H NMR (400MHz, CD 3 OD)δ8.45(s,1H),8.14(d,J=5.2Hz,1H),7.78(m,1H),4.52(m,2H),2.92(m,2H),1.50(m,9H).

[0234] Synthesis of intermediate A4

[0235]

[0236] Intermediate A4 was synthesized by the following route

[0237]

[0238] Step 1: Synthesis of Compound A4-1

[0239] Compound 3-bromoisonicotinic acid methyl ester (1.0 g, 4.63 mmol, 1.0 eq) and 1-ethoxyvinyl-2-boronic acid pinacol ester (1.37 g, 6.94 mmol, 1.5 eq) were dissolved in a mixed solvent of dioxane (20 mL) and water (2 mL), and [1,1′-bis(diphenylphosphino)ferrocene]dichloropalladium (II) (0.34 g, 0.46 mmol, 0.1 eq) and sodium carbonate (0.98 g, 9.26 mmol, 2.0 eq) were added thereto. The mixture was stirred at 80°C for 16 hours under nitrogen protection. After monitoring the reaction, the reaction solution was diluted with water (50 mL), extracted with dichloromethane (100 mL×3), and the organic layers were combined. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate:petroleum ether=0-20%) to give compound A4-1 (560 mg, yield 58%).

[0240] 1 H NMR (400 MHz, CDCl 3 )δ8.72(s,1H),8.46(d,J=5.2Hz,1H),7.65(d,J=5.2Hz,1H),6.99(d,J=13.2Hz,1H) ,6.57(d,J=13.2Hz,1H),4.00(q,J=7.2Hz,2H),3.92(s,3H),1.36(t,J=7.2Hz,3H).

[0241] Step 2: Synthesis of Compound A4-2

[0242] Compound A4-1 (0.97 g, 4.68 mmol, 1.0 eq) and 2-[[(4-methoxyphenyl)methyl]amino]acetonitrile (0.99 g, 5.62 mmol, 1.2 eq) were dissolved in dichloromethane (20 mL), and trifluoroacetic acid (5.34 g, 46.8 mmol, 10.0 eq) and triethylsilane (2.72 g, 23.4 mmol, 5.0 eq) were added in sequence. The mixture was reacted at room temperature for 16 hours. After the reaction was monitored, the reaction solution was concentrated under reduced pressure, diluted with ethyl acetate (200 mL), and then washed with saturated sodium bicarbonate aqueous solution (100 mL) and saturated sodium chloride aqueous solution (100 mL) in sequence. The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate: petroleum ether = 0-70%) to obtain compound A4-2 (0.77 g, yield 48%).

[0243] LC-MS (ESI + )m / z:340.2(M+H) + ;

[0244] 1 H NMR (400MHz, d 6 -DMSO)δ8.60-8.58(m,2H),7.64(d,J=4.8Hz,1H),7.04(d,J=8.8Hz,2H),6.82(d,J=8.8Hz,2H),3 .82(s,3H),3.73(s,3H),3.71(s,2H),3.55(s,2H),3.08(t,J=7.2Hz,2H),2.67(t,J=7.2Hz,2H).

[0245] Step 3: Synthesis of Compound A4-3

[0246] Compound A4-2 (0.77 g, 2.27 mmol, 1.0 eq) was dissolved in tetrahydrofuran (15 mL) and cooled to 0°C. Then potassium tert-butoxide tetrahydrofuran solution (1 M, 4.5 mL, 4.54 mmol, 2.0 eq) was slowly added thereto. The reaction solution was stirred at 0°C for 30 minutes. After the reaction was completed, the reaction solution was adjusted to pH = 7 with dilute hydrochloric acid (1N), and then concentrated under reduced pressure. The residue was purified by silica gel column chromatography (methanol: dichloromethane = 0-10%) to obtain compound A4-3 (0.49 g, yield 70%).

[0247] LC-MS (ESI + )m / z:308.2(M+H) + ;

[0248] 1H NMR (400MHz, d 6 -DMSO) δ9.93(br,1H),8.52(d,J=5.2Hz,1H),8.45(s,1H),7.48(d,J=5.2Hz,1H),7.08(d,J=8.4Hz, 2H), 6.86 (d, J = 8.8Hz, 2H), 4.09 (s, 2H), 3.72 (s, 3H), 3.18 (t, J = 5.2Hz, 2H), 2.77 (t, J = 5.2Hz, 2H).

[0249] Step 4: Synthesis of intermediate A4

[0250] Compound A4-3 (440 mg, 1.43 mmol, 1.0 eq) was dissolved in n-butanol (20 mL), and then hydrazine monohydrate (0.35 mL, 7.15 mmol, 5.0 eq) was added. The reaction solution was stirred at 110 ° C for 3 hours. After the reaction was completed, the reaction solution was concentrated under reduced pressure. The obtained residue was purified by silica gel column chromatography (methanol: dichloromethane = 0-10%) to obtain intermediate A4 (230 mg, yield 49%).

[0251] LC-MS (ESI + )m / z:322.2(M+H) + ;

[0252] 1 H NMR (400MHz, d 6 -DMSO) δ11.86 (br, 1H), 8.37-8.36 (m, 2H), 7.73 (m, 1H), 7.43 (d, J = 8.8 Hz, 2H), 6.92 (d, J = 8.4 Hz, 2H), 4.44 (br, 2H), 4.06 (s, 2H), 3.76 (s, 3H), 2.96-2.77 (m, 4H). Synthesis of Intermediate A5

[0253]

[0254] Intermediate A5 was synthesized by the following route

[0255]

[0256] Step 1: Synthesis of Compound A5-1

[0257] 3-Bromoisonicotinic acid methyl ester (5.00g, 23.14mmol, 1.0eq) and 4-pentenoic acid methyl ester (2.60g, 23.14mmol, 1.0eq) were dissolved in N,N-dimethylformamide (45mL), and then palladium acetate (520mg, 2.314mmol, 0.1eq), 1,4-diazabicyclo[2.2.2]octane (260mg, 2.314mmol, 0.1eq) and potassium carbonate (3.20g, 23.14mmol, 1.0eq) were added thereto. The mixture was stirred at 120°C for 16 hours under nitrogen protection. After the reaction was completed, the reaction solution was cooled to room temperature and concentrated under reduced pressure. The obtained residue was dissolved in ethyl acetate (200mL), washed with water (200mL) and saturated sodium chloride aqueous solution (100mL) in turn. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The obtained residue was purified by flash column chromatography (petroleum ether:ethyl acetate=1:1) to obtain compound A5-1 (1.675 g, yield 29.1%).

[0258] LC-MS (ESI + )m / z:250.0(M+H) + .

[0259] Step 2: Synthesis of Compound A5-2

[0260] Compound A5-1 (200 mg, 0.80 mmol, 1.0 eq) was dissolved in ethyl acetate (5 mL) at room temperature. Under nitrogen protection, 10% palladium carbon (200 mg) was added thereto. The mixture was replaced with hydrogen three times and reacted at 25 ° C for 2 hours under a hydrogen atmosphere (1 atm). After the reaction was monitored, the reaction solution was filtered through diatomaceous earth and the filter cake was washed with ethyl acetate (50 mL). After the filtrate was concentrated under reduced pressure, the crude product was purified by rapid column chromatography (petroleum ether: ethyl acetate = 3:1) to obtain compound A5-2 (75 mg, yield 37.3%).

[0261] LC-MS (ESI + )m / z:252.0(M+H) + ;

[0262] 1 H NMR (400MHz, d 6 -DMSO) δ8.61(s,1H),8.57(d,J=4.8Hz,1H),7.63(d,J=5.2Hz,1H),3.88(s,3H) ,3.58(s,3H),2.86(t,J=7.2Hz,2H),2.33(t,J=6.8Hz,2H),1.55-1.53(m,4H).

[0263] Step 3: Synthesis of Compound A5-3

[0264] Compound A5-2 (1.0 g, 3.99 mmol, 1.0 eq) was dissolved in dry tetrahydrofuran (20 mL) and cooled to 0 ° C. Potassium tert-butoxide tetrahydrofuran solution (1M, 6.38 mL, 6.38 mmol, 1.6 eq) was added thereto. The mixture was stirred at 0 ° C for 15 minutes, and then the temperature was raised to 25 ° C for 3 hours. After the reaction was completed, the reaction solution was poured into cold water (100 mL), extracted with ethyl acetate (120 mL × 3), and the organic layers were combined. The organic layer was washed with saturated sodium chloride aqueous solution (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography (petroleum ether: ethyl acetate = 4: 1) to obtain compound A5-3 (470 mg, yield 53.9%).

[0265] LC-MS (ESI + )m / z:220.2(M+H) + ;

[0266] 1 H NMR (400MHz, d 6 -DMSO) δ12.50(brs,1H),8.62(d,J=4.4Hz,1H),8.52(s,1H),7.54(d,J=5.2Hz,1H),3.86(s,3H),2.71-2.60(m,2H),2.19-2.11(m,4H).

[0267] Step 4: Synthesis of Compound A5-4

[0268] Compound A5-3 (300 mg, 1.370 mmol, 1.0 eq) was dissolved in dimethyl sulfoxide (5 mL), and water (0.3 mL) and lithium chloride (290 mg, 6.85 mmol, 5.0 eq) were added in sequence. The reaction solution was reacted at 130 ° C for 16 hours. After the reaction was completed, the reaction solution was poured into water (50 mL), extracted with ethyl acetate (30 mL × 3), and the organic layers were combined. The organic layer was washed with saturated sodium chloride aqueous solution (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography (petroleum ether: ethyl acetate = 1: 1) to obtain compound A5-4 (130 mg, yield 59.1%).

[0269] LC-MS (ESI + )m / z:162.2(M+H) + ;

[0270] 1 H NMR (400MHz, d 6-DMSO) δ8.59(m,2H),7.44(d,J=4.8Hz,1H),2.94(t,J=6.4Hz,2H),2.74(t,J=6.0Hz,2H),1.83-1.79(m,2H),1.77-1.72(m,2H).

[0271] Step 5: Synthesis of Compound A5-5 Compound A5-4 (500 mg, 3.10 mmol, 1.0 eq) was dissolved in dry THF (10 mL), cooled to 0 ° C, and NaH (372 mg, 9.3 mmol, 3.0 eq) and ethyl formate (689 mg, 9.3 mmol, 3.0 eq) were added in sequence. The reaction solution was stirred at 0 ° C for 20 minutes, then heated to 60 ° C and continued to react for 2 hours. After the monitoring reaction was completed, the reaction solution was poured into cold water (50 mL), extracted with ethyl acetate (30 mL × 3), and the organic layers were combined. The organic layer was washed with saturated sodium chloride aqueous solution (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was purified by flash column chromatography (dichloromethane: methanol = 50: 1) to obtain compound A5-5 (485 mg, yield 82.6%).

[0272] LC-MS (ESI + )m / z:190.0(M+H) + ;

[0273] 1 H NMR (400 MHz, CDCl 3 )δ14.60(br,1H),8.67(m,1H),8.55(m,1H),8.22(m,1H),7.49(m,1H),2.73(m,2H),2.12(m,4H).

[0274] Step 6: Synthesis of Compound A5-6

[0275] Compound A5-5 (1.05 g, 5.55 mmol, 1.0 eq) was dissolved in acetic acid (40 mL), and hydroxylamine hydrochloride (771 mg, 11.10 mmol, 2.0 eq) was added. The reaction solution was heated to 80 ° C and stirred for 2 hours. After the reaction was completed, the reaction solution was concentrated and diluted with ethyl acetate (200 mL). The organic layer was washed with water (50 mL), saturated sodium bicarbonate aqueous solution (50 mL), and saturated sodium chloride solution (50 mL) in sequence, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography (dichloromethane: methanol = 40: 1) to obtain compound A5-6 (230 mg, yield 22.3%).

[0276] 1H NMR (400 MHz, CDCl 3 )δ8.58(d,J=5.2Hz,1H),8.50(s,1H),8.23(s,1H),7.88(d,J=5.2Hz,1H),3.07-2.93(m,2H),2.87(t,J=6.4Hz,2H),2.10-2.04(m,2H).

[0277] Step 7: Synthesis of Compound A5-7

[0278] Compound A5-6 (230 mg, 1.237 mmol, 1.0 eq) was dissolved in dry tetrahydrofuran (20 mL), and sodium methoxide (0.69 mL, 3.709 mmol, 3.0 eq) was added thereto. The reaction solution was stirred at 25 ° C for 1 hour. After the reaction was completed, the reaction solution was adjusted to pH = 5 with dilute hydrochloric acid (1N), extracted with ethyl acetate (15 mL × 3), and the organic layers were combined. The organic layer was washed with saturated sodium chloride aqueous solution (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography (dichloromethane: methanol = 10: 1) to obtain compound A5-7 (200 mg, yield 86.9%).

[0279] LC-MS (ESI + )m / z:187.2(M+H) + ;

[0280] 1 H NMR (400MHz, CD 3 OD)δ8.46(d,J=4.8Hz,1H),8.40(s,1H),7.40(d,J=5.2Hz,1H),2.63(t,J=6.8Hz,2H),2.15-2.08(m,2H),1.91(t,J=6.8Hz,2H).

[0281] Step 8: Synthesis of Intermediate A5

[0282] Compound A5-7 (50 mg, 0.269 mmol, 1.0 eq) was dissolved in n-butanol (3 mL), and hydrazine monohydrate (0.2 mL, 4.12 mmol, 15.3 eq) and TFA (0.2 mL) were added in sequence. The mixture was stirred at 110°C for 2 hours. After the reaction was completed, the reaction solution was concentrated under reduced pressure, and the resulting residue was purified by flash column chromatography (dichloromethane: methanol = 9:1) to obtain intermediate A5 (28 mg, yield 52.8%).

[0283] LC-MS (ESI + )m / z:201.2(M+H) + ;

[0284] 1 H NMR (400MHz, CD 3 OD)δ8.56-8.54(m,2H),8.32(d,J=6.0Hz,1H),3.11-3.05(m,2H),2.77(t,J=6.4Hz,2H),2.13-2.07(m,2H).

[0285] Synthesis of intermediate A6

[0286]

[0287] Intermediate A6 was synthesized by the following route

[0288]

[0289] Step 1: Synthesis of Compound A6-1

[0290] Dissolve 3-bromoisonicotinic acid methyl ester (15.0g, 69.44mmol, 1.0eq) and tert-butyldimethyl (2-propynyloxy) silane (14.2g, 83.3mmol, 1.2eq) in N,N-dimethylformamide (100mL) and triethylamine (100mL), add bis(triphenylphosphine) palladium dichloride (9.7g, 13.9mmol, 0.2eq) and cuprous iodide (2.6g, 13.9mmol, 0.2eq). The reaction solution was stirred at 60°C for 12 hours under nitrogen protection. After monitoring the reaction, the reaction solution was poured into water (500mL), extracted with dichloromethane (500mL×3), and the organic layers were combined. The organic layer was washed with saturated sodium chloride solution (500mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The obtained residue was purified by flash column chromatography (petroleum ether:ethyl acetate=2:1) ​​to obtain compound A6-1 (17.4 g, yield 81.2%).

[0291] LC-MS (ESI + )m / z:306.1(M+H) + ;

[0292] 1 H NMR (400MHz, d 6 -DMSO) δ8.78(s,1H),8.71(d,J=4.8Hz,1H),7.75(d,J=4.8Hz,1H),4.61(s,2H),3.88(s,3H),0.89(s,9H),0.14(s,6H).

[0293] Step 2: Synthesis of Compound A6-2

[0294] Compound A6-1 (17.4 g, 56.9 mmol, 1.0 eq) was dissolved in tetrahydrofuran (100 mL) and cooled to 0 ° C. Under nitrogen protection, tetrabutylammonium fluoride tetrahydrofuran solution (1M, 142 mL, 142.4 mmol, 2.5 eq) was added thereto. The mixture was stirred and reacted for 2 hours after returning to room temperature naturally. After the reaction was monitored, the reaction solution was poured into a cold saturated ammonium chloride solution (500 mL), extracted with dichloromethane (500 mL×3), and the organic layers were combined. The organic layer was washed with a saturated sodium chloride solution (500 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography (petroleum ether: ethyl acetate = 1:1) to obtain compound A6-2 (8.6 g, yield 78.9%).

[0295] LC-MS (ESI + )m / z:191.9(M+H) + ;

[0296] 1 H NMR (400MHz, d 6 -DMSO) δ8.78(s,1H),8.69(d,J=5.2Hz,1H),7.75(d,J=5.2Hz,1H),5.42(t,J=6.0Hz,1H),4.36(d,J=6.0Hz,2H),3.89(s,3H).

[0297] Step 3: Synthesis of Compound A6-3

[0298] Compound A6-2 (8.6 g, 45.0 mmol, 1.0 eq) was dissolved in methanol (60 mL), and 10% palladium on carbon (1.5 g) was added thereto. The reaction solution was reacted at room temperature for 5 hours under a hydrogen atmosphere (1 atm). After the reaction was monitored, the reaction solution was filtered through diatomaceous earth. The filtrate was concentrated under reduced pressure to obtain compound A6-3 (8.2 g, yield 93.3%).

[0299] LC-MS (ESI + )m / z:196.2(M+H) + ;

[0300] 1 H NMR (400MHz, d 6 -DMSO) δ8.60(s,1H),8.56(d,J=4.8Hz,1H),7.62(d,J=5.2Hz,1H),4.50(t,J =5.2Hz,1H),3.87(s,3H),3.40(m,2H),2.93-2.84(m,2H),1.77-1.55(m,2H).

[0301] Step 4: Synthesis of Compound A6-4

[0302] Compound A6-3 (8.2 g, 42.0 mmol, 1.0 eq) was dissolved in dichloromethane (20 mL) and cooled to 0 ° C. Under nitrogen protection, carbon tetrabromide (20.8 g, 63.0 mmol, 1.5 eq) and triphenylphosphine (16.5 g, 63.0 mmol, 1.5 eq) were added thereto in sequence. After returning to room temperature, the mixture was stirred for reaction for 2 hours. After monitoring the reaction, the reaction solution was poured into ice water (200 mL), extracted with dichloromethane (200 mL × 3), and the organic layers were combined. The organic layer was washed with saturated sodium chloride solution (200 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography (petroleum ether: ethyl acetate = 1: 1) to obtain compound A6-4 (3.0 g, yield 27.6%).

[0303] LC-MS (ESI + )m / z:260.0(M+H+2) + .

[0304] Step 5: Synthesis of Compound A6-5

[0305] Compound A6-4 (3.0 g, 11.6 mmol, 1.0 eq) was dissolved in acetonitrile (25 mL). Potassium cyanide (1.9 g, 29.1 mmol, 2.5 eq) and 18-crown-6-ether (3.7 g, 13.9 mmol, 1.2 eq) were added thereto in sequence. Under nitrogen protection, the mixture was stirred at 80 ° C for 12 hours. After the monitoring reaction was completed, the reaction solution was poured into ice water (200 mL), extracted with dichloromethane (200 mL × 3), and the organic layers were combined. The organic layer was washed with saturated sodium chloride solution (200 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was purified by flash column chromatography (petroleum ether: ethyl acetate = 1: 1) to obtain compound A6-5 (670 mg, yield 28.2%).

[0306] LC-MS (ESI + )m / z:205.1(M+H) + .

[0307] Step 6: Synthesis of Compound A6-6

[0308] Compound A6-5 (400 mg, 1.9 mmol, 1.0 eq) was dissolved in tetrahydrofuran (10 mL) and cooled to 0°C. Under nitrogen protection, lithium diisopropylamide tetrahydrofuran solution (1 M, 4 mL, 3.9 mmol, 2.0 eq) was slowly added thereto. The mixture was stirred at 0°C for 2 hours. After the monitoring reaction was completed, the reaction solution was poured into ice water (50 mL), extracted with dichloromethane (50 mL×3), and the organic layers were combined. The organic layer was washed with saturated sodium chloride solution (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was purified by flash column chromatography (dichloromethane: methanol = 20:1) to obtain compound A6-6 (200 mg, yield 59.3%).

[0309] LC-MS (ESI + )m / z:170.9(MH) + .

[0310] Step 7: Synthesis of Intermediate A6

[0311] Compound A6-6 (200 mg, 1.2 mmol, 1.0 eq) was dissolved in n-butanol (10 mL). Hydrazine monohydrate (743 mg, 13.28 mmol, 5.0 eq) was added thereto. Under nitrogen protection, the mixture was stirred at 110 ° C for 1 hour. After the reaction was completed, the reaction solution was poured into a cold saturated ammonium chloride solution (30 mL), extracted with dichloromethane (30 mL × 3), and the organic layers were combined. The organic layer was washed with a saturated sodium chloride solution (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography (dichloromethane: methanol = 10: 1) to obtain intermediate A6 (100 mg, yield 46.2%).

[0312] LC-MS (ESI + )m / z:187.2(M+H) + .

[0313] Synthesis of intermediate A7

[0314]

[0315] Intermediate A7 was synthesized by the following route:

[0316]

[0317] Step 1: Synthesis of Compound A7-2

[0318] At room temperature, compound A3-1 (716 mg, 2.84 mmol, 1.0 eq), compound A7-1 (860 mg, 3.40 mmol, 1.2 eq), cesium carbonate (2.77 g, 8.52 mmol, 3.0 eq) and potassium iodide (518 mg, 3.12 mmol, 1.1 eq) were dissolved in N, N-dimethylformamide (5 mL). The reaction solution was heated to 70 ° C under nitrogen protection and stirred for 16 hours. After the monitoring reaction was completed, the reaction solution was poured into ice water (50 mL), extracted with ethyl acetate (50 mL × 3), and the organic layers were combined. The organic layer was washed with saturated sodium chloride solution (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was purified by flash column chromatography (petroleum ether: ethyl acetate = 2: 1) to obtain compound A7-2 (198 mg, 20%).

[0319] LC-MS (ESI + )m / z:334.2(M+H) + .

[0320] Step 2: Synthesis of Compound A7-3

[0321] The synthesis method of compound A7-3 can refer to the synthesis method of intermediate A3-3. Compound A7-3 is generated by reacting intermediate A7-2 with potassium tert-butoxide.

[0322] LC-MS (ESI + )m / z:302.2(M+H) + .

[0323] Step 3: Synthesis of intermediate A7

[0324] The synthesis method of compound A7 can refer to the synthesis method of intermediate A3. Intermediate A7 is generated by reacting intermediate A7-3 with hydrazine monohydrate.

[0325] LC-MS (ESI + )m / z:316.2(M+H) + .

[0326] Synthesis of intermediate A8

[0327]

[0328] Intermediate A8 was synthesized by the following route:

[0329]

[0330] Step 1: Synthesis of Compound A8-1

[0331] Compound A3-1 (0.4 g, 1.6 mmol, 1.0 eq) was dissolved in N,N-dimethylformamide (15 mL). Potassium carbonate (657 mg, 4.8 mmol, 3.0 eq), potassium iodide (316 mg, 1.9 mmol, 1.2 eq) and 5-bromovaleronitrile (513 mg, 3.2 mmol, 2.0 eq) were added thereto. The mixture was reacted at 70 ° C for 16 hours under nitrogen protection. After the reaction was monitored, the reaction solution was poured into saturated brine (20 mL), extracted with ethyl acetate (20 mL × 3), and the organic layers were combined. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography (petroleum ether: ethyl acetate = 1:1) to obtain compound A8-1 (0.2 g, yield 38%).

[0332] LC-MS (ESI + )m / z:334.2(M+H) + .

[0333] Step 2: Synthesis of Compound A8-2

[0334] Compound A8-1 (0.2 g, 0.6 mmol, 1.0 eq) was dissolved in tetrahydrofuran (10 mL) and cooled to 0°C. Under nitrogen protection, lithium diisopropylamide tetrahydrofuran solution (2 M, 0.9 mL, 1.8 mmol, 3.0 eq) was slowly added thereto. The mixture was stirred at 0°C for 1 hour. After the reaction was completed, the reaction solution was quenched with water (1 mL). The reaction solution was concentrated under reduced pressure, and the residue was purified by flash column chromatography (dichloromethane: methanol = 10: 1) to give compound A8-2 (0.11 g, yield 61%).

[0335] LC-MS (ESI + )m / z:302.1(M+H) + .

[0336] Step 3: Synthesis of intermediate A8

[0337] Compound A8-2 (110 mg, 0.36 mmol, 1.0 eq) was dissolved in n-butanol (5 mL). Hydrazine monohydrate (92 mg, 1.80 mmol, 5.0 eq) was added thereto. Under nitrogen protection, the mixture was stirred at 110 ° C for 1 hour. After the reaction was completed, the reaction solution was concentrated under reduced pressure, and the residue was purified by flash column chromatography (dichloromethane: methanol = 10: 1) to obtain intermediate A8 (20 mg, yield 17%).

[0338] LC-MS (ESI + )m / z:316.2(M+H) + .

[0339] Synthesis of intermediate A9

[0340]

[0341] Intermediate A9 was synthesized by the following route:

[0342]

[0343] Step 1: Synthesis of Compound A9-1

[0344] 3-Hydroxyisonicotinic acid methyl ester (1.0 g, 6.5 mmol, 1.0 eq) was dissolved in dry N,N-dimethylformamide (20 mL). Cesium carbonate (4.3 g, 13.1 mmol, 2.0 eq) and 5-bromovaleronitrile (1.1 g, 6.5 mmol, 1.0 eq) were added thereto. The mixture was stirred at room temperature for 16 hours. After the reaction was monitored, the reaction solution was poured into saturated brine (50 mL), extracted with ethyl acetate (50 mL × 3), and the organic layers were combined. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography (petroleum ether: ethyl acetate = 1:1) to give compound A9-1 (1.1 g, yield 72%).

[0345] LC-MS (ESI + )m / z:235.1(M+H) + .

[0346] Step 2: Synthesis of Compound A9-2

[0347] Compound A9-1 (1.0 g, 4.3 mmol, 1.0 eq) was dissolved in tetrahydrofuran (20 mL) and cooled to 0°C. Under nitrogen protection, lithium diisopropylamide tetrahydrofuran solution (2M, 6.4 mL, 12.8 mmol, 3.0 eq) was slowly added thereto. The mixture was stirred at 0°C for 1 hour. After the reaction was completed, a large amount of solid precipitated. The reaction solution was filtered and the residue was collected. The residue was purified by flash column chromatography (dichloromethane: methanol = 10: 1) to obtain compound A9-2 (0.2 g, yield 23%).

[0348] LC-MS (ESI + )m / z:203.1(M+H) + .

[0349] Step 3: Synthesis of intermediate A9

[0350] Compound A9-2 (200 mg, 0.1 mmol, 1.0 eq) was dissolved in n-butanol (5 mL). Hydrazine monohydrate (309 mg, 4.9 mmol, 5.0 eq) was added thereto. Under nitrogen protection, the mixture was stirred at 110 ° C for 1 hour. After the reaction was completed, the reaction solution was concentrated under reduced pressure, and the residue was purified by flash column chromatography (dichloromethane: methanol = 10: 1) to obtain intermediate A9 (80 mg, yield 37%).

[0351] LC-MS (ESI + )m / z:217.1(M+H) + .

[0352] Synthesis of intermediate A10

[0353]

[0354] Intermediate A10 was synthesized by the following route:

[0355]

[0356] Step 1: Synthesis of Compound A10-1

[0357] 3-Mercaptoisonicotinic acid methyl ester (7g, 41.3mmol, 1.0eq) was dissolved in N,N-dimethylformamide (100mL). Cesium carbonate (73g, 123.9mmol, 3.0eq) and 4-bromobutyronitrile (5mL, 49.56mmol, 1.2eq) were added thereto. The reaction was stirred at room temperature overnight. After the monitoring reaction was completed, the reaction solution was poured into water (30mL), extracted with ethyl acetate (30mL×3), and the organic layers were combined. The organic layer was washed with saturated sodium chloride solution (30mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was purified by flash column chromatography (ethyl acetate: petroleum ether = 0%-30%) to give compound A10-1 (8g, yield 82%).

[0358] LC-MS (ESI + )m / z:237.1(M+H) + .

[0359] Step 2: Synthesis of Compound A10-2

[0360] Compound A10-1 (8 g, 33.8 mmol, 1.0 eq) was dissolved in tetrahydrofuran (80 mL) and cooled to 0 ° C. Under nitrogen protection, potassium tert-butoxide tetrahydrofuran solution (1M, 67.6 mL, 67.6 mmol, 2.0 eq) was slowly added to the reaction mixture. The reaction mixture was reacted at 0 ° C for 1 hour. After monitoring the reaction was complete, the reaction solution was poured into a cold saturated ammonium chloride solution (20 mL) to quench, extracted with dichloromethane (30 mL × 3), and the organic layers were combined. The organic layer was washed with a saturated sodium chloride solution (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was purified by flash column chromatography (ethyl acetate: petroleum ether = 0%-30%) to obtain compound A10-2 (4 g, yield 57%).

[0361] LC-MS (ESI + )m / z:205.1(M+H) + .

[0362] Step 3: Synthesis of intermediate A10

[0363] Compound A10-2 (4 g, 19.2 mmol, 1.0 eq) was dissolved in anhydrous ethanol (40 mL), and hydrazine monohydrate solution (7.6 mL, 85% purity, 156.4 mmol, 8.0 eq) was added. The reaction mixture was heated to 80 ° C under nitrogen protection for 16 hours. After monitoring the reaction was complete, the reaction solution was concentrated under reduced pressure. The obtained residue was purified by slurrying with dichloromethane (5 mL) to obtain intermediate A10 (2 g, yield 47%).

[0364] LC-MS (ESI + )m / z:219.1(M+H) + ;

[0365] 1 H NMR (400MHz, d 6 -DMSO) δ12.03(br,1H),8.56(s,1H),8.43(d,J=4.4Hz,1H),7.75(m,1H),4.76(br,2H),3.05(t,J=5.6Hz,2H),2.87(t,J=5.6Hz,2H).

[0366] Synthesis of intermediate A11

[0367]

[0368] Intermediate A11 was synthesized by the following route

[0369]

[0370] Step 1: Synthesis of Compound A11-1

[0371] 3-Amino-4-cyanopyrazole (10.0 g, 92.5 mmol, 1.0 eq) was dissolved in dry N,N-dimethylformamide (100 mL) and cooled to 0°C. N-bromosuccinimide (17 g, 95 mmol, 1.03 eq) was added thereto in batches. The mixture was stirred for 2 hours after the reaction was naturally warmed to room temperature. After monitoring the reaction was complete, the reaction solution was poured into a saturated sodium sulfite solution (100 mL), extracted with ethyl acetate (100 mL×3), the organic phases were combined, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by flash column chromatography (petroleum ether: ethyl acetate = 1:1) to obtain compound A11-1 (3.5 g, yield 20%).

[0372] LC-MS (ESI + )m / z:187.0(M+H) + .

[0373] Step 2: Synthesis of Compound A11-2

[0374] Compound A11-1 (2.0 g, 10.7 mmol, 1.0 eq), p-methoxybenzyl chloride (1.8 g, 11.8 mmol, 1.1 eq) and potassium carbonate (3.0 g, 21.4 mmol) were added to N, N-dimethylformamide (20 mL). The mixture was reacted at 25 ° C for 16 hours. After the reaction was monitored, the reaction solution was poured into saturated brine (50 mL), extracted with ethyl acetate (50 mL × 3), and the organic phases were combined. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography (petroleum ether: ethyl acetate = 2: 1) to obtain compound A11-2 (2.5 g, yield 76%).

[0375] LC-MS (ESI + )m / z:307.0(M+H) + .

[0376] Step 3: Synthesis of Compound A11-3

[0377] 4-boronic acid pinacol ester nicotinate methyl ester (1.5g, 5.7mmol, 1eq), compound A11-2 (537mg, 1.7mmol, 0.3eq), potassium carbonate (805mg, 5.8mmol, 1.0eq), 1,1-bis(diphenylphosphine)dichloropalladium iron (426mg, 0.58mmol, 0.1eq) were added to a mixed solvent of water (3mL) and dioxane (15mL) in sequence. The reaction mixture was heated to 80°C under nitrogen protection and stirred for 16 hours. After monitoring the reaction completion, the reaction solution was filtered using diatomaceous earth, the filtrate was collected and the filtrate was concentrated under reduced pressure. The resulting residue was purified by flash column chromatography (ethyl acetate = 100%) to obtain compound A11-3 (0.35g, yield 17%).

[0378] LC-MS (ESI + )m / z:364.1(M+H) + .

[0379] Step 4: Synthesis of Compound A11-4

[0380] Compound A11-3 (350 mg, 1.0 mmol, 1.0 eq) was dissolved in methanol (20 mL). Raney nickel (50 mg) and aqueous ammonia (1 mL) were added thereto under nitrogen protection. The reaction solution was stirred at room temperature for 16 hours under a hydrogen atmosphere (1 atm). After the reaction was monitored to be complete. The reaction solution was filtered using diatomaceous earth, the filtrate was collected and concentrated under reduced pressure. The residue was purified by flash column chromatography (dichloromethane: methanol = 10: 1) to give compound A11-4 (0.3 g, yield 93%).

[0381] LC-MS (ESI + )m / z:336.1(M+H) + .

[0382] Step 5: Synthesis of intermediate A11

[0383] Compound A11-4 (50 mg, 0.15 mmol) was suspended in trifluoroacetic acid (2 mL). Trifluoromethanesulfonic anhydride (0.5 mL) was added thereto. The mixture was stirred at room temperature for 1 hour. After the reaction was completed, the reaction solution was concentrated under reduced pressure at low temperature. The resulting residue was purified by rapid column chromatography (C 18 , acetonitrile: 0.1‰ ammonia solution = 0-20%) to obtain intermediate A11 (15 mg, yield 47%).

[0384] LC-MS (ESI + )m / z:216.1(M+H) + .

[0385] Intermediate A12

[0386]

[0387] Intermediate A12 was synthesized by the following route

[0388]

[0389] The synthesis method of intermediate A12 can refer to the synthesis method of intermediate A2, and intermediate A12 is generated by the reaction of compound A3-3 and 4-methoxybenzylhydrazine.

[0390] LC-MS (ESI+) m / z: 422.3 (M+H) + ;

[0391] 1 H NMR (400MHz, CD 3 OD)δ8.43(s,1H),8.34(d,J=5.6Hz,1H),8.13(m,1H),7.23(d,J=8.8Hz,2H),6.93 (d,J=8.8Hz,2H),5.27(s,2H),4.6(m,2H),3.81(s,3H),3.04(m,2H),1.59(m,9H).

[0392] Intermediate A13

[0393]

[0394] Intermediate A13 was synthesized by the following route

[0395]

[0396] Step 1: Synthesis of Compound A13-1

[0397] 3-Bromoisonicotinic acid methyl ester (1.0g, 4.63mmol, 1.0eq), 1-ethoxyvinyl-2-boronic acid pinacol ester (1.37g, 6.94mmol, 1.5eq), 1,1'-bis(diphenylphosphino)ferrocene palladium dichloride (II) (0.34g, 0.46mmol, 0.1eq) and sodium carbonate (0.98g, 9.26mmol, 2.0eq) were placed in a reaction flask, and dioxane (20mL) and water (2mL) were added thereto. The reaction solution was stirred at 80°C for 16 hours under nitrogen protection. After the reaction was monitored, the reaction solution was diluted with water (50mL), extracted with dichloromethane (100mL×3), and the organic phases were combined. The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The obtained residue was purified by column chromatography (ethyl acetate:petroleum ether=0-20%) to give compound A13-1 (560 mg, yield 58%).

[0398] 1 H NMR (400 MHz, CDCl 3 )δ8.65(s,1H),8.40(d,J=8.0Hz,1H),7.58(d,J=8.0Hz,1H),6.93(d,J=12.0Hz,1H) ,6.50(d,J=12.0Hz,1H),3.91(q,J=8.0Hz,2H),3.86(s,3H),1.30(t,J=8.0Hz,3H).

[0399] Step 2: Synthesis of Compound A13-2

[0400] Compound A13-1 (0.82 g, 3.95 mmol, 1.0 eq) and methylaminoacetonitrile (0.55 g, 7.9 mmol, 2.0 eq) were dissolved in dichloromethane (30 mL), and trifluoroacetic acid (4.5 g, 39.5 mmol, 10.0 eq) and triethylsilane (2.29 g, 19.75 mmol, 5.0 eq) were added in sequence. The reaction solution was stirred at room temperature for 16 hours. After the reaction was monitored, the reaction solution was concentrated under reduced pressure. The crude product was dissolved in ethyl acetate (200 mL), and then washed with saturated sodium bicarbonate solution (100 mL) and saturated sodium chloride solution (100 mL) respectively, and the organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography (ethyl acetate: petroleum ether = 0-70%) to obtain compound A13-2 (0.64 g, yield 69%).

[0401] LC-MS (ESI + )m / z:234.2(M+H) + ;

[0402] 1 H NMR (400 MHz, DMSO-d 6 )δ8.65(s,1H),8.58(d,J=5.2Hz,1H),7.64(d,J=5.2Hz,1H),3.89(s,3H),3.73(s,2H),3.03(t,J=7.2Hz,2H),2.58(t,J=7.2Hz,2H),2.28(s,3H).

[0403] Step 3: Synthesis of Compound A13-3

[0404] Compound A13-2 (0.64 g, 2.74 mmol, 1.0 eq) was dissolved in tetrahydrofuran (20 mL) and cooled to 0°C. Then potassium tert-butoxide tetrahydrofuran solution (1 M, 5.48 mL, 5.48 mmol, 2.0 eq) was slowly added thereto. The reaction solution was stirred at this temperature for 30 minutes. After the reaction was monitored, the reaction solution was neutralized with dilute hydrochloric acid (1 M) and the pH was adjusted to 7. The mixture was then concentrated under reduced pressure, and the resulting residue was purified by column chromatography (methanol: dichloromethane = 0-8%) to obtain compound A13-3 (130 mg, yield 23%).

[0405] LC-MS (ESI + )m / z:202.2(M+H) + ;

[0406] 1 H NMR (400 MHz, DMSO-d 6 )δ9.82(br,1H),8.51(d,J=5.2Hz,1H),8.48(s,1H),7.51(d,J=5.2Hz,1H),3.17-3.14(t,J=5.2Hz,2H),2.83-2.90(t,J=5.2Hz,2H),2.68(s,3H).

[0407] Step 4: Synthesis of intermediate A13

[0408] Compound A13-3 (130 mg, 0.65 mmol, 1.0 eq) was dissolved in n-butanol (6 mL), and then hydrazine hydrate (103 mg, 3.25 mmol, 5.0 eq) was added. The reaction solution was stirred at 110°C for 1 hour. After the reaction was completed, the reaction solution was concentrated under reduced pressure, and the resulting residue was purified by column chromatography (methanol: dichloromethane = 0-10%) to obtain intermediate A13 (70 mg, yield 50%).

[0409] LC-MS (ESI + )m / z:216.2(M+H) + ;

[0410] 1 H NMR (400 MHz, DMSO-d 6 )δ11.75(brs,1H),8.40(s,1H),8.36(d,J=5.2Hz,1H),7.71(m,1H),4.46(br,2H),3.05-2.99(m,2H),2.97-2.90(m,2H),2.67(s,3H).

[0411] Intermediate A14

[0412]

[0413] Intermediate A14 was synthesized by the following route

[0414]

[0415] Step 1: Synthesis of Compound A14-1

[0416] At room temperature, 5-bromo-3-fluoropyridine (20g, 113.64mmol, 1eq) was dissolved in tetrahydrofuran (300mL) and cooled to -78°C under nitrogen protection. Diisopropylamide lithium tetrahydrofuran solution (2M, 68ml, 136.37mmol, 1.2eq) was added to the reaction solution. After the reaction solution was stirred at -78°C for 0.5 hours, methyl chloroformate (10.54ml, 136.37mmol, 1.2eq) was added thereto and stirred at this temperature for 2 hours. After monitoring the reaction, saturated ammonium chloride solution (50mL) was added to the reaction solution to quench, and extracted with ethyl acetate (100mL×3). The organic phase was washed with saturated sodium chloride (50mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The obtained residue was purified by column chromatography (dichloromethane:methanol=20:1) to give compound A14-1 (17.4 g, yield 65%).

[0417] LC-MS (ESI + )m / z:236.0(M+2H) + .

[0418] Step 2: Synthesis of Compound A14-2

[0419] Compound A14-1 (5 g, 21.36 mmol, 1.0 eq) was dissolved in N, N-dimethylacetamide (30 mL) at room temperature, and 4-aminobutyronitrile (5 g, 42.72 mmol, 2.0 eq) and N, N-diisopropylethylamine (4.3 ml, 62.08 mmol, 3.0 eq) were added. The reaction solution was stirred at 80 ° C for 2 hours. After the reaction was completed, the reaction solution was diluted with water (50 mL) and extracted with ethyl acetate (50 mL × 3). The organic phase was washed with saturated sodium chloride solution (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography (dichloromethane: methanol = 20: 1) to obtain compound A14-2 (1.6 g, yield 25%).

[0420] LC-MS (ESI + )m / z:300.0(M+2H) + .

[0421] Step 3: Synthesis of Compound A14-3

[0422] Compound A14-2 (250 mg, 0.84 mmol, 1 eq) was dissolved in tetrahydrofuran (5 mL) at room temperature. Di-tert-butyl dicarbonate (365 mg, 1.68 mmol, 2.0 eq), sodium carbonate (270 mg, 2.52 mmol, 3.0 eq), and 4-dimethylaminopyridine (100 mg, 0.84 mmol, 1.0 eq) were added to the reaction solution. The reaction solution was stirred at 80 ° C for 16 hours. After the reaction was completed, the reaction solution was diluted with water (10 mL) and extracted with ethyl acetate (10 mL × 3). The organic phase was washed with saturated sodium chloride solution (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography (dichloromethane: methanol = 20: 1) to obtain compound A14-3 (330 mg, yield 99%).

[0423] LC-MS (ESI + )m / z:400.2(M+2H) + .

[0424] Step 4: Synthesis of Compound A14-4

[0425] At room temperature, compound A14-3 (350 mg, 0.88 mmol, 1.0 eq) was dissolved in tetrahydrofuran (5 mL). Potassium tert-butoxide (148 mg, 1.32 mmol, 1.5 eq) was added to the reaction solution at 0 ° C. The reaction solution was stirred at room temperature for 1 hour. After the reaction was completed, the reaction solution was diluted with water (10 mL) and extracted with ethyl acetate (20 mL × 3). The organic phase was washed with saturated sodium chloride solution (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography (dichloromethane: methanol = 15: 1) to obtain compound A14-4 (220 mg, yield 68%).

[0426] LC-MS (ESI + )m / z:368.0(M+2H) + .

[0427] Step 5: Synthesis of intermediate A14

[0428] At room temperature, compound A14-4 (220 mg, 0.60 mmol, 1.0 eq) was dissolved in n-butanol (5 mL), and then hydrazine hydrate (96 mg, 3.0 mmol, 5.0 eq) was added. The reaction solution was stirred at 110 ° C for 1 hour. After the reaction was completed, the reaction solution was concentrated under reduced pressure. The resulting residue was purified by column chromatography (dichloromethane: methanol = 15: 1) to obtain intermediate A14 (100 mg, yield 43%).

[0429] LC-MS (ESI+ )m / z:382.0(M+2H) + .

[0430] Intermediate A15

[0431]

[0432] Intermediate A15 was synthesized by the following route

[0433]

[0434] Intermediate A14 (50 mg, 0.13 mmol, 1.0 eq) was dissolved in dimethyl sulfoxide (5 mL) at room temperature. 2-Dicyclohexylphosphine-2′,6′-dimethoxy-biphenyl (11 mg, 0.026 mmol, 0.2 eq), potassium phosphate (83 mg, 0.39 mmol, 3.0 eq), trimethylcyclotriboroxine (61 mg, 0.49 mmol, 3.74 eq) and palladium acetate (3 mg, 0.013 mmol, 0.1 eq) were added to the reaction solution in sequence. The reaction solution was stirred at 80°C for 16 hours under nitrogen protection. After the reaction was completed, the reaction solution was diluted with water (10 mL) and extracted with ethyl acetate (10 mL×3). The organic phase was washed with saturated sodium chloride solution (20 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The obtained residue was purified by column chromatography (dichloromethane:methanol=15:1) to give intermediate A15 (35 mg, yield 38%).

[0435] LC-MS (ESI + )m / z:316.2(M+H) + .

[0436] Intermediate A16

[0437]

[0438] Intermediate A16 was synthesized by the following route

[0439]

[0440] Step 1: Synthesis of Compound A16-1

[0441] Compound A11-4 (100 mg, 0.3 mmol, 1.0 eq) was dissolved in tetrahydrofuran (5 mL) and cooled to 0 ° C. Borane dimethyl sulfide complex (2 M, 2.2 mL, 4.5 mmol, 15 eq) was added dropwise thereto. The mixture was heated to 60 ° C and stirred for 2 hours. After the reaction was monitored, the reaction solution was cooled to 0 ° C and quenched by adding methanol (10 mL). The reaction solution was concentrated under reduced pressure to obtain a crude compound A16-1 (90 mg, yield 94%).

[0442] LC-MS (ESI+) m / z: 322.2 (M+H) + .

[0443] Step 2: Synthesis of Compound A16-2

[0444] Compound A16-1 (90 mg, 0.28 mmol, 1.0 eq) was dissolved in a mixed solvent of tetrahydrofuran (2 mL) and water (2 mL), and fluorenylmethoxycarbonyl chloride (142 mg, 0.42 mmol, 1.5 eq) and sodium bicarbonate (71 mg, 0.84 mmol, 3.0 eq) were added thereto. The mixture was stirred at room temperature for 2 hours. After the reaction was monitored, the reaction solution was poured into saturated brine (20 mL), extracted with ethyl acetate (20 mL × 3), and the organic phases were combined. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was purified by flash column chromatography (petroleum ether: ethyl acetate = 1:1) to obtain compound A16-2 (50 mg, yield 32%).

[0445] LC-MS (ESI+) m / z: 544.2 (M+H) + .

[0446] Step 3: Synthesis of intermediate A16

[0447] Compound A16-2 (50 mg, 0.09 mmol, 1.0 eq) was suspended in trifluoroacetic acid (2 mL). Trifluoromethanesulfonic anhydride (0.5 mL) was added thereto. The mixture was stirred at room temperature for 30 minutes. After the reaction was monitored, the reaction solution was concentrated under reduced pressure at low temperature. Saturated sodium bicarbonate solution was added dropwise to the concentrated reaction solution, and the pH was adjusted to 7. The mixture was extracted with ethyl acetate (20 mL × 3), and the organic phases were combined. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was purified by flash column chromatography (dichloromethane: methanol = 10: 1) to give intermediate A16 (30 mg, yield 77%).

[0448] LC-MS (ESI+) m / z: 424.2 (M+H) + .

[0449] Intermediate A17

[0450]

[0451] Intermediate A17 was synthesized by the following route

[0452]

[0453] Step 1: Synthesis of Compound A17-1

[0454] Compound A14-3 (670 mg, 1.68 mmol, 1.0 eq) was dissolved in 1,4-dioxane (15 mL), and 4-methoxybenzylamine (460 mg, 3.37 mmol, 2.0 eq), cesium carbonate (1.65 g, 5.05 mmol, 3.0 eq), tris(dibenzylideneacetone)dipalladium (154 mg, 0.17 mmol, 0.1 eq) and 4,5-bis(diphenylphosphine)-9,9-dimethylxanthene (146 mg, 0.25 mmol, 0.15 eq) were added in sequence. The reaction solution was replaced with nitrogen three times and reacted at 100 ° C for 16 hours. Compound 2 (8.37 g, 56.2 mmol, 0.5 eq) was added, and nitrogen was replaced three times. The reaction solution was refluxed at 90 ° C for 16 hours. After the reaction was monitored, the reaction solution was concentrated under reduced pressure, dissolved in ethyl acetate (50 mL), and then washed with water (30 mL × 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography (ethyl acetate:petroleum ether=0-50%) to give compound A17-1 (502 mg, yield 66.2%).

[0455] 1 H NMR (400 MHz, CDCl 3 )δ8.05(s,1H),7.67(s,1H),7.20(d,J=8.1,2H),7.07(s,1H),6.82(d,J=8.6,2H),4.34(s,2H),3.81(s,3H ),3.74(s,3H),3.67(s,1H),3.31(d,J=6.7,1H),2.35(t,J=7.3,2H),2.02-1.88(m,2H),1.34-1.17(m,9H).

[0456] Step 2: Synthesis of Compound A17-2

[0457] Compound A17-1 (820 mg, 1.81 mmol, 1.0 eq) was dissolved in tetrahydrofuran (15 mL) and nitrogen was replaced three times. The temperature was lowered to 0 ° C, and then potassium tert-butoxide tetrahydrofuran solution (1M, 3.62 mL, 3.62 mmol, 2.0 eq) was quickly added thereto. The reaction solution was stirred at this temperature for 1 hour. After the reaction was completed, the reaction solution was quenched by adding saturated ammonium chloride solution (15 mL) and extracted with ethyl acetate (50 mL × 3). The organic phases were combined, then dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was purified by column chromatography (methanol: dichloromethane = 0-10%) to obtain compound A17-2 (470 mg, yield 56.6%).

[0458] Step 3: Synthesis of intermediate A17

[0459] Compound A17-2 (405 mg, 0.88 mmol, 1.0 eq) was dissolved in n-butanol (10 mL), and hydrazine monohydrate (221 mg, 4.42 mmol, 5.0 eq) was added. The reaction solution was stirred at 110°C for 2 hours under nitrogen protection. After monitoring the reaction, dilute hydrochloric acid (1 M) was slowly added dropwise to adjust the pH to 3-5. The mixture was concentrated under reduced pressure and the obtained residue was purified by column chromatography (methanol: dichloromethane = 0-10%) to obtain intermediate A17 (240 mg, yield 62.2%).

[0460] 1 H NMR (400 MHz, DMSO-d 6 )δ12.10(brs,1H),8.84(br,1H),7.79(s,1H),7.67(s,1H),7.31(d,J=8.4,2H),6.91(d,J= 8.4,2H),5.09(brs,2H),4.39(s,2H),4.34(d,1H),3.74(s,3H),2.88(dd,2H),1.37(d,9H).

[0461] Preparation of specific compounds

[0462] Example 1: Synthesis of Compound 1

[0463]

[0464] Compound 1 was synthesized via the following route:

[0465]

[0466] Intermediate A1 (150 mg, 0.74 mmol, 1.0 eq) was dissolved in N, N-dimethylformamide (2 mL), and 1-propylphosphoric acid cyclic anhydride ethyl acetate solution (50%, 705 mg, 1.11 mmol, 1.5 eq), N, N-diisopropylethylamine (191 mg, 1.48 mmol, 2.0 eq) and 3-(4-chlorophenyl)propionic acid (163 mg, 0.88 mmol, 1.2 eq) were added in sequence. After the reaction mixture was reacted for 1 hour under nitrogen protection at 25°C, the reaction solution was poured into a cold saturated ammonium chloride solution (30 mL), extracted with dichloromethane (30 mL×3), and the organic layers were combined. The organic layer was washed with a saturated sodium chloride solution (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The obtained residue was purified by preparative high performance liquid chromatography (prep-HPLC: Waters 2767 / Qda column: SunFireSunfire C18, 19*250mm, 10um; mobile phase: A: 0.05% trifluoroacetic acid aqueous solution, B: acetonitrile; flow rate: 20ml / min; gradient: 25-35%) to obtain compound 1 (54.98mg, yield 20%).

[0467] LC-MS (ESI+) m / z: 369.2 (M+H) + ;

[0468] 1 H NMR (400MHz, d 6 -DMSO) δ10.06(brs,1H),8.49(s,1H),8.38(d,J=5.6Hz,1H),8.13(m,1H),7.36(d,J=8.4Hz,2H),7.29(d, J=8.4Hz,2H),4.30(t,J=4.8Hz,2H),2.91(t,J=7.6Hz,2H),2.77(t,J=4.8Hz,2H),2.65(t,J=7.6Hz,2H).

[0469] Example 2: Synthesis of Compound 2

[0470]

[0471] Compound 2 was synthesized by the following route:

[0472]

[0473] The synthesis method of compound 2 can refer to the synthesis method of compound 1 in Example 1, and compound 2 is generated by reacting intermediate A1 and 3-(4-chloro-3-fluorophenyl)propionic acid.

[0474] LC-MS (ESI +)m / z:387.2(M+H) + ;

[0475] 1 H NMR (400MHz, d 6 -DMSO)δ13.24-13.16(br,1H),10.13-9.90(br,1H),8.32-8.28(m,2H),8.02-7.83(m,1H),7.51(t, J=8.0Hz,1H),7.33(d,J=8.0Hz,1H),7.14(d,J=8.0Hz,1H),4.24(m,2H),2.95(m,2H),2.72(m,4H).

[0476] Example 3: Synthesis of Compound 3

[0477]

[0478] Compound 3 was synthesized via the following route:

[0479]

[0480] The synthesis method of compound 3 can refer to the synthesis method of compound 1 in Example 1, and compound 3 is generated by reacting intermediate A1 and 3-(6-chloropyridin-3-yl)propionic acid.

[0481] LC-MS (ESI + )m / z:370.2(M+H) + ;

[0482] 1 H NMR (400MHz, d 6 -DMSO)δ10.07(brs,1H),8.47(s,1H),8.38-8.33(m,2H),8.10(m,1H),7.78(d,J=8.0Hz,1 H),7.46(d,J=8.0Hz,1H),4.29(t,J=4.8Hz,2H),2.94(t,J=7.2Hz,2H),2.76-2.50(m,4H).

[0483] Example 4: Synthesis of Compound 4

[0484]

[0485] Compound 4 was synthesized via the following route:

[0486]

[0487] The synthesis method of compound 4 can refer to the synthesis method of compound 1 in Example 1, and compound 4 is generated by the reaction of intermediate A1 and 3-(4-cyano-3-fluorophenyl)propionic acid.

[0488] LC-MS (ESI + )m / z:378.2(M+H) + ;

[0489] 1 H NMR (400MHz, d 6 -DMSO) δ13.24 (br, 1H), 10.02 (br, 1H), 8.31-8.27 (m, 2H), 7.87 (m, 2H), 7.47 (d, J = 7.2 Hz, 1H), 7.34 (d, J = 7.2 Hz, 1H), 4.23 (m, 2H), 3.03 (m, 2H), 2.85-2.64 (m, 4H). Example 5: Synthesis of Compound 5

[0490]

[0491] Compound 5 was synthesized via the following route:

[0492]

[0493] The synthesis method of compound 5 can refer to the synthesis method of compound 1 in Example 1, and compound 5 is generated by reacting intermediate A1 and 3-(6-chloro-5-fluoropyridin-3-yl)propionic acid.

[0494] LC-MS (ESI + )m / z:388.0(M+H) + ;

[0495] 1 H NMR (400MHz, d 6 -DMSO) δ13.22(br,1H),9.98(br,1H),8.31-8.22(m,3H),7.89(m,2H),4.22(t,J=4.8Hz,2H),2.98(t,J=7.2Hz,2H),2.71(m,4H).

[0496] Example 6: Synthesis of Compound 6

[0497]

[0498] Compound 6 was synthesized via the following route:

[0499]

[0500] The synthesis method of compound 6 can refer to the synthesis method of compound 1 in Example 1, and compound 6 is generated by reacting intermediate A1 and 3-(4-cyano-3,5-difluorophenyl)propionic acid.

[0501] LC-MS (ESI + )m / z:396.2(M+H) + ;

[0502] 1 H NMR (400MHz, d 6 -DMSO)δ13.24(br,1H),9.94(br,1H),8.32 -8.27(m,2H),7.84(m,1H),7.40(d,J=9.6Hz,2H),4.24(t,J=4.8Hz,2H),3.03(t,J=7.2Hz,2H),2.77-2.67(m,4H).

[0503] Example 7: Synthesis of Compound 7

[0504]

[0505] Compound 7 was synthesized via the following route:

[0506]

[0507] The synthesis method of compound 7 can refer to the synthesis method of compound 1 in Example 1, and compound 7 is generated by reacting intermediate A1 and 3-(4-chloro-3,5-difluorophenyl)propionic acid.

[0508] LC-MS (ESI + )m / z:405.0(M+H) + ;

[0509] 1 H NMR (400MHz, d 6 -DMSO) δ13.22(br,1H),9.97(br,1H),8.31(s,1H),8.26(d,J=5.2Hz,1H),7.88(s,1H),7.27(d,J=8. 8Hz, 2H), 4.23 (t, J = 4.8Hz, 2H), 2.95 (t, J = 7.2Hz, 2H), 2.75 (t, J = 4.8Hz, 2H), 2.68 (t, J = 7.2Hz, 2H).

[0510] Example 8: Synthesis of Compound 8

[0511]

[0512] Compound 8 was synthesized via the following route:

[0513]

[0514] The synthesis method of compound 8 can refer to the synthesis method of compound 1 in Example 1, and compound 8 is generated by reacting intermediate A1 and 3-(3,4,5-trifluorophenyl)propionic acid.

[0515] LC-MS (ESI + )m / z:389.2(M+H) + ;

[0516] 1 H NMR (400MHz, d 6 -DMSO)δ13.25(br,1H),9.91(br,1H),8.30(m,2H),7.84(m,1H),7.25(dd,J 1 =8.8Hz,J 2 =6.8Hz,2H),4.24(m,2H),2.92(t,J=7.2Hz,2H),2.86-2.58(m,4H).

[0517] Example 9: Synthesis of Compound 9

[0518]

[0519] Compound 9 was synthesized via the following route:

[0520]

[0521] Step 1: Synthesis of compound 9-1

[0522] The synthesis method of compound 9-1 can refer to the synthesis method of compound 1 in Example 1, and compound 9-1 is generated by reacting intermediate A1 and Boc-D-4-chlorophenylalanine.

[0523] LC-MS (ESI + )m / z:484.3(M+H) + .

[0524] Step 2: Synthesis of compound 9

[0525] Compound 9-1 (59 mg, 0.12 mmol, 1.0 eq) was dissolved in dichloromethane (1 mL), and trifluoroacetic acid (1 mL) was added dropwise thereto. The mixture was stirred at room temperature for 2 hours. After the reaction was monitored, the reaction solution was concentrated under reduced pressure. The crude product was purified by flash column chromatography (C 18, acetonitrile: 0.5‰ ammonia solution = 0-35%) to give compound 9 (37 mg, yield 80%).

[0526] LC-MS (ESI + )m / z:384.2(M+H) + ;

[0527] 1 H NMR (400MHz, d 6 -DMSO) δ13.25(brs,1H),8.29(m,2H),7.85(m,1H),7.35(d,J=8.4Hz,2H),7.30(d,J= 8.4Hz,2H),4.31-4.17(m,2H),3.61(t,J=6.8Hz,1H),2.98(m,1H),2.82-2.68(m,3H).

[0528] Example 10: Synthesis of Compound 10

[0529]

[0530] The synthesis method of compound 10 can refer to the synthesis method of compound 9 in Example 9, and compound 10 is generated by a two-step reaction of intermediate A1 and Boc-L-4-chlorophenylalanine.

[0531] LC-MS (ESI + )m / z:384.2(M+H) + ;

[0532] 1 H NMR (400MHz, d 6 -DMSO) δ13.25(brs,1H),8.29(m,2H),7.86(m,1H),7.35(d,J=8.4Hz,2H),7.30(d,J= 8.4Hz,2H),4.28-4.17(m,2H),3.61(t,J=6.8Hz,1H),2.98(m,1H),2.81-2.68(m,3H).

[0533] Example 11: Synthesis of Compounds 11A and 11B

[0534]

[0535] Compounds 11A and 11B were synthesized by the following route:

[0536]

[0537] Step 1: Synthesis of compound 11-1

[0538]

[0539] Dissolve γ-butyrolactone (5g, 58.4mmol, 1.2eq) in tetrahydrofuran (100mL) and cool to -78°C. Under nitrogen protection, the reaction solution was slowly added with bistrimethylsilylamine lithium tetrahydrofuran solution (1M, 58.4mL, 58.4mmol, 1.2eq) and 1,3-dimethyl-2-imidazolidinone (6.61g, 58.4mmol, 1.2eq). The mixture was stirred at -78°C for 30 minutes, returned to room temperature, and p-chlorobenzene bromide (10g, 48.67mmol, 1.0eq) was added. The reaction solution was stirred at room temperature for 2 hours. After the reaction was monitored, the reaction solution was poured into ice water (800mL), extracted with dichloromethane (800mL×3), and the organic layers were combined. The organic layer was washed with saturated sodium chloride solution (800mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was purified by flash column chromatography (C 18 , acetonitrile: water = 5% -90%) to obtain compound 11-1 (7.2 g, yield 70.23%).

[0540] LC-MS (ESI + )m / z:211.1(M+H) + ;

[0541] 1 H NMR (400MHz, d 6 -DMSO) δ7.36(d,J=8.0Hz,2H),7.27(d,J=8.0Hz,2H),4.22(m,1H),4.11(m,1H),3.08-2.91(m,2H),2.70(m,1H),2.16-2.08(m,1H),1.88(m,1H).

[0542] Step 2: Synthesis of compound 11-2

[0543]

[0544] Compound 11-1 (7.2 g, 34.2 mmol, 1.0 eq) was dissolved in a mixed solvent of methanol (30 mL), tetrahydrofuran (30 mL) and water (30 mL). The mixture was added with lithium hydroxide (1.4 g, 34.2 mmol, 1.0 eq) under nitrogen protection and reacted at 80°C for 2 hours. After the reaction was completed, the reaction solution was concentrated under reduced pressure to obtain compound 11-2 (7.8 g, yield 99.7%).

[0545] LC-MS (ESI + )m / z:226.9(MH)+ .

[0546]

[0547] Compound 11-2 (6 g, 42.0 mmol, 1.0 eq) was dissolved in N,N-dimethylformamide (40 mL) and cooled to 0°C. Under nitrogen protection, imidazole (20.8 g, 63.0 mmol, 1.5 eq), 4-dimethylaminopyridine (16.5 g, 63.0 mmol, 1.5 eq) and tert-butyldimethylsilyl chloride (16.5 g, 63.0 mmol, 1.5 eq) were added to the mixture in sequence. The mixture was stirred and reacted for 12 hours after naturally returning to room temperature. After monitoring the reaction, the reaction solution was poured into a saturated aqueous sodium bicarbonate solution (500 mL), extracted with dichloromethane (500 mL×3), and the organic layers were combined. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography (C 18 , acetonitrile: water = 5%-70%) to obtain compound 11-3 (2.8 g, yield 31.1%);

[0548] 1 H NMR (400MHz, d 6 -DMSO)δ12.12(br,1H),7.32(d,J=8.0Hz,2H),7.20(d,J=8.0Hz,2H),3.64-3.52(m,2H), 2.86-2.60(m,3H),1.75-1.70(m,1H),1.60-1.54(m,1H),0.83(s,9H),0(d,J=3.2Hz,6H).

[0549] Step 4: Synthesis of compound 11-4

[0550]

[0551] The synthesis method of compound 11-4 can refer to the synthesis method of compound 1 in Example 1, and compound 11-4 is generated by the reaction of intermediate A1 and compound 11-3.

[0552] LC-MS (ESI + )m / z:527.2(M+H) + .

[0553] Step 5: Synthesis of compound 11-5

[0554]

[0555] Compound 11-4 (1.7 g, 3.2 mmol, 1.0 eq) was dissolved in tetrahydrofuran (30 mL) and cooled to 0 ° C. Under nitrogen protection, tetrabutylammonium fluoride tetrahydrofuran solution (1M, 8 mL, 8 mmol, 2.5 eq) was added to the mixture. The mixture was naturally restored to room temperature and the reaction solution was stirred for 2 hours. After the reaction was monitored, the reaction solution was poured into a cold saturated aqueous ammonium chloride solution (300 mL) for quenching, extracted with dichloromethane (300 mL × 3), and the organic layers were combined. The organic layer was washed with a saturated sodium chloride solution (300 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography (dichloromethane: methanol = 20: 1) to obtain compound 11-5 (1.0 g, yield 75.1%).

[0556] LC-MS (ESI + )m / z:413.1(M+H) + .

[0557] Step 6: Synthesis of compound 11-6

[0558]

[0559] Compound 11-5 (800 mg, 1.9 mmol, 1.0 eq) was dissolved in dichloromethane (20 mL) and cooled to 0 ° C. Under nitrogen protection, thionyl chloride (900 mg, 7.5 mmol, 4.0 eq) was slowly added to the mixture. The reaction solution was stirred for 2 hours. After the reaction was completed, the reaction solution was poured into a saturated sodium bicarbonate aqueous solution (200 mL), extracted with dichloromethane (200 mL × 3), and the organic layers were combined. The organic layer was washed with a saturated sodium chloride aqueous solution (200 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain a crude compound 11-6 (600 mg, 73.3%).

[0560] LC-MS (ESI + )m / z:430.6(M+H) + .

[0561] Step 7: Synthesis of compounds 11A and 11B

[0562]

[0563] Compound 11-6 (600 g, 1.4 mmol, 1.0 eq) was dissolved in tetrahydrofuran (15 mL). The mixture was cooled to 0 ° C, and sodium hydride (112 mg, 60% purity, 2.8 mmol, 2.0 eq) was slowly added under nitrogen protection. The reaction solution was stirred for 2 hours. After the reaction was completed, the reaction solution was poured into a saturated aqueous ammonium chloride solution (100 mL), extracted with dichloromethane (100 mL × 3), and the organic layers were combined. The organic layer was washed with a saturated aqueous sodium chloride solution (100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by preparative HPLC (chromatographic column: Pursuit XRs C18 250*21.2 mm, 10 um; mobile phase: A: 0.05% trifluoroacetic acid aqueous solution, B: acetonitrile; flow rate: 20 ml / min; gradient: 48%-58%; retention time: 8.4-8.9 min of 17 min) and then further chiral separation (chiral chromatographic column: Mobile phase A: supercritical carbon dioxide, mobile phase B: methanol (+0.1% 7.0 mol / l ammonia methanol solution), A:B:=7:3, flow rate: 60 ml / min) to obtain compound 11A (58.17 mg, yield 10.59%) and compound 11B (62.27 mg, yield 11.3%).

[0564] Compound 11A

[0565] LC-MS (ESI + )m / z:395.2(M+H) + ;

[0566] Chiral HPLC (chiral column: CHIRALPAKIC, 100*3.0mm 3.0μm, mobile phase A: supercritical carbon dioxide, mobile phase B: 0.1% diethylamine methanol solution, B: A = 15-25%), Rt = 1.512min;

[0567] 1 H NMR (400MHz, d 6-DMSO) δ13.40(brs,1H),8.35(s,1H),8.30(d,J=5.2Hz,1H),7.86(d,J=5.2Hz,1H),7.37(d,J=8.4Hz,2H),7.31(d,J=8.4Hz,2H),4.35-4.26(m,1 H),4.26-4.18(m,1H),3.73(m,1H),3.62-3.60(m,1H),3.07(m,1H),3.0 2-2.87(m,2H),2.86-2.70(m,2H),2.18-2.05(m,1H),1.88-1.73(m,1H).

[0568] Compound 11B

[0569] LC-MS (ESI + )m / z:395.2(M+H) + ;

[0570] Chiral HPLC (chiral column: CHIRALPAKIC, 100*3.0mm 3.0μm, mobile phase A: supercritical carbon dioxide, mobile phase B: 0.1% diethylamine methanol solution, B: A = 15-25%), Rt = 1.978min;

[0571] 1 H NMR (400MHz, d 6 -DMSO) δ13.40(brs,1H),8.35(s,1H),8.30(d,J=5.2Hz,1H),7.86(d,J=5.2Hz,1H),7.37(d,J=8.4Hz,2H),7.31(d,J=8.4Hz,2H),4.35-4.26( m,1H),4.26-4.18(m,1H),3.73(m,1H),3.60(m,1H),3.07(m,1H),3.02 -2.86(m,2H),2.85-2.71(m,2H),2.19-2.03(m,1H),1.86-1.74(m,1H).

[0572] Example 12: Synthesis of Compounds 12A and 12B

[0573]

[0574] Compounds 12A and 12B were synthesized by the following route:

[0575]

[0576] Step 1: Synthesis of compound 12-1

[0577] The synthesis method of compound 12-1 can refer to the synthesis method of compound 1 in Example 1, and compound 12-1 is generated by reacting intermediate A1 with 5-bromovaleric acid.

[0578] LC-MS (ESI + )m / z:365.0(M+H) + ;

[0579] 1 H NMR (400MHz, d 6 -DMSO) δ13.22(br,1H),9.88(br,1H),8.31(s,1H),8.26(m,1H),7.86(m,1H),4.26(t,J=4.4H z,2H),3.57(t,J=6.4Hz,2H),2.83(m,2H),2.36(m,2H),1.92-1.79(m,2H),1.78-1.65(m,2H).

[0580] Step 2: Synthesis of compound 12-2

[0581] Compound 12-1 (600 mg, 1.65 mmol, 1.0 eq) was dissolved in N,N-dimethylformamide (15 mL) and cooled to 0 ° C. Under nitrogen protection, sodium hydride (132 mg, purity 60%, 3.3 mmol, 2.0 eq) was added to the mixture. After the mixture was reacted at 25 ° C for 15 minutes, 2-(trimethylsilyl)ethoxymethyl chloride (274.75 mg, 1.65 mmol, 1.0 eq) was added and the reaction was continued to stir for 30 minutes. After the monitoring reaction was completed, the reaction solution was poured into a saturated aqueous ammonium chloride solution (60 mL), extracted with dichloromethane (60 mL × 3), and the organic layers were combined. The organic layer was washed with a saturated sodium chloride solution (60 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane: methanol = 15: 1) to obtain compound 12-2 (187 mg, yield 27.43%).

[0582] LC-MS (ESI + )m / z:415.2(M+H) + ;

[0583] Step 3: Synthesis of compound 12-3

[0584] Compound 12-2 (187 mg, 0.45 mmol, 1.0 eq) was dissolved in tetrahydrofuran (8 ml). The reaction solution was cooled to -40 °C, and lithium diisopropylamide tetrahydrofuran solution (2M, 1.13 ml, 2.26 mmol, 5.0 eq) was added under nitrogen protection. After the mixture was stirred for 30 minutes, chlorobenzene bromide (92.8 mg, 0.451 mmol, 1.0 eq) was added and the reaction was continued at -40 °C for one hour. After the monitoring reaction was completed, the reaction solution was poured into a saturated aqueous ammonium chloride solution (30 mL), extracted with dichloromethane (30 mL × 3), and the organic layers were combined. The organic layer was washed with a saturated sodium chloride solution (60 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified using a chromatographic silica gel column (dichloromethane: methanol, = 40: 1) to obtain compound 12-3 (150 mg, yield 61.84%).

[0585] LC-MS (ESI + )m / z:539.2(M+H) + ;

[0586] Step 4: Synthesis of compounds 12A and 12B

[0587] Compound 12-3 (150 mg, 0.45 mmol, 1.0 eq) was dissolved in dichloromethane (3 mL) and trifluoroacetic acid (3 mL) was added. The reaction solution was reacted at 25 ° C for one hour. After the reaction was completed, the reaction solution was concentrated under reduced pressure. The residue was purified by preparative high performance liquid chromatography (prep-HPLC, column: Pursuit XRs C18 250*21.2 mm, 10 um; mobile phase: A: 0.1% ammonium bicarbonate aqueous solution, B: acetonitrile; flow rate: 20 ml / min; gradient: 46%-56%) and then further separated by SFC chiral separation (chiral column: Mobile phase A: supercritical carbon dioxide, mobile phase B: methanol (+0.1% 7.0 mol / l ammonia methanol solution), A:B:=65:35, flow rate: 100 ml / min) to obtain compound 12A (20.81 mg, yield 22.3%) and compound 12B (19.21 mg, yield 20.9%).

[0588] Compound 12A

[0589] LC-MS (ESI + )m / z:409.2(M+H) + ;

[0590] Chiral HPLC (chiral column: CHIRALPAKIC, 100*3.0mm 3.0μm, mobile phase A: supercritical carbon dioxide, mobile phase B: 0.1% diethylamine methanol solution, B: A = 30%), Rt = 4.912min;

[0591] 1 H NMR (400MHz, d 6 -DMSO) δ13.36(brs,1H),8.35(s,1H),8.31(d,J=5.2Hz,1H),7.86(d,J=5.2Hz,1H),7.40(d,J=8.4Hz,2H),7.29(d,J=8.4Hz,2H) ,4.33-4.17(m,2H),3.71-3.49(m,2H),3.19(m,1H),2.85-2.66(m,4H),1.96-1.86(m,1H),1.85-1.71(m,2H),1.55-1.43(m,1H).

[0592] Compound 12B

[0593] LC-MS (ESI + )m / z:409.2(M+H) + ;

[0594] Chiral HPLC (chiral column: CHIRALPAKIC, 100*3.0mm 3.0μm, mobile phase A: supercritical carbon dioxide, mobile phase B: 0.1% diethylamine methanol solution, B: A = 30%), Rt = 6.016min;

[0595] 1 H NMR (400MHz, d 6 -DMSO) δ13.36(brs,1H),8.34(s,1H),8.30(d,J=4.4Hz,1H),7.86(d,J=3.6Hz,1H),7.36(d,J=8.0Hz,2H),7.28(d,J=8.0Hz,2H) ,4.34-4.16(m,2H),3.69-3.47(m,2H),3.19(m,1H),2.88-2.61(m,4H),1.97-1.86(m,1H),1.85-1.71(m,2H),1.58-1.41(m,1H).

[0596] Example 13: Synthesis of Compound 13

[0597]

[0598] Compound 13 was synthesized by the following route:

[0599]

[0600] Step 1: Synthesis of compound 13-1

[0601]

[0602] Intermediate A2 (400 mg, 1.24 mmol, 1.0 eq) was dissolved in tetrahydrofuran (10 mL). Methyl chloroformate (140 mg, 1.5 mmol, 1.2 eq) was added to the mixture under nitrogen protection. The reaction solution was stirred at room temperature for 2 hours. After the reaction was completed, the reaction solution was poured into a cold saturated ammonium chloride solution (50 mL), extracted with dichloromethane (50 mL × 3), and the organic layers were combined. The organic layer was washed with a saturated sodium chloride aqueous solution (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain a crude compound 13-1 (400 mg).

[0603] LC-MS (ESI + )m / z:381.1(M+H) + .

[0604] Step 2: Synthesis of compound 13-2

[0605]

[0606] Compound 13-1 (400 mg, 1.05 mmol, 1.0 eq) was dissolved in tetrahydrofuran (30 mL). The mixture was added with lithium aluminum hydride tetrahydrofuran solution (1 M, 3.15 mL, 3.15 mmol, 3.0 eq) under nitrogen protection and heated to 65 ° C for 2 hours. After the reaction was completed, the reaction solution was poured into a cold saturated aqueous solution of ammonium chloride (50 mL), extracted with dichloromethane (50 mL × 3), and the organic layers were combined. The organic layer was washed with a saturated aqueous solution of sodium chloride (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain a crude compound 13-2 (300 mg).

[0607] LC-MS (ESI + )m / z:337.1(M+H) + .

[0608] Step 3: Synthesis of compound 13-3

[0609]

[0610] Compound 13-1 (300 mg, 34.2 mmol, 1.0 eq) was dissolved in trifluoroacetic acid (5 mL). The mixture was reacted at 80 ° C for 12 hours under nitrogen protection. After the reaction was completed, the reaction solution was poured into a cold saturated sodium bicarbonate solution (30 mL) for quenching, extracted with dichloromethane (30 mL × 3), and the organic layers were combined. The organic layer was washed with a saturated sodium chloride solution (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain a crude compound 13-3 (150 mg).

[0611] LC-MS (ESI + )m / z:217.0(M+H) + .

[0612] Step 4: Synthesis of compound 13

[0613]

[0614] The synthesis method of compound 13 can refer to the synthesis method of compound 1 in Example 1, and compound 13 is generated by reacting compound 13-3 with 3-(4-chlorophenyl)propionic acid.

[0615] LC-MS (ESI + )m / z:383.2(M+H) + ;

[0616] 1 H NMR (400MHz, d 6 -DMSO) δ13.56(s,1H),8.33(m,2H),7.86(d,J=4.8Hz,1H),7.27(d,J=8.4Hz,2H),7.13(d,J=8.4Hz,2H ),4.23(t,J=4.8Hz,2H),3.08(s,3H),2.80-2.78(m,2H),2.70(t,J=4.8Hz,2H),2.33(t,J=7.2Hz,2H).

[0617] Example 14: Synthesis of Compound 14

[0618]

[0619] Compound 14 was synthesized via the following route:

[0620]

[0621] Step 1: Synthesis of compound 14-1

[0622] Under nitrogen protection, triphosgene (111 mg, 0.37 mmol, 1.2 eq) was dissolved in tetrahydrofuran (3 mL) at 0 ° C, and the temperature was kept constant. Compound A2 (100 mg, 0.31 mmol, 1.0 eq) and N, N-diisopropylethylamine (400 mg, 3.1 mmol, 10 eq) were slowly added to the system at the same time. After the reaction was stirred at 0 ° C for 2 hours, a solution of 4-chlorobenzylamine (79 mg, 0.56 mmol, 1.5 eq) in tetrahydrofuran (1 mL) was slowly added to the system and slowly warmed to room temperature and stirred for 1 hour. After the reaction was monitored, the reaction solution was diluted with ethyl acetate (50 mL) and quenched with saturated sodium bicarbonate aqueous solution (50 mL). The reaction solution was extracted with ethyl acetate (50 mL × 3), and the organic layers were combined. The organic layer was washed with saturated sodium chloride solution (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The obtained residue was purified by flash column chromatography (C 18 , acetonitrile: 0.5‰ trifluoroacetic acid aqueous solution = 0-50%) to obtain compound 14-1 (99 mg, yield 65%).

[0623] LC-MS (ESI + )m / z:490.2(M+H) + .

[0624] Step 2: Synthesis of compound 14

[0625] Compound 14-1 (99 mg, 0.2 mmol) was dissolved in trifluoroacetic acid (2 mL) at room temperature. The mixture was refluxed at 80°C for 2 hours. After the reaction was completed, the reaction solution was concentrated under reduced pressure. The resulting residue was purified by flash column chromatography (C 18 , acetonitrile: 0.5‰ trifluoroacetic acid aqueous solution = 0-40%) to obtain compound 14 (44 mg, yield 60%).

[0626] LC-MS (ESI + )m / z:370.1(M+H) + .

[0627] 1 H NMR (400MHz, d 6 -DMSO)δ8.70(s,1H),8.49(s,1H),8.37(d,J=5.6Hz,1H),8.12(m,1H),7.43(d,J=6 .8Hz,2H),7.33(d,J=6.8Hz,2H),7.27(br,1H),4.32(m,4H),2.91(t,J=4.8Hz,2H).

[0628] Example 15: Synthesis of Compound 15

[0629]

[0630] Compound 15 was synthesized via the following route:

[0631]

[0632] Step 1: Synthesis of compound 15-1

[0633] The synthesis method of compound 15-1 can refer to the synthesis of compound 14-1 in Example 14, and compound 15-1 is generated by reacting intermediate A2 and 2-chloroethylamine hydrochloride.

[0634] LC-MS (ESI + )m / z:428.2(M+H) + .

[0635] Step 2: Synthesis of compound 15-2

[0636] Under nitrogen protection, compound 15-1 (66 mg, 0.15 mmol, 1.0 eq) was dissolved in N, N-dimethylformamide (1 mL). Sodium hydrogen (18 mg, 0.45 mmol, 60% mass fraction, 3.0 eq) was added to the reaction solution at room temperature and stirred for 0.5 hours, followed by the addition of 4-chlorobenzyl bromide (47 mg, 0.23 mmol, 1.5 eq) and continued stirring for 2 hours. After the reaction was monitored, the reaction solution was diluted with ethyl acetate (50 mL), and washed with saturated aqueous ammonium chloride solution (50 mL) and saturated aqueous sodium chloride solution (50 mL) in turn. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The crude product was purified by silica gel column chromatography (methanol: dichloromethane = 0-5%) to obtain compound 15-2 (55 mg, yield 70%).

[0637] LC-MS (ESI + )m / z:516.3(M+H) + .

[0638] Step 3: Synthesis of compound 15

[0639] Compound 15-2 (55 mg, 0.1 mmol) was dissolved in trifluoroacetic acid (2 mL) at room temperature. The mixture was refluxed at 80°C for 2 hours. After monitoring the completion of the reaction, the reaction solution was concentrated under reduced pressure. The resulting residue was purified by flash column chromatography (C 18 , acetonitrile: 0.5‰ trifluoroacetic acid aqueous solution = 0-45%) to obtain compound 15 (25 mg, yield 60%).

[0640] LC-MS (ESI + )m / z:396.2(M+H) + ;

[0641] 1 H NMR (400MHz, d 6 -DMSO) δ8.49(s,1H),8.40(d,J=5.6Hz,1H),8.08(m,1H),7.45(d,J=6.4Hz,2H),7.33(d,J=6.4Hz,2 H), 4.37 (s, 2H), 4.32 (t, J = 4.8Hz, 2H), 3.83-3.81 (m, 2H), 3.42-3.36 (m, 2H), 3.04 (t, J = 5.2Hz, 2H).

[0642] Example 16: Synthesis of Compound 16

[0643]

[0644] Compound 16 was synthesized via the following route:

[0645]

[0646] The synthesis method of compound 16 can refer to the synthesis method of compound 1 in Example 1 to generate compound 16 by reacting intermediate A1 and 3-(4-chlorophenyl)-2,2-dimethylpropionic acid.

[0647] LC-MS (ESI + )m / z:397.2(M+H) + ;

[0648] 1 H NMR (400MHz, d 6 -DMSO)δ9.60(brs,1H),8.52(s,1H),8.41(d,J=5.6Hz,1H),8.18(m,1H),7.32(d,J=6.4Hz,2H) ,7.23(d,J=6.4Hz,2H),4.32(t,J=5.2Hz,2H),2.93(s,2H),2.78(t,J=5.2Hz,2H),1.19(s,6H).

[0649] Example 17: Synthesis of Compound 17

[0650]

[0651] Compound 17 was synthesized via the following route:

[0652]

[0653] The synthesis method of compound 17 can refer to the synthesis method of compound 1 in Example 1, and intermediate A1 and 3-(4-chloro)-2-methylpropionic acid are reacted to generate compound 17.

[0654] LC-MS (ESI + )m / z:383.2(M+H) + ;

[0655] 1 H NMR (400MHz, d 6 -DMSO) δ9.98(brs,1H),8.49(s,1H),8.38(d,J=5.6Hz,1H),8.13(m,1H),7.36(d,J=6.4Hz,2H),7.25 (d,J=6.4Hz,2H),4.28(t,J=4.8Hz,2H),2.97-2.79(m,2H),2.73-2.62(m,3H),1.13(d,J=6.4Hz,3H).

[0656] Example 18: Synthesis of Compound 18

[0657]

[0658] Compound 18 was synthesized via the following route:

[0659]

[0660] Under nitrogen protection, compound 10 (15 mg, 0.04 mmol, 1.0 eq) and N,N-diisopropylethylamine (26 mg, 0.2 mmol, 5.0 eq) were dissolved in tetrahydrofuran (1 mL), the system was cooled to 0 ° C and triphosgene (5 mg, 0.016 mmol, 4.0 eq) in tetrahydrofuran (1 mL) was slowly added dropwise. The reaction was stirred at 0 ° C for 2 hours. After the reaction was monitored, the reaction solution was quenched with methanol (1 mL) and concentrated under reduced pressure. The crude product was purified by flash column chromatography (C 18 , acetonitrile: 0.5‰ ammonia solution = 0-45%) to give compound 18 (12 mg, yield 79%).

[0661] LC-MS (ESI + )m / z:410.2(M+H) + ;

[0662] 1 H NMR (400MHz, d 6-DMSO) δ13.73(brs,1H),8.65(brs,1H),8.35(s,1H),8.32(d,J=5.2Hz,1H),7.85(m,1H),7.40(d,J=6.4Hz,2H),7 .26(d,J=6.4Hz,2H),4.72(s,1H),4.13(t,J=4.4Hz,2H),3.14-3.02(m,2H),2.28-2.14(m,1H),2.12-1.96(m,1H).

[0663] Example 19: Synthesis of Compound 19

[0664]

[0665] Compound 19 was synthesized via the following route:

[0666]

[0667] Step 1: Synthesis of intermediate 19-1

[0668] The synthesis method can refer to the synthesis method of compound 1 in Example 1, and intermediate A3 and 3-(4-chlorophenyl)propionic acid are reacted to generate intermediate 19-1.

[0669] LC-MS (ESI + )m / z:468.1(M+H) + .

[0670] Step 2: Synthesis of compound 19

[0671] Intermediate 19-1 (150 mg, 0.32 mmol, 1.0 eq) was dissolved in a hydrochloric acid ethyl acetate solution (2 M, 3 mL). The reaction mixture was reacted at 25 ° C for 30 minutes under nitrogen protection. After the reaction was completed, the reaction solution was concentrated under reduced pressure. The obtained residue was purified by preparative high performance liquid chromatography (prep-HPLC (Waters 3767), chromatographic column: SunFire C18, 19*250 mm, 10 um; mobile phase A: 0.05% trifluoroacetic acid aqueous solution, B: acetonitrile; flow rate: 20 ml / min; gradient: 24-34%, retention time: 8-8.5 min of 17 min) to obtain compound 19 (40.39 mg, yield 34.2%).

[0672] LC-MS (ESI + )m / z:368.2(M+H) + ;

[0673] 1 H NMR (400MHz, d 6-DMSO) δ10.00(br,1H),8.24(m,2H),8.09(d,J=6.0Hz,1H),7.35(d,J=8.4Hz,2H),7.29(d,J=8.4Hz,2H),3.27(t,J=4.8Hz 2H), 2.91(t,J=7.2Hz,2H), 2.64(t,J=7.2Hz,2H), 2.56(m,2H).

[0674] Example 20: Synthesis of Compound 20

[0675]

[0676] The synthesis method of compound 20 can refer to the synthesis method of compound 19 in Example 19. Compound 20 is prepared by two-step reaction of intermediate A3 and 3-(4-chloro-3-fluorophenyl)propionic acid.

[0677] LC-MS (ESI + )m / z:386.2(M+H) + ;

[0678] 1 H NMR (400MHz, d 6 -DMSO) δ13.40(br,1H),9.99(br,1H),8.23(m,1H),8.09(m,1H),7.51(t,J=8.0Hz,1H),7.33(d,J=10.4Hz,1H ),7.24(m,1H),7.14(d,J=8.0Hz,1H),3.27(m,2H),2.93(t,J=7.2Hz,2H),2.67(t,J=7.2Hz,2H),2.55(m,2H).

[0679] Example 21: Synthesis of Compound 21

[0680]

[0681] The synthesis method of compound 21 can refer to the synthesis method of compound 19 in Example 19. Compound 21 is prepared by two-step reaction of intermediate A3 and 3-(2-fluoropyridin-4-yl)propionic acid.

[0682] LC-MS (ESI + )m / z:353.2(M+H) + ;

[0683] 1 H NMR (400 MHz, DMSO-d 6)δ12.90(brs,1H),9.73(brs,1H),8.12(m,2H),7.93-7.81(m,2H),7.62(m,1H),7.13(d,J=8.4 ,1H),6.48(brs,1H),3.14(m,2H),2.93(t,J=7.2Hz,2H),2.70-2.62(m,2H),2.34-2.32(m,2H).

[0684] Example 22: Synthesis of Compound 22

[0685]

[0686] The synthesis method of compound 22 can refer to the synthesis method of compound 19 in Example 19, and compound 22 is generated by a two-step reaction of intermediate A3 and 3-(6-chloro-5-fluoropyridin-3-yl)propionic acid.

[0687] LC-MS (ESI + )m / z:387.2(M+H) + ;

[0688] 1 H NMR (400MHz, d 6 -DMSO) δ13.37(br,1H),10.03(br,1H),8.23(m,2H),8.09(d,J=5.6Hz,1H),7.91(d,J= 9.6Hz,1H),7.26(m,1H),3.27(m,2H),2.98(t,J=7.2Hz,2H),2.72(m,2H),2.56(m,2H).

[0689] Example 23: Synthesis of Compounds 23A and 23B

[0690]

[0691] Compounds 23A and 23B were synthesized by the following route:

[0692]

[0693] The synthesis method of compound 23-1 can refer to the synthesis method of compound 11 in Example 11.

[0694] LC-MS (ESI + )m / z:494.2(M+H) + .

[0695] Compounds 23A and 23B

[0696] Under nitrogen protection, compound 23-1 (160 mg, 0.324 mmol, 1.0 eq) was dissolved in a hydrogen chloride ethyl acetate solution (4 M, 5 mL). The mixture was reacted at 25 ° C for 2 hours. After the reaction was completed, the reaction solution was poured into a saturated sodium bicarbonate aqueous solution (100 mL) for quenching, extracted with dichloromethane (50 mL × 3), and the organic layers were combined. The organic layer was washed with a saturated sodium chloride aqueous solution (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was purified by flash column chromatography (dichloromethane: methanol = 10: 1), and then further SFC chiral separation (chiral chromatographic column: DAICELCHIRALCEL OJ, mobile phase A: supercritical carbon dioxide, mobile phase B: isopropanol (+0.1% 7.0 mol / l ammonia methanol solution), A:B: =75:25, flow rate: 100 ml / min) to obtain compound 23A (27.89 mg, yield 21.86%) and compound 23B (26.14 mg, yield 20.49%).

[0697] Compound 23A

[0698] LC-MS (ESI + )m / z:394.2(M+H) + ;

[0699] Chiral HPLC (chiral column: CHIRALPAKIC, 100*3.0mm 3.0μm, mobile phase A: supercritical carbon dioxide, mobile phase B: 0.1% diethylamine isopropanol solution, B: A = 15-30%), Rt = 1.126min;

[0700] 1 H NMR (400MHz, d 6 -DMSO) δ13.07(brs,1H),8.14(s,1H),7.88(d,J=5.2Hz,1H),7.65(d,J=5.2Hz,1H ),7.41-7.34(d,J=8.4Hz,2H),7.31(d,J=8.4Hz,2H),6.54(brs,1H),3.73-3.65(m ,1H),3.56(m,1H),3.27-3.20m,1H),3.19-3.11(m,1H),3.07(m,1H),2.95-2.84(m ,1H),2.78-2,65(m,2H),2.63-2.53(m,1H),2.16-2.03(m,1H),1.87-1.72(m,1H).

[0701] Compound 23B

[0702] LC-MS (ESI + )m / z:394.2(M+H) + ;

[0703] Chiral HPLC (chiral column: CHIRALPAKIC, 100*3.0mm 3.0μm, mobile phase A: supercritical carbon dioxide, mobile phase B: 0.1% diethylamine isopropanol solution, B: A = 15-30%), Rt = 1.497min;

[0704] 1 H NMR (400MHz, d 6 -DMSO) δ13.07(brs,1H),8.14(s,1H),7.88(d,J=5.2Hz,1H),7.64(d,J=5.2Hz, 1H),7.37(d,J=8.4Hz,2H),7.31(d,J=8.4Hz,2H),6.53(brs,1H),3.69(m,1H),3 .56(m,1H),3.25-3.20(m,1H),3.18-3.15(m,1H),3.07(m,1H),2.94-2.86(m,1 H),2.79-2.65(m,2H),2.63-2.53(m,1H),2.16-2.03(m,1H),1.85-1.75(m,1H).

[0705] Example 24: Synthesis of Compound 24

[0706]

[0707] The synthesis method of compound 24 can refer to the synthesis method of compound 19 in Example 19, and compound 24 is generated by two-step reaction of intermediate A3 and 3-(4-chloro-3,5-difluorophenyl)propionic acid.

[0708] LC-MS (ESI + )m / z:404.2(M+H) + ;

[0709] 1 H NMR (400MHz, CD 3 OD)δ8.41(m,1H),8.17(s,1H),8.00(d,J=6.0Hz,1H),7.15-7.02(m,2H),3.46 -3.38(m,2H),3.06(t,J=7.2Hz,2H),2.79(t,J=7.2Hz,2H),2.76-2.68(m,2H).

[0710] Example 25: Synthesis of Compound 25

[0711]

[0712] The synthesis method of compound 25 can refer to the synthesis method of compound 19 in Example 19, and compound 25 is generated by a two-step reaction of intermediate A3 and 3-(3,4,5-trifluorophenyl)propionic acid.

[0713] LC-MS (ESI + )m / z:388.2(M+H) + ;

[0714] 1 H NMR (400MHz, d 6 -DMSO) δ13.33(br,1H),9.97(br,1H),8.22(s,1H),8.07(d,J=5.6Hz,1H),7.25 (m,3H),3.27(m,2H),2.92(t,J=7.2Hz,2H),2.67(t,J=7.2Hz,2H),2.49(m,2H).

[0715] Example 26: Synthesis of Compounds 26A and 26B

[0716]

[0717] Compounds 26A and 26B were synthesized by the following route:

[0718]

[0719] The synthesis method of compound 26-1 can refer to the synthesis method of compound 17 in Example 17.

[0720] LC-MS (ESI + )m / z:383.2(M-100+H) + .

[0721] Synthesis of compounds 26A and 26B:

[0722] Compound 26-1 (470 mg, 1.37 mmol, 1.0 eq) was dissolved in anhydrous dichloromethane (6 mL). Trifluoroacetic acid (2 mL) was added to the mixture and stirred at room temperature for 2 hours. After the reaction was completed, the reaction solution was concentrated under reduced pressure. The residue was separated and purified by preparative high performance liquid chromatography (Prep-HPLC (Gilson GX-281) column: Pursuit XRs C18 250*21.2mm, 10um; mobile phase A: 0.05% trifluoroacetic acid aqueous solution, B: acetonitrile, flow rate: 20ml / min; gradient: 36-46%; retention time: 7.2-8.5min of 17min), and then further separated by SFC chiral separation (chiral column: REGIS (S,S) WHELK-O1, mobile phase A: supercritical carbon dioxide, mobile phase B: isopropanol (+0.1% 7.0mol / l ammonia methanol solution), A:B: =75:25, flow rate: 100ml / min) to obtain compound 26A (35.34mg, yield 13.5%) and compound 26B (33.93mg, yield 13.0%).

[0723] Compound 26A

[0724] LC-MS (ESI + )m / z:382.2(M+H) + ;

[0725] Chiral HPLC (chiral column: CHIRALPAKIC, 3.0 mm*5 cm 3.0 μm, mobile phase A: supercritical carbon dioxide, mobile phase B: 0.1% diethylamine methanol solution, B: A = 15-30%), Rt = 2.856 min;

[0726] 1 H NMR (400MHz, d 6 -DMSO) δ13.20(br,1H),9.86(br,1H),8.20(s,1H),8.04(d,J=6.0Hz,1H),7.35(d,J=8.4Hz,2H),7.25(d,J=8.4Hz,2 H),7.11(m,1H),6.98(s,1H),3.21(m,2H),2.94-2.77(m,2H),2.66(m,1H),2.46-2.34(m,2H),1.12(d,J=6.4Hz,3H).

[0727] Compound 26B

[0728] LC-MS (ESI + )m / z:382.2(M+H) + ;

[0729] Chiral HPLC (chiral column: CHIRALPAKIC, 3.0 mm*5 cm 3.0 μm, mobile phase A: supercritical carbon dioxide, mobile phase B: 0.1% diethylamine methanol solution, B: A = 15-30%), Rt = 3.560 min;

[0730] 1 H NMR (400MHz, d 6 -DMSO) δ13.20(br,1H),9.86(br,1H),8.20(s,1H),8.04(d,J=6.0Hz,1H),7.35(d,J=8.4Hz,2H),7.25(d,J=8.4Hz,2 H),7.11(m,1H),6.98(s,1H),3.21(m,2H),2.93-2.79(m,2H),2.66(m,1H),2.46-2.38(m,2H),1.12(d,J=6.4Hz,3H).

[0731] Example 27: Synthesis of Compound 27

[0732]

[0733] Compound 27 was synthesized by the following route:

[0734]

[0735] Step 1: Synthesis of compound 27-1

[0736] Intermediate A3 (100 mg, 0.33 mmol, 1.0 eq) was dissolved in tetrahydrofuran (5 mL). Under nitrogen protection, the mixture was added with lithium aluminum hydride tetrahydrofuran solution (1 M, 1.65 mL, 1.65 mmol, 5.0 eq) and heated to 70 ° C for stirring and reaction for 3 hours. After the reaction was completed, the reaction solution was cooled to 0 ° C, a small amount of ice water was added, and 15% sodium hydroxide aqueous solution (8 mL) was slowly added, and dichloromethane (30 mL × 3) was extracted, and the organic layers were combined. The organic layer was washed with saturated sodium chloride aqueous solution (30 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by rapid column chromatography (C18, acetonitrile: water = 5%-30%) to obtain compound 27-1 (20 mg, yield 28%).

[0737] LC-MS (ESI + )m / z:216.2(M+H) + ;

[0738] Step 2: Synthesis of compound 27

[0739] The synthesis method of compound 27 can refer to the synthesis method of compound 1 in Example 1, and compound 27 is generated by reacting intermediate 27-1 with 3-(4-chlorophenyl)propionic acid.

[0740] LC-MS (ESI + )m / z:382.2(M+H) + ;

[0741] 1 H NMR (400MHz, d 6 -DMSO) δ13.40(br,1H),10.03(br,1H),8.37(s,1H),8.26(m,2H),7.36(d,J=8.4Hz,2H),7 .29(d,J=8.4Hz,2H),3.25(m,2H),3.12(s,3H),2.92(t,J=7.4Hz,2H),2.69-2.60(m,4H).

[0742] Example 28: Synthesis of Compound 28

[0743]

[0744] Compound 28 was synthesized via the following route:

[0745]

[0746] At room temperature, compound 19 (200 mg, 0.54 mmol, 1.0 eq) was dissolved in dichloromethane (8 mL), and triethylamine (110 mg, 2.16 mmol, 4.0 eq), DMAP (13 mg, 0.11 mmol, 0.2 eq) and acetic anhydride (218 mg, 1.08 mmol, 2.0 eq) were added to the reaction solution in sequence. The reaction solution was stirred at room temperature for 2 hours. After the reaction was completed, the reaction solution was diluted with an appropriate amount of water (50 mL), extracted with ethyl acetate (30 mL × 3), and the organic layers were combined. The organic layer was washed with saturated sodium chloride (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was purified by using preparative high performance liquid chromatography (Prep-HPLC (MeCN:H 2 O (0.1% TFA) = 21%-29%) was purified to give compound 28 (23.8 mg, yield 11%).

[0747] LC-MS (ESI + )m / z:410.2(M+H) + ;

[0748] 1 H NMR (400MHz, d 6-DMSO) δ13.39(br,1H),8.15(s,1H),7.90(d,J=5.2Hz,1H),7.67(d,J=5.2Hz,1H),7.31(d,J=8.4 Hz,2H),7.22(d,J=8.4Hz,2H),6.56(br,1H),3.15(m,2H),2.83(m,4H),2.40(m,2H),2.21(s,3H).

[0749] Example 29: Synthesis of Compound 29

[0750]

[0751] The synthesis method of compound 29 can refer to the synthesis method of compound 14 in Example 14, and compound 29 is generated by two-step reaction of intermediate A12 and 4-chlorobenzylamine.

[0752] LC-MS (ESI + )m / z:369.2(M+H) + ;

[0753] 1 H NMR (400MHz, d 6 -DMSO)δ8.63(br,1H),8.21(s,1H),8.07(d,J=6.0Hz,1H),7.41(d,J=8.8Hz,2H),7.33 (d,J=8.8Hz,2H),7.19(m,1H),4.31(d,J=6.0Hz,2H),3.31-3.29(m,2H),2.71(m,2H).

[0754] Example 30: Synthesis of Compound 30

[0755]

[0756] Compound 30 was synthesized via the following route:

[0757]

[0758] Compound A1 (100 mg, 0.5 mmol, 1.0 eq) and N,N-diisopropylethylamine (129 mg, 1 mmol, 2.0 eq) were dissolved in N,N-dimethylformamide (3 mL), and N,N'-thiocarbonyldiimidazole (134 mg, 0.75 mmol, 1.5 eq) was added thereto. The reaction solution was stirred at 80 ° C for 1 hour, and 4-chlorobenzylamine (106 mg, 0.75 mmol, 1.5 eq) was added after the reaction returned to room temperature. The reaction solution was heated to 80 ° C and stirred again for 1 hour. After the reaction was monitored, it was cooled. The reaction solution was directly purified by flash column chromatography (C 18 , acetonitrile: 0.5‰ ammonia solution = 0-50%) to give compound 30 (11 mg, yield 6%).

[0759] LC-MS (ESI + )m / z:386.1(M+H) + ;

[0760] 1 H NMR (400MHz, d 6 -DMSO) δ13.30(brs,1H),9.92(brs,1H),9.46(brs,1H),8.34(s,1H),8.29(d,J=5 .2Hz,1H),7.82(m,1H),7.48-7.28(m,4H),4.80(s,2H),4.27(s,2H),2.99(s,2H).

[0761] Example 31: Synthesis of Compound 31

[0762]

[0763] The synthesis method of compound 31 can refer to the synthesis method of compound 14 in Example 14, and compound 31 is generated by two-step reaction of intermediate A12 and 4-chloro-3,5-difluorobenzylamine.

[0764] LC-MS (ESI + )m / z:405.2(M+H) + ;

[0765] 1 H NMR (400MHz, d 6-DMSO) δ12.81(br,1H),8.51(br,1H),8.15(s,1H),7.91(d,J=5.2Hz,1H),7.77-7.44(m,1H),7.25(s ,1H),7.23-7.18(m,2H),6.63(br,1H),4.35(d,J=6.0Hz,2H),2.73-2.60(m,2H),2.44-2.28(m,2H).

[0766] Example 32: Synthesis of Compound 32

[0767]

[0768] Compound 32 was synthesized via the following route:

[0769]

[0770] Step 1: Synthesis of compound 32-1

[0771] 4-Chlorobenzyl bromide (1g, 4.9mmol, 1.0eq) and 2-chloroethylamine hydrochloride (568mg, 4.9mmol, 1.0eq) were dissolved in N,N-dimethylformamide (10mL) at room temperature, and N,N-diisopropylethylamine (1.9mg, 14.7mmol, 3.0eq) was added thereto. The reaction solution was stirred at room temperature for 2 hours. After the reaction was monitored, the reaction solution was diluted with ethyl acetate (50mL), washed with water (50mL) and saturated sodium chloride aqueous solution (50mL) in turn. The organic phase was dried, filtered, and concentrated under reduced pressure. The crude product was purified by silica gel column chromatography (ethyl acetate: petroleum ether = 0-30%) to obtain compound 32-1 (520mg, yield 52%).

[0772] LC-MS (ESI + )m / z:204.1(M+H) + .

[0773] Step 2: Synthesis of compound 32-2

[0774] The synthesis method of compound 32-2 can refer to the synthesis method of compound 14-1 in Example 14. Compound 32-2 is generated by the reaction of intermediate A12 and compound 32-1.

[0775] LC-MS (ESI + )m / z:651.4(M+H) + .

[0776] Step 3: Synthesis of compound 32-3

[0777] Compound 32-2 (109 mg, 0.17 mmol, 1.0 eq) was dissolved in N,N-dimethylformamide (2 mL). Sodium hydroxide (20 mg, 0.51 mmol, 60% mass fraction, 3 eq) was added to the mixture at room temperature under nitrogen protection, and stirred at room temperature for 1 hour. After the reaction was monitored, the reaction solution was quenched with methanol (1 mL). The reaction solution was directly subjected to rapid column chromatography (C 18 , acetonitrile: 0.5‰ trifluoroacetic acid aqueous solution = 0-55%) to obtain compound 32-3 (72 mg, yield 70%).

[0778] LC-MS (ESI + )m / z:615.4(M+H) + .

[0779] Step 4: Synthesis of compound 32

[0780] Compound 32-3 (72 mg, 0.12 mmol, 1.0 eq) was dissolved in trifluoroacetic acid (2 mL). The reaction solution was refluxed at 80 °C for 2 hours. After the reaction was monitored, the reaction solution was concentrated under reduced pressure. The crude product was purified by rapid column chromatography (C 18 , acetonitrile: 0.5‰ ammonia solution = 0-50%) to give compound 32 (32 mg, yield 70%).

[0781] LC-MS (ESI + )m / z:395.2(M+H) + ;

[0782] 1 H NMR (400MHz, d 6 -DMSO) δ12.94(brs,1H),8.14(s,1H),7.88(d,J=5.2Hz,1H),7.64(d,J=5.2Hz,1H),7.44(d,J=8.4Hz,2H),7.33(d,J =8.4Hz,2H),6.53(brs,1H),4.35(s,2H),3.76(t,J=7.2Hz,2H),3.36(m,2H),3.24-3.15(m,2H),2.82-2.73(m,2H).

[0783] Example 33: Synthesis of Compound 33

[0784]

[0785] The synthesis method of compound 33 can refer to the synthesis method of compound 19 in Example 19, and compound 33 is generated by two-step reaction of intermediate A3 and 2-[(4-chlorophenyl)amino]acetic acid.

[0786] LC-MS (ESI + )m / z:369.1(M+H) + ;

[0787] 1 H NMR (400MHz, d 6 -DMSO) δ12.94(brs,1H),9.80(brs,1H),8.12(s,1H),7.86(m,1H),7.63(m,1H),7.13(d,J=8.8Hz,2H),6. 61(d,J=8.8Hz,2H),6.47(brs,1H),6.20(brs,1H),3.85(d,J=6.0Hz,2H),3.16(m,2H),2.61-2.52(m,2H).

[0788] Example 34: Synthesis of Compound 34

[0789]

[0790] The synthesis method of compound 34 can refer to the synthesis method of compound 19 in Example 19, and compound 34 is generated by a two-step reaction of intermediate A3 and 3-(4-chlorophenyl)-2-fluoropropionic acid.

[0791] LC-MS (ESI + )m / z:386.1(M+H) + ;

[0792] 1 H NMR (400MHz, d 6 -DMSO)δ13.02(brs,1H),9.97(brs,1H),8.13(s,1H),7.87(d,J=5.2Hz,1H),7.63(d,J=5.2Hz,1H), 7.39(d,J=8.4Hz,2H),7.33(d,J=8.4Hz,2H),6.51(brs,1H),5.33(m,1H),3.18(m,4H),2.42(m,2H).

[0793] Example 35: Synthesis of Compound 35

[0794]

[0795] The synthesis method of compound 35 can refer to the synthesis method of compound 14 in Example 14, and compound 35 is generated by two-step reaction of intermediate A12 and 3-(4-chlorophenyl)azetidine.

[0796] LC-MS (ESI+ )m / z:395.2(M+H) + ;

[0797] 1 H NMR (400MHz, d 6 -DMSO)δ12.83(brs,1H),8.39(brs,1H),8.13(s,1H),7.87(m,1H),7.64(m,1H),7.51-7.38(m,4 H),6.48(brs,1H),4.42-4.25(m,2H),3.94-3.80(m,3H),3.25-3.18(m,2H),2.71-2.64(m,2H).

[0798] Example 36: Synthesis of Compound 36

[0799]

[0800] The synthesis method of compound 36 can refer to the synthesis method of compound 19 in Example 19, and compound 36 is generated by two-step reaction of intermediate A3 and 7-chloro-3,4-dihydro-2H-1-benzopyran-4-acetic acid.

[0801] 1 H NMR (400MHz, d 6 -DMSO) δ12.94(brs,1H),9.87(brs,1H),8.13(s,1H),7.87(d,J=5.2Hz,1H),7.65(m,1H),7.28(d,J=8.4Hz,1H),6.90(d,J=8.4Hz,1H),6.84(s,1 H),6.49(br,1H),4.31-4.09(m,2H),3.31-3.26(m,2H),3.24-3.16(m,2H ),2.78(m,1H),2.66-2.60(m,2H),2.09-2.01(m,1H),1.91-1.77(m,1H).

[0802] Example 37: Synthesis of Compounds 37A and 37B

[0803]

[0804] Compounds 37A and 37B were synthesized by the following route:

[0805]

[0806] Step 1: Synthesis of compound 37-1

[0807] Intermediate A3 (1.31 g, 6.485 mmol, 1.0 eq) and 3-(4-chlorophenyl)glutaric anhydride (370 mg, 1.66 mmol, 1.0 eq) were dissolved in tetrahydrofuran (10 mL). The mixture was stirred at 65 ° C for 16 hours. After the reaction was completed, the reaction solution was concentrated under reduced pressure. The residue was purified by flash chromatography column (C18, acetonitrile: water = 10% to 50%) to obtain compound 37-1 (640 mg, 73.3%).

[0808] LC-MS (ESI + )m / z:526.2(M+H) + .

[0809] Step 2: Synthesis of compound 37-2

[0810] Compound 37-1 (100 mg, 0.19 mmol, 1.0 eq) was dissolved in tetrahydrofuran (5 mL). The reaction solution was cooled to 0 ° C, and lithium aluminum hydride tetrahydrofuran solution (1M, 1.9 mmol, 1.9 ml, 10.0 eq) was added dropwise under nitrogen protection. After the addition was completed, the temperature was gradually restored to room temperature, and the reaction solution was stirred and reacted at room temperature for two hours. After the reaction was completed, the reaction solution was cooled to 0 ° C, and cold water (2 ml) and 15% sodium hydroxide aqueous solution (3 ml) were slowly added in sequence, and then concentrated and purified by rapid column chromatography (dichloromethane: methanol = 10: 1) to obtain compound 37-2 (35 mg, yield 34.16%).

[0811] LC-MS (ESI + )m / z:512.2(M+H) + .

[0812] Step 3: Synthesis of compound 37-3

[0813] Compound 37-2 (1.26 g, 2.46 mmol, 1.0 eq) was dissolved in tetrahydrofuran (25 ml). The reaction solution was cooled to 0 °C, and triethylamine (746.7 mg, 7.38 mmol, 3.0 eq) and methylsulfonyl chloride (563.5 mg, 4.92 mmol, 2.0 mmol) were added in sequence. The temperature was gradually restored to room temperature, and the reaction solution was stirred for 3 hours. After the reaction was completed, the reaction solution was poured into a saturated aqueous sodium bicarbonate solution (50 ml), extracted with dichloromethane (50 mL × 3), and the organic layers were combined. The organic layer was washed with a saturated aqueous sodium chloride solution (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography (dichloromethane: methanol = 20: 1) to obtain compound 37-3 (720 mg, yield 61.84%).

[0814] LC-MS (ESI+ )m / z:590.3(M+H) + .

[0815] Step 4: Synthesis of compound 37-4

[0816] Compound 37-3 (720 mg, 1.22 mmol, 1.0 eq) was dissolved in tetrahydrofuran (15 mL). The reaction solution was cooled to 0 ° C and sodium hydride (mass fraction 60%, 810 mg, 12.2 mmol, 10.0 eq) was added. Slowly returned to room temperature, and the reaction solution continued to react at 30 ° C for 4 hours. After the monitoring reaction was completed, the reaction solution was slowly poured into a cold saturated aqueous solution of ammonium chloride (20 ml), then extracted with dichloromethane (30 mL × 3), and the organic layers were combined. The organic layer was washed with a saturated aqueous sodium chloride solution (30 ml), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was purified by flash column chromatography (dichloromethane: methanol = 20: 1) to obtain compound 37-4 (460 mg, yield 61.84%).

[0817] LC-MS (ESI + )m / z:494.3(M+H) + .

[0818] Step 5: Synthesis of compounds 37A and 37B

[0819] Compound 37-4 (460 mg, 0.931 mmol, 1.0 eq) was dissolved in a solution of hydrogen chloride in dioxane (4 M, 12 mL) and stirred at room temperature for one hour. After the reaction was completed, the reaction solution was concentrated under reduced pressure, diluted with dichloromethane (90 mL), and washed with saturated sodium bicarbonate aqueous solution (30 mL) and saturated sodium chloride aqueous solution (30 mL) in sequence. The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by flash chromatography (acetonitrile: water = 10% to 60%) and further separated by chiral separation (chiral chromatography column: Mobile phase A: n-hexane, mobile phase B: ethanol (+0.1% 7.0 mol / l ammonia methanol solution), A:B=60:40, flow rate: 80 ml / min) was used to separate compound 37A (29.78 mg, yield 16.3%) and compound 37B (34.38 mg, yield 19.1%).

[0820] Compound 37A

[0821] LC-MS (ESI + )m / z:394.2(M+H) + ;

[0822] Chiral HPLC 4.6*250mm, 5um, mobile phase A: n-hexane, mobile phase B: 0.2% diethylamine ethanol solution, B: A = 40%) Rt = 11.466min;

[0823] 1 H NMR (400MHz, d 6 -DMSO)δ13.43(br,1H),8.24(s,1H),8.12(m,1H),7.47-7.35(m,4H),7.23(m,1 H),3.82-3.71(m,2H),3.63-3.60(m,3H),2.73-2.58(m,4H),2.17-2.05(m,2H).

[0824] Compound 37B

[0825] LC-MS (ESI + )m / z:394.2(M+H) + ;

[0826] Chiral HPLC 4.6*250mm, 5um, mobile phase A: n-hexane, mobile phase B: 0.2% diethylamine ethanol solution, B: A = 40%) Rt = 14.687min;

[0827] 1 H NMR (400MHz, d 6 -DMSO)δ13.46(br,1H),8.26(s,1H),8.12(m,1H),7.50-7.29(m,4H),7.23(m,1 H),3.84-3.70(m,2H),3.66-3.57(m,3H),2.74-2.56(m,4H),2.17-2.05(m,2H).

[0828] Example 38: Synthesis of Compound 38

[0829]

[0830] The synthesis method of compound 38 can refer to the synthesis method of compound 19 in Example 19, and compound 38 is generated by two-step reaction of intermediate A3 and 3-(5-chlorothiophen-2-yl)propionic acid.

[0831] LC-MS (ESI + )m / z:374.0(M+H) + ;

[0832] 1 H NMR (400MHz, d 6-DMSO) δ13.40(br,1H),10.06(br,1H),8.23(m,2H),8.09(d,J=5.6Hz,1H),7.24(m,1H),6.94(d,J=3.6 Hz,1H),6.78(d,J=3.6Hz,1H),3.29(m,2H),3.06(t,J=7.2Hz,2H),2.68(t,J=7.2Hz,2H),2.64(m,2H).

[0833] Example 39: Synthesis of Compound 39

[0834]

[0835] The synthesis method of compound 39 can refer to the synthesis method of compound 1 in Example 1, and compound 39 is generated by reacting intermediate A5 and 3-(4-chlorophenyl)propionic acid.

[0836] LC-MS (ESI + )m / z:367.2(M+H) + ;

[0837] 1 H NMR (400MHz, d 6 -DMSO) δ13.38(br,1H),9.93(br,1H),8.65(m,2H),8.21(m,1H),7.35(d,J=8.4Hz,2H),7.29(d,J=8.4Hz,2H ),3.02-2.94(m,2H),2.92(t,J=7.4Hz,2H),2.66(t,J=7.2Hz,2H),2.56(t,J=6.0Hz,2H),1.96-1.82(m,2H).

[0838] Example 40: Synthesis of Compound 40

[0839]

[0840] The synthesis method of compound 40 can refer to the synthesis method of compound 1 in Example 1, and compound 40 is generated by reacting intermediate A6 with 3-(4-chlorophenyl)propionic acid.

[0841] LC-MS (ESI + )m / z:353.2(M+H) + ;

[0842] 1 H NMR (400MHz, d 6-DMSO)δ13.20(br,1H),10.10(br,1H),8.45(m,2H),7.50(d,J=4.8Hz,1H),7.3 5(d,J=8.0Hz,2H),7.28(d,J=8.0Hz,2H),2.92-2.83(m,4H),2.64-2.58(m,4H).

[0843] Example 41: Synthesis of Compound 41

[0844]

[0845] The synthesis method of compound 41 can refer to the synthesis method of compound 1 in Example 1, and compound 41 is generated by reacting intermediate A10 with 3-(4-chlorophenyl)propionic acid.

[0846] LC-MS (ESI + )m / z:385.1(M+H) + ;

[0847] 1 H NMR (400MHz, d 6 -DMSO)δ9.92(brs,1H),8.73(s,1H),8.58(d,J=5.6Hz,1H),7.99(m,1H),7.38(d,J=8 .4Hz,2H),7.32(d,J=8.4Hz,2H),3.09(m,2H),2.93(m,2H),2.87(m,2H),2.67(m,2H).

[0848] Example 42: Synthesis of Compound 42

[0849]

[0850] Compound 42 was synthesized via the following route:

[0851]

[0852] Step 1: Synthesis of Compound 42-1

[0853] Compound 41 (38 mg, 0.1 mmol, 1.0 eq) was dissolved in dichloromethane (1 mL), and m-chloroperbenzoic acid (62 mg, 0.36 mmol, 85% mass fraction, 3.6 eq) was slowly added thereto. The reaction solution was stirred at room temperature for 16 hours. After the reaction was monitored, the reaction solution was concentrated under reduced pressure, and the crude product was purified by silica gel column chromatography (methanol: dichloromethane = 0-10%) to obtain compound 42-1 (30 mg, yield 70%).

[0854] LC-MS (ESI+ )m / z:433.0(M+H) + ;

[0855] Step 2: Synthesis of Compound 42

[0856] Compound 42-1 (30 mg, 0.07 mmol, 1.0 eq) was dissolved in acetic acid (1 mL), and then iron powder (12 mg, 0.21 mmol, 3 eq) was added. The reaction solution was reacted at 70°C for 2 hours. After the reaction was monitored, the reaction solution was filtered and concentrated under reduced pressure. The crude product was purified by rapid column chromatography (C 18 , acetonitrile: 0.5‰ trifluoroacetic acid aqueous solution = 0-45%) to give compound 42 (17 mg, yield 60%).

[0857] LC-MS (ESI + )m / z:417.1(M+H) + ;

[0858] 1 H NMR (400MHz, d 6 -DMSO) δ10.05(br,1H),9.12(s,1H),8.89(d,J=5.2Hz,1H),8.17(m,1H),7.39(d,J=8.0Hz ,2H),7.32(d,J=8.0Hz,2H),3.85(t,J=6.4Hz,2H),3.00-2.84(m,4H),2.75-2.65(m,2H).

[0859] Example 43: Synthesis of Compound 43

[0860]

[0861] The synthesis method of compound 43 can refer to the synthesis method of compound 1 in Example 1, and compound 43 is generated by the reaction of intermediate A9 and 3-(4-chlorophenyl)propionic acid.

[0862] LC-MS (ESI + )m / z:383.1(M+H) + ;

[0863] 1 H NMR (400MHz, d 6-DMSO) δ12.96(br,1H),9.63(brs,1H),8.39-8.23(m,2H),7.46(m,1H),7.35(d,J=8.4Hz,2H),7.29(d,J =8.4Hz,2H),4.19(m,2H),2.90(d,J=7.2Hz,2H),2.66-2.57(m,2H),2.39(m,2H),1.75(d,J=7.2Hz,2H).

[0864] Example 44: Synthesis of Compound 44

[0865]

[0866] Compound 44 was synthesized via the following route:

[0867]

[0868] The synthesis method of compound 44-1 can refer to the synthesis method of compound 1 in Example 1, and compound 44-1 is produced by reacting intermediate A4 with 3-(4-chlorophenyl)propionic acid.

[0869] LC-MS (ESI + )m / z:488.2(M+H) + ;

[0870] Synthesis of compound 44:

[0871] Compound 44-1 (36 mg, 0.074 mmol, 1.0 eq) was dissolved in trifluoroacetic acid (2 mL). The reaction solution was stirred at 80 ° C for 16 hours. After the reaction was completed, the reaction solution was concentrated under reduced pressure. The residue was purified by preparative high performance liquid chromatography (Prep-HPLC (Gilson GX-281) column: Pursuit XRs C18, 250*21.2 mm, 10 um; mobile phase A: 0.05% trifluoroacetic acid aqueous solution, B: acetonitrile; flow rate: 20 ml / min; gradient: 30-40%; retention time: 7.0-7.5 min of 17 min) to obtain compound 44 (15.19 mg, yield 55%).

[0872] LC-MS (ESI + )m / z:368.2(M+H) + ;

[0873] 1 H NMR (400MHz, d 6-DMSO) δ12.89(br,1H),10.12(s,1H),8.62(d,J=6.4Hz,1H),8.52(s,1H),7.99(m,1H),7.36(d,J=8.0Hz,2H ),7.29(d,J=8.0Hz,2H),3.36-3.34(m,2H),3.09-3.00(m,2H),2.91(t,J=7.2Hz,2H),2.65(t,J=7.6Hz,2H).

[0874] Example 45: Synthesis of Compound 45

[0875]

[0876] The synthesis method of compound 45 can refer to the synthesis method of compound 1 in Example 1, and compound 45 is generated by reacting intermediate A9 and 3-(4-chloro-3,5-difluorophenyl)propionic acid.

[0877] LC-MS (ESI + )m / z:419.1(M+H) + ;

[0878] 1 H NMR (400MHz, d 6 -DMSO) δ12.98(br,1H),9.65-9.95(br,1H),8.38-8.23(m,2H),7.46-7.62(m,1H),7.26(d,J= 9.2Hz,2H),4.19(m,2H),2.94(t,J=7.2Hz,2H),2.75-2.65(m,2H),2.41(m,2H),1.73(m,2H).

[0879] Example 46: Synthesis of Compound 46

[0880]

[0881] The synthesis method of compound 46 can refer to the synthesis method of compound 19 in Example 19, and compound 46 is generated by two-step reaction of intermediate A8 and 3-(4-chloro-3,5-difluorophenyl)propionic acid.

[0882] LC-MS (ESI + )m / z:418.3(M+H) + ;

[0883] 1 H NMR (400MHz, d 6-DMSO) δ12.96(brs,1H),9.47(brs,1H),7.95(s,1H),7.66(m,1H),7.25(d,J=9.2Hz,2H),7.02(m,1H),6.06(br 1H),3.16(m,2H),2.94(m,2H),2.63(m,2H),2.37(m,2H),1.33(m,2H).

[0884] Example 47: Synthesis of Compound 47

[0885]

[0886] The synthesis method of compound 47 can refer to the synthesis method of compound 1 in Example 1, and compound 47 is generated by reacting intermediate A11 with 3-(4-chlorophenyl)propionic acid.

[0887] LC-MS (ESI + )m / z:382.1(M+H) + ;

[0888] 1 H NMR (400MHz, d 6 -DMSO)δ12.94(br,1H),10.26(br,1H),9.01(s,1H),8.70(m,1H),8.53(m,1H),7.64(m,1H),7.36( d,J=8.2Hz,2H),7.29(d,J=8.2Hz,2H),3.95(m,2H),2.91(t,J=7.6Hz,2H),2.65(t,J=7.6Hz,2H).

[0889] Example 48: Synthesis of Compound 48

[0890]

[0891] Compounds 48A and 48B were synthesized by the following route:

[0892]

[0893] Step 1: Synthesis of Compound 48-1

[0894] The synthesis method of compound 48-1 can refer to the synthesis method of compound 1 in Example 1, and compound 48-1 is produced by reacting intermediate A7 with 3-(4-chlorophenyl)propionic acid.

[0895] LC-MS (ESI + )m / z:482.2(M+H) + .

[0896] Step 2: Synthesis of compounds 48A and 48B

[0897] Compound 48-1 (910 mg, 1.89 mmol, 1.0 eq) was dissolved in dichloromethane (10 mL) and trifluoroacetic acid (5 mL) was added. The reaction solution was stirred at room temperature for 1 hour. After the reaction was monitored, the reaction solution was concentrated under reduced pressure. The crude product was dissolved in ethyl acetate (30 mL), washed with saturated sodium bicarbonate (15 mL) and saturated sodium chloride (10 mL). The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The product was chiral separated using SFC (chiral chromatographic column: Mobile phase A: supercritical carbon dioxide, mobile phase B: methanol (+0.1% 7.0 mol / l ammonia methanol solution) to obtain compound 48A (44.55 mg, yield 12.3%) and compound 48B (36.95 mg, yield 10.2%).

[0898] Compound 48A:

[0899] LC-MS (ESI + )m / z:382.2(M+H) + ;

[0900] Chiral HPLC (chiral column: CHIRALPAKIC, 100*3.0mm 3.0μm, mobile phase A: supercritical carbon dioxide, mobile phase B: 0.1% diethylamine methanol solution, B: A = 15-20%), Rt = 1.707min;

[0901] 1 H NMR (400MHz, DMSO) δ12.87(br,1H),9.61(br,1H),8.15(s,1H),7.85(d,J=4.8Hz,1H),7.65(m,1H),7.35(d,J=8.4Hz,2H ),7.29(d,J=,8.4Hz,2H),6.39(br,1H),3.17-3.14(m,1H),2.96-2.89(m,4H),2.65-2.63(m,2H),0.97(d,J=6.8Hz,3H).

[0902] Compound 48B

[0903] LC-MS (ESI + )m / z:382.2(M+H) + ;

[0904] Chiral HPLC (chiral column: CHIRALPAKIC, 100*3.0mm 3.0μm, mobile phase A: supercritical carbon dioxide, mobile phase B: 0.1% diethylamine methanol solution, B: A = 15-20%), Rt = 2.119min;

[0905] 1 H NMR (400MHz, DMSO) δ12.90(br,1H),9.58(br,1H),8.16(s,1H),7.85(s,1H),7.63(s,1H),7.35(d,J=8.4 Hz,2H),7.29(d,J=8.4Hz,2H),6.42(br,1H),3.15(m,1H),2.93-2.89(m,4H),2.62(m,2H),0.97(m,3H).

[0906] Example 49: Synthesis of Compound 49

[0907]

[0908] The synthesis method of compound 49 can refer to the synthesis method of compound 1 in Example 1, and compound 49 is generated by the reaction of intermediate A13 and 3-(4-chlorophenyl)propionic acid.

[0909] LC-MS (ESI + )m / z:382.2(M+H) + ;

[0910] 1 H NMR (400 MHz, DMSO-d 6 )δ12.70(br,1H),9.35(br,1H),8.39-8.37(m,2H),7.75(m,1H),7.29(m,4H),3.04(m,2H),2.95-2.83(m,4H),2.62(m,5H).

[0911] Example 50: Synthesis of Compound 50

[0912]

[0913] Compound 50 was synthesized via the following route:

[0914]

[0915] Step 1: Synthesis of Compound 50-1

[0916] The synthesis method of compound 50-1 can refer to the synthesis method of compound 1 in Example 1, and intermediate A14 and 3-(4-chlorophenyl)propionic acid are reacted to produce compound 50-1.

[0917] LC-MS (ESI + )m / z:546.1(M+H) + .

[0918] Step 2: Synthesis of Compound 50

[0919] Compound 50-1 (50 mg, 0.38 mmol, 1.0 eq) was dissolved in 1,4-dioxane (1 mL), and hydrochloric acid / 1,4-dioxane (4 M, 2 mL) was added. The reaction solution was stirred at room temperature for 1 hour. After the reaction was completed, the reaction solution was concentrated under reduced pressure. The crude product was analyzed by reverse HPLC ((0.1% NH 4 HCO 3 / H 2 O)MeCN 37%-47%))) to prepare compound 50 (11.17 mg, yield 27%).

[0920] LC-MS (ESI + )m / z:446.0(M+H) + ;

[0921] 1 H NMR (400MHz, DMSO) δ12.43(br,1H),9.73(br,1H),8.09-8.07(m,2H),7.35(d,J=8.4Hz,2H),7.29(d,J =8.4Hz,2H),6.43(br,1H),3.31-3.25(m,2H),2.91(t,J=7.6Hz,2H),2.67-2.62(m,2H),2.51(m,2H).

[0922] Example 51: Synthesis of Compound 51

[0923]

[0924] Compound 51 was synthesized via the following route:

[0925]

[0926] The synthesis method of compound 51 can refer to the synthesis method of compound 50 in Example 50, and compound 51 is generated by a two-step reaction of intermediate A15 and 3-(4-chlorophenyl)propionic acid.

[0927] LC-MS (ESI +)m / z:382.2(M+H) + ;

[0928] 1 H NMR (400 MHz, DMSO-d 6 )δ12.31(br,1H),9.78(brs,1H),7.99(s,1H),7.81(s,1H),7.35(d,J=8.4Hz,2H),7.29(d,J=8. 4Hz,2H),6.00(brs,1H),3.19(s,2H),2.91(t,J=7.4Hz,2H),2.63(t,J=7.4Hz,2H),2.52(s,3H).

[0929] Example 52: Synthesis of Compound 52

[0930]

[0931] Compound 52 was synthesized by the following route:

[0932]

[0933] Step 1: Synthesis of Compound 52-1

[0934] The synthesis method of compound 52-1 can refer to the synthesis method of compound 1 in Example 1, and compound 52-1 is produced by reacting intermediate A16 with 3-(4-chlorophenyl)propionic acid.

[0935] LC-MS (ESI + )m / z:590.2(M+H) + .

[0936] Step 2: Synthesis of Compound 52

[0937] Compound 52-1 (20 mg, 0.03 mmol, 1.0 eq) was dissolved in N, N-dimethylformamide (2 mL), and 1,8-diazabicyclo[5.4.0]undec-7-ene (15 uL, 0.1 mmol, 3.0 eq) was added thereto. The mixture was stirred at room temperature for 30 minutes. After the reaction was completed, the reaction solution was subjected to reverse HPLC (prep-HPLC, column: Welch XT C18 150 mm*21.2 mm, 5 um, flow rate: 15 ml / min, mobile phase: A: 0.1% ammonia solution, B: acetonitrile, wavelength: 214 nm, gradient: 15%-60% retention time: 13 min) to prepare compound 52 (5 mg, yield 40%).

[0938] LC-MS (ESI+) m / z: 368.1 (M+H)+ ;

[0939] 1 H NMR (400 MHz, DMSO-d 6 )δ13.02(br,1H),9.82(br,1H),8.45(d,J=5.2Hz,1H),8.36(s,1H),7.78(m,1H), 7.35-7.28(m,4H),3.89(s,2H),3.75(s,2H),2.83(t,J=7.2Hz,2H),2.50(m,2H).

[0940] Example 53: Synthesis of Compound 53

[0941]

[0942] Compound 53 was synthesized by the following route:

[0943]

[0944] Step 1: Synthesis of Compound 53-1

[0945] The synthesis method of compound 53-1 can refer to the synthesis method of compound 1 in Example 1, and compound 53-1 is produced by reacting intermediate A17 with 3-(4-chlorophenyl)propionic acid.

[0946] 1 H NMR (400 MHz, DMSO-d 6 )δ13.32(brs,1H),10.06(brs,1H),8.71-8.64(m,1H),7.87(s,1H),7.73(s,1H),7.39-7.26(m,6H),6.92 (d,J=8.4,2H),4.43(s,2H),4.34-4.08(m,2H),3.74(s,3H),2.92(m,4H),2.77-2.61(m,2H),1.36(m,9H).

[0947] Step 2: Synthesis of Compound 53

[0948] Compound 53-1 (200 mg, 0.33 mmol, 1.0 eq) was dissolved in trifluoroacetic acid (5 mL), heated to 70 ° C for 1 hour. After the reaction was completed, it was concentrated under reduced pressure. The obtained residue was subjected to reverse preparative high performance liquid chromatography (prep-HPLC: Gilson GX-281-011, chromatographic column: XBridge C18 19*250mm, 10um, mobile phase A: 0.05% trifluoroacetic acid aqueous solution, B: acetonitrile, flow rate: 20 ml / min; gradient: 35-45%; retention time: 6.5-7.5 min of 17 min) to prepare compound 53 (33.1 mg, yield 26.2%).

[0949] LC-MS (ESI + )m / z:383.2(M+H) + ;

[0950] 1 H NMR (400 MHz, DMSO-d 6 )δ7.43(s,1H),7.35(d,J=8.4Hz,2H),7.29(m,3H),6.76(br,2H),5.89(brs,1H ),3.18-3.06(m,2H),2.92(t,J=7.6Hz,2H),2.68(t,J=7.6Hz,2H),2.53(m,2H).

[0951] Biological test evaluation

[0952] 1. Preparation of SARM1 and detection of NADase activity

[0953] 1. Experimental Materials

[0954]

[0955]

[0956] 2. Experimental Instruments

[0957]

[0958] 3. Experimental Methods

[0959] Construction of SARM1 stable transfected cell lines and preparation of lysate

[0960] (1) Plasmid construction

[0961] In this case, PCR was used to amplify the sequence of the SARM1 (aa28-724) gene, the N-terminal mitochondrial localization signal peptide of SARM1 was removed, and the PCR amplification product was constructed into the pCDH-CMV-MCS-EF1-Puro plasmid (addgene: catalog #CD510B-1).

[0962] The PCR amplified SARM1 (aa28-724) gene fragment is shown below (SEQ ID NO. 1).

[0963] GCGGTGCCTGGGCCAGATGGGGGCGGTGGCACGGGC

[0964] CCATGGTGGGCTGCGGGTGGCCGCGGGCCCCGCGAAGTGTCGCCGGGGGCAGGCACCGAG

[0965] GTGCAGGACGCCCTGGAGCGCGCCGCTGCCGGAGCTGCAGCAGGCCTTGTCCGCGCTGAAG

[0966] CAGGCGGGCGGCGCGCGGGCCGTGGGCGCCGGCCTGGCCGAGGTCTTCCAACTGGTGGAG

[0967] GAGGCCTGGCTGCTGCCGGCCGTGGGCCGCGAGGTAGCCCAGGGTCTGTGCGACGCCATC

[0968] CGCCTCGATGGCGGCCTCGACCTGCTGTTGCGGCTGCTGCAGGCGCCGGAGTTGGAGACG

[0969] CGTGTGCAGGCCGCGCGCCTGCTGGAGCAGATCCTGGTGGCTGAGAACCGAGACCGCGTG

[0970] GCGCGCATTGGGCTGGGCGTGATCCTGAACCTGGCGAAGGAACGCGAACCCGTAGAGCTG

[0971] GCGCGGAGCGTGGCAGGCATCTTGGAGCACATGTTCAAGCATTCGGAGGAGACATGCCAG

[0972] AGGCTGGTGGCGGCCGGCGGCCTGGACGCGGTGCTGTATTGGTGCCGCGCCACGGACCCC

[0973] GCGCTGCTGCGCCACTGCGCGCTGGCGCTGGGCAACTGCGCGCTGCACGGGGCCAGGCG

[0974] GTGCAGCGACGCATGGTAGAGAGCGCGCAGCCGAGTGGCTCTTCCCGCTCGCCTTCTCC

[0975] AAGGAGGACGAGCTGCTTCGCTGCACGCCTGCCTGCAGTAGCGGTGTTGGCGACTAAC

[0976] AAGGAGGTGGAGCGCGAGGTGGAGCGCTCGGGCACGCCTGGCGCTCGTGGAGCCGCTTGTG

[0977] GCCTCGCTGGACCCTGGCGCCTTCGCCCGCTGTCTGGTGGACGCCAGCGACACAAGCCAG

[0978] GGCCGCGGGCCCGACGACCTGCAGCGCCTCGTGCCGTTGCTCCGACTCTAACCGCTTGGAG

[0979] GCGCAGTGCATCGGGGCTTTCTACCTCTGCGCCGAGGCTGCCATCAAGAGCCTGCAAGGC

[0980] AAGACCAAGGTGTTCAGCGACATCGGCGCCATCCAGAGCCTGAAACGCCTGGTTTCCTAC

[0981] TCTACCAATGGCACTAAGTCGGCGCTGGCCAAGCGCGCGCTGCGCCTGCTGGGCGAGGAG

[0982] GTGCCACGCCCATCCTGCCCTCCGTGCCAGCTGGAAGGAGGCCGAGGTTCAGACGTGG

[0983] CTGCAGCAGATCGGTTTCTCCAAGTACTGCGAGAGCTTCCGGGAGCAGCAGGTGGATGGC

[0984] GACCTGCTTCTGCGGCTCACGGAGGAGGAACTCCAGACCGACCTGGGCATGAAATCGGGC

[0985] ATCACCCGCAAGAGGTTCTTTAGGGAGCTCACGGAGCTCAAGACCTTCGCCAACTATTCT

[0986] ACGTGCGACCGCAGCAACCTGGCGGACTGGCTGGGCAGCCTGGACCCGCGCTTCCGCCAG

[0987] TACACCTACGGCCTGGTCAGCTGCGGCCTGGACCGCTCCCTGCTGCCACCGCGTGTCTGAG

[0988] CAGCAGCTGCTGGAAGACTGCGGCATCCACCTGGGGCGTGCACCGCGCCGCATCCTCACG

[0989] GCGGCCAGAGAAATGCTACACTCCCCGCTGCCCTGTACTGGTGGCAAACCCAGTGGGGAC

[0990] ACTCCAGATGTCTTCATCAGCTACCGCCGGAACTCAGGTTCCCAGCTGGCCAGTCTCCTG

[0991] AAGGTGCACCTGCAGCTGCATGGCTTCAGTGTCTTCATTGATGTGGAGAAGCTGGAAGCA

[0992] GGCAAGTTCGAGGACAAACTCATCCAGAGGTGTCATGGGTGCCCCGCAACTTTGTGTTGGTG

[0993] CTATCACCTGGAGCACTGGACAAGTGCATGCAAGACCATGACTGCAAGGATTGGGTGCAT

[0994] AAGGAGATTGTGACTGCTTTAAGCTGCGGCAAGAACATTGTGCCCATCATTGATGGCTTC

[0995] GAGTGGCCTGAGCCCCAGGTCCTGCCTGAGGACATGCAGGCTGTGCTTACTTTCAACGGT

[0996] ATCAAGTGGTCCCACGAATACCAGGAGGCCACCATTGAGAAGATCATCCGCTTCCTGCAG

[0997] GGCCGCTCCTCCCGGGACTCATCTGCAGGCTCTGACACCAGTTTGGAGGGTGCTGCACCC

[0998] ATGGGTCCAACCTAA

[0999] The PCR amplification reaction system is:

[1000] 5× PrimeSTAR Buffer (Mg2+plus) 10μL, dNTP Mixture (2.5mMeach) 4μL, add dN-SARM1-F with a final concentration of 0.2μmol / L, add dN-SARM1-R with a final concentration of 0.2μmol / L, DNA template 100ng, PrimeSTAR HSDNA Polymerase (2.5U / μL) 0.5μL, and finally add sterile ddH 2 The full-length SARM1 was synthesized by Huamei Biotechnology into the pMD18-T Simple Vector plasmid, and PCR was performed using pMD18-T-SARM1 as a DNA template.

[1001] The PCR amplification product was electrophoresed by agarose gel, and then recovered and purified using the Omega gel recovery kit D2500-02. The specific steps of gel excision and recovery refer to the kit instructions. The recovered and purified PCR amplification product was used to construct a vector with pCDH-CMV-MCS-EF1-Puro.

[1002] (2) Transfection

[1003] In this example, the constructed pLenti-CMV-puro-dest and the virus packaging plasmid psPAX2, pMD2.G (addgene psPAX2:#12260, pMD2.G:#12259) were co-transfected into HEK293T cells (ATCC) by lipofectamine 2000 (Life Technologies) to prepare a virus with the dN-SARM1 reading frame. The details are as follows:

[1004] 1×106 cells were plated in a 3.5 cm dish and transfected the next day.

[1005] Plasmid mixture: 1.7 μg of pLenti-dN-SARM1, 1.7 μg of psPAX2, 0.6 μg of pMD2.G, 8 μL lipofectamine 2000 transfection reagent, transfection was performed according to the instructions, the medium was changed after 8 hours, and the virus was collected for 48 hours.

[1006] (3) Cell screening

[1007] The HEK293T cells obtained in the "(2) transfection" step were infected with the dN-SARM1 virus, and cells stably expressing the dN-SARM1 protein were obtained by adding puromycin for selection. The details are as follows:

[1008] Virus: 80μL / 3.5cm infected 2×105, 48 hours after infection, add 2μg / mL puromycin for screening, 48 hours after screening, the cells not infected with the virus have completely died. Most of the cells infected with the virus survived, and 2μg / mL puromycin was added again for a second screening for 48 hours.

[1009] NADase activity assay

[1010] (1) Establishment of enzyme activity method

[1011] In order to identify SARM1 inhibitors, a fluorescence analysis method was used, which mainly monitors the fluorescence changes of PC6 (styrene, pyridine conjugate compound). The principle of this method is: when SARM1 undergoes base substitution, SARM1 catalyzes the PC6 probe to replace nicotinamide on NAD. The disappearance of nicotinamide leads to an increase in the electron absorption capacity of the pyridine ring and an increase in the charge transfer capacity within the molecule, thereby increasing the fluorescence of the product. When SARM1 is inhibited, its catalytic activity decreases, resulting in a slower replacement of the PC6 probe, thereby weakening the fluorescence signal.

[1012] (2) Enzyme activity determination method

[1013] Lyse cells: 1. Take out the experimental supplies needed for the experiment from the refrigerator in advance, restore them to room temperature before use, and precool the centrifuge to 4°C. Take out the HEK-SARM1-293T Clone cells and HEK-SARM1-293T Pool cells from the 80°C refrigerator, put them on ice to thaw, add KHM lysis buffer after thawing (calculated based on 1mL lysis buffer for one T 75), place the sample on a micro-oscillator to mix thoroughly, and lyse on ice for 30 minutes, while marking. Next, prepare dry 1.5mL centrifuge tubes and mark them, and transfer the liquid in the bottle to the marked 1.5mL EP tube. If there is a translucent, semi-gel-like liquid in the EP tube, use a micro-oscillator to mix and lyse thoroughly. Evenly place all the lysed protein samples in the precooled high-speed centrifuge, pay attention to balancing, and then centrifuge at 4°C and 15,000rpm for 10 minutes. After centrifugation, pipette the supernatant into a new 1.5mL EP tube and perform a second centrifugation under the same conditions. Finally, carefully remove the EP tube and place it on ice, carefully aspirate the supernatant in the tube and transfer it to a new labeled 15mL centrifuge tube, and indicate the volume and name. Then perform Bradford protein quantification operation. For the specific process, refer to 2.3.2.2 Bradford protein quantification operation.

[1014] Set up the enzyme reaction: First, prepare the reagents of appropriate concentrations as required, and then set up the enzyme reaction. Take out a 96-well plate or a 384-well plate, set up the negative control well and the sample measurement well, add a relatively fixed amount of cell lysate and 15 μL of 100 μM NMN substrate solution, respectively, and make up with PBS lysate if it is less than 15 μL; then add or not add 5 μL of small molecule inhibitors (use PBS to make up the corresponding volume for the group without adding), and incubate at room temperature for 30 minutes. After the incubation is completed, add 5 μL of 250 μM PC6 and 250 μM NAD to start the reaction.

[1015] Microplate reader fluorescence irradiation: relative fluorescence readings were performed using a microplate reader under vertical irradiation. The luminescence intensity of the fluorescein substrate was read, and the SARM1 enzyme activity was calculated by continuous monitoring. The obtained data was analyzed using GraphPad and the background value was deducted. In the experiment with PC6 as the detection probe, the OD value in the range of 390nM-520nM was read using a microplate reader; in the experiment with ε-NAD as the detection probe, the OD value in the range of 300nM-410nM was read using a microplate reader.

[1016] (3) Determination of SARM1 concentration

[1017] First, the SARM1 Clone cells were lysed, 0, 3, 10, 30 μL of lysate was taken and placed in a 96-well plate, and the enzyme was pre-incubated with NMN, PBS and other solutions at room temperature for 30 minutes; Next, 100 μM PC6 and 100 μM NAD were added to the corresponding system to start the reaction, and the SpectraMax multi-function microplate reader (λex=390nM, λem=520nM) was used to monitor SARM1 activation at 0min, 2min, 4min, 6min, 8min, 10min, 15min, 20min, 25min, 30min and 60min in point reading mode. The enzyme activity reaction was carried out according to the above enzyme activity determination method to study the effect of different hydrolase concentrations on the corresponding enzyme activity determination. Each concentration of enzyme solution was repeated 3 times.

[1018] (4) Determination of PC6 concentration and linear analysis

[1019] First, the cells were lysed, and NMN, PBS and other solutions were added to the reaction plate of 30 μL lysis solution, and the mixture was incubated at room temperature for 30 minutes; then the probe substrate sample with an initial concentration of 100 μM was prepared, and five probe substrate samples with different concentrations of 50 μM, 25 μM, 12.5 μM and 0 μM (i.e. blank control) were prepared in turn. After mixing with NAD, it was added to the mixed system, and the SARM1 activation was monitored at 0 min, 2 min, 4 min, 6 min, 8 min, 10 min, 15 min, 20 min, 25 min, 30 min and 60 min in the point reading mode using the SpectraMax multifunctional microplate reader (λex=390nM, λem=520nM). The probe substrate solution of each concentration was measured three times. At the same time, a standard curve was established based on the probe substrate concentration and luminescence intensity to determine the detection range of the fluorescein substrate.

[1020] (5) Determination of reaction time

[1021] Take 30 μL of SARM1 solution. Perform enzyme activity reaction according to the enzyme activity assay method, read out at 0 min, 2 min, 4 min, 6 min, 8 min, 10 min, 15 min, 20 min, 30 min, and 60 min to monitor SARM1 activation, and use GraphPad Prism for data processing. Repeat the assay 3 times.

[1022] (6) Determination of substrate NAD concentration

[1023] A series of NAD substrate solutions (1000 μM, 333.3 μM, 111.1 μM, 37.04 μM, 12.35 μM, 4.12 μM, 1.37 μM, 0.46 μM, 0.15 μM, 0 μM) were prepared by serial dilution with NAD substrate stock solution (100 mM in water), and 30 μL and 0 μL SARM1 lysate were set up at the same time, and the enzymatic reaction was carried out according to the enzyme activity determination method of 2.3.4.1. The effect of different substrate concentrations on the reaction rate was studied, and each substrate concentration was measured 3 times.

[1024] During the reaction, the PC6 fluorescence spectrum dynamics was detected by an ELISA instrument, where the excitation wavelength and emission wavelength were 390 nm and 520 nm, respectively. The reaction rate was finally used to represent the activity of the protein. The higher the reaction rate, the stronger the protein activity and the lower the inhibition efficiency of the compound.

[1025] 4. Data Analysis

[1026] The enzyme activity test data was processed, analyzed and plotted using GraphPad Prism. After obtaining the initial data, the average fluorescence value of the background wells was calculated, and the sample wells were uniformly processed and imported into GraphPad Prism for calculation to obtain the Sloop value and RSquared of each point. R Squared was used to determine whether the data was reliable, and the IC value of the compound was calculated using the concentration and Sloop. 50 The experimental results are shown in Table 1.

[1027] Table 1: Inhibitory effect on SARM1 enzyme activity

[1028]

[1029]

[1030] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A compound of formula (I), a stereoisomer, a tautomer or a pharmaceutically acceptable salt thereof, in, W is selected from S and O; Ring A is selected from C 3-8 Cycloalkyl and 3-8 membered heterocyclic group; Ring B and Ring C are each independently selected from a 3-10 membered heterocyclic group, a C 6-10 Aryl and 5-10 membered heteroaryl; X1 is selected from -CR5R6-, -NR7-, -O- and a bond; X2 is selected from -CR8R9-, -NR 10 -, -O-, -S-, -SO-, -SO2-, C 3-8 Cycloalkyl and 3-8 membered heterocyclic groups, wherein one or more carbon atoms in the -CR8R9- are optionally further selected from -O-, -S-, -SO-, -SO2-, -NR 10 -、-C(O)-、-C(O)N(R 10 )-、-N(R 10 )C(O)-, -C(O)O-, -OC(O)-, -SO2N(R 10 )- and -N(R 10 )SO2- group replaced; Each R1 is independently selected from hydrogen, deuterium, halogen, cyano, amino, C 1-6 Alkyl, halogenated C 1-6 Alkyl, hydroxy C 1-6 Alkyl, C 1-6 Alkoxy, halogenated C 1-6 Alkoxy and hydroxy C 1-6 Alkoxy; Each R2 is independently selected from hydrogen, deuterium, halogen, hydroxyl, amino, cyano, nitro, =O, =N-OH, C 1-6 Alkyl, C 3-8 Cycloalkyl, C 1-6 Alkoxy, -C(O)NH2 and -C(O)OH, the above groups are optionally further substituted with one or more selected from deuterium, halogen, hydroxyl, cyano, nitro, azido, C 1-6 Alkyl, C 1-6 Alkoxy, C 3-8 Cycloalkyl, 3-8 membered heterocyclic group, C 6-10 substituted by aryl and 5-6 membered heteroaryl groups; R3 is selected from hydrogen, deuterium, cyano, hydroxyl, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-8 Cycloalkyl, 3-8 membered heterocyclic group, C 5-6 Aryl, 5-8 membered heteroaryl, -C(O)R 11 and -S(O)2R 11 ; Each R4 is independently selected from hydrogen, deuterium, halogen, cyano, hydroxyl, nitro, amino, azido, =O, C 1-6 Alkyl, C 1-6 Alkoxy, halogenated C 1-6 Alkyl and halogenated C 1-6 Alkoxy; R5, R6, R7, R8, R9, R 10 are each independently selected from hydrogen, deuterium, halogen, amino, hydroxyl, cyano, nitro, azido, C 1-6 Alkyl, halogenated C 1-6 Alkyl, hydroxy C 1-6 Alkyl, cyano C 1-6 Alkyl, C 1-6 Alkoxy, halogenated C 1-6 Alkoxy and -C(O)R 11 ; or R3 and R5, the atoms directly connected thereto, and the atoms between the atoms connected thereto, together form a 3-10 membered heterocyclic group; or R3 and R7, the atoms directly connected thereto, and the atoms between the atoms connected thereto, together form a 3-10 membered heterocyclic group; or R3 and R8, the atoms directly connected thereto, and the atoms between the atoms connected thereto, together form a 3-10 membered heterocyclic group; or R3 and R 10 The atoms directly connected to it and the atoms between them together form a 3-10 membered heterocyclic group, or R5 and R9 and the atoms directly connected to them together form a C 3-8 Cycloalkyl or 3-10 membered heterocyclic group, or R5 and R 10 The atoms directly connected to it together form a 3-10 membered heterocyclic group, and the above group is optionally further substituted by one or more selected from deuterium, halogen, cyano, nitro, hydroxyl, carbonyl, azido, C 1-6 Alkyl, C 1-6 Alkoxy, halogen substituted C 1-6 Alkyl, halogenated C 1-6 Alkoxy, deuterium substituted C 1-6 Alkyl, hydroxy substituted C 1-6 substituted by an alkyl substituent; Each R 11 independently selected from hydrogen, deuterium and C 1-6 alkyl; is a single bond or a double bond; m and q are each independently selected from 0, 1, 2, 3 or 4; n is selected from 0, 1, 2, 3, 4 or 5.

2. The compound according to claim 1, its stereoisomer, tautomer or pharmaceutically acceptable salt thereof, characterized in that: Ring B is selected from pyridyl and pyridazinyl.

3. The compound according to claim 1, its stereoisomer, tautomer or pharmaceutically acceptable salt thereof, characterized in that: Select from the following structures R 12 Selected from hydrogen, deuterium, C 1-6 Alkyl, halogenated C 1-6 Alkyl, C 1-6 Alkoxy and halogenated C 1-6 Alkoxy; m is each independently selected from 0, 1, 2 or 3; R1, R2 and q are as defined in claim 1.

4. The compound according to any one of claims 1 to 3, its stereoisomer, tautomer or a pharmaceutically acceptable salt thereof, characterized in that: Selected from the following structures: R 12 Selected from hydrogen, deuterium, C 1-4 Alkyl, halogenated C 1-4 Alkyl, C 1-4 Alkoxy and halogenated C 1-4 Alkoxy; m is each independently selected from 0, 1, 2 or 3; R2 is as defined in claim 1.

5. The compound according to any one of claims 1 to 4, its stereoisomer, tautomer or a pharmaceutically acceptable salt thereof, characterized in that: Selected from the following structures:

6. The compound according to claim 1, its stereoisomer, tautomer or pharmaceutically acceptable salt thereof, characterized in that: Selected from the following compounds: R 12 Selected from hydrogen, deuterium, C 1-6 Alkyl, halogenated C 1-6 Alkyl, C 1-6 Alkoxy and halogenated C 1-6 Alkoxy; Ring C, R1, R2, R3, R4, X1, X2, W, q, m and n are as defined in claim 1.

7. The compound according to claim 1, its stereoisomer, tautomer or pharmaceutically acceptable salt thereof, characterized in that: Selected from the following compounds: R 12 Selected from hydrogen, deuterium, C 1-4 Alkyl, halogenated C 1-4 Alkyl, C 1-4 Alkoxy and halogenated C 1-4 Alkoxy; Ring C, R2, R3, R4, X1, X2, W, m and n are as defined in claim 1.

8. A compound according to any one of claims 1 to 3 and claims 5 to 6, a stereoisomer, a tautomer or a pharmaceutically acceptable salt thereof, characterized in that: Each R1 is independently selected from hydrogen, deuterium, halogen, cyano, amino, C 1-4 Alkyl, halogenated C 1-4 Alkyl, hydroxy C 1-4 Alkyl, C 1-4 Alkoxy, halogenated C 1-4 Alkoxy and hydroxy C 1-4 Alkoxy; Preferably, each R1 is independently selected from hydrogen, deuterium, amino, fluorine, chlorine, bromine, methyl, ethyl, propyl, isopropyl, trifluoromethyl, difluoromethyl, fluoromethyl, trifluoroethyl, difluoroethyl, fluoroethyl, methoxy, ethoxy, isopropoxy, trifluoromethoxy, difluoromethoxy, fluoromethoxy, trifluoroethoxy, difluoroethoxy and fluoroethoxy.

9. The compound according to any one of claims 1 to 4 and claims 6 to 7, its stereoisomers, tautomers or pharmaceutically acceptable salts thereof, characterized in that: Each R2 is independently selected from hydrogen, deuterium, halogen, hydroxyl, amino, cyano, C 1-4 Alkyl, =O, =N-OH, C 3-6 Cycloalkyl, C 1-4 Alkoxy, -C(O)NH2 and -C(O)OH, the above groups are optionally further substituted with one or more selected from deuterium, halogen, hydroxyl, cyano, nitro, azido, C 1-4 Alkyl, C 1-4 Alkoxy, C 3-6 Cycloalkyl, 3-6 membered heterocyclic group and C 6-8 substituted with an aromatic group; Preferably, each R2 is independently selected from hydrogen, deuterium, halogen, hydroxyl, amino, cyano, C 1-6 Alkyl, =O, =N-OH, C 3-6 Cycloalkyl, C 1-6 Alkoxy, -C(O)NH2, -NHR' and -C(O)OH, wherein R' is independently deuterium, halogen, hydroxyl, cyano, nitro, C 1-6 Alkyl, C 1-6 Alkoxy, C 3-6 Cycloalkyl, 3-6 membered heterocyclic group and C 6-8 Aryl; Preferably, each R2 is independently selected from hydrogen, deuterium, fluorine, chlorine, bromine, cyano, nitro, hydroxyl, amino, fluorine, chlorine, bromine, =O, =N-OH, methyl, ethyl, propyl, isopropyl, trifluoromethyl, difluoromethyl, fluoromethyl, trifluoroethyl, difluoroethyl, fluoroethyl, methoxy, ethoxy, isopropoxy, trifluoromethoxy, difluoromethoxy, fluoromethoxy, trifluoroethoxy, difluoroethoxy, fluoroethoxy, methylamino, -C(O)NH2 and -C(O)OH, or selected from 10. The compound according to any one of claims 1 to 9, its stereoisomer, tautomer or a pharmaceutically acceptable salt thereof, characterized in that: X1 is selected from -CR5R6-, -NR7-, -O- and a bond; X2 is selected from -CR8R9-, -NR 10 -, -O-, -S-, -SO-, -SO2-, C 3-6 Cycloalkyl and 3-6 membered heterocyclic group; R3 is selected from hydrogen, deuterium, cyano, C 1-4 Alkyl, 3-6 membered heterocyclic group, C 5-6 Aryl, 5-6 membered heteroaryl, -C(O)R 11 and -S(O)2R 11 ; R5, R6, R7, R8, R9, R 10 are each independently selected from hydrogen, deuterium, halogen, amino, hydroxyl, cyano, C 1-4 Alkyl, halogenated C 1-4 Alkyl, hydroxy C 1-4 Alkyl, cyano C 1-4 Alkyl, C 1-4 Alkoxy, halogenated C 1-4 Alkoxy and -C(O)R 11 , or R3 and R5, the atoms directly connected thereto, and the atoms between the atoms connected thereto, together form a 3-8 membered heterocyclic group, or R3 and R7, the atoms directly connected thereto, and the atoms between the atoms connected thereto, together form a 3-8 membered heterocyclic group, or R3 and R8, the atoms directly connected thereto, and the atoms between the atoms connected thereto, together form a 3-8 membered heterocyclic group; Each R 11 are independently selected from hydrogen and C 1-6 alkyl.

11. The compound according to any one of claims 1 to 10, its stereoisomer, tautomer or a pharmaceutically acceptable salt thereof, characterized in that: X1 is selected from -CR5R6, -NR7- and a bond; X2 is selected from -CR8R9-, -NR 10 -、-O-、-S-、-SO2-、C 3-6 Cycloalkyl and 3-6 membered heterocyclic group; R3 is selected from hydrogen, methyl, ethyl, n-propyl, isopropyl and -C(O)R 11 ; R5, R6, R7, R8, R9, R 10 are each independently selected from hydrogen, fluorine, chlorine, bromine, amino, methyl, ethyl, hydroxymethyl, hydroxyethyl and -C(O)R 11 , or R3 and R5, the atoms directly connected thereto, and the atoms between the atoms connected thereto, together form a 3-6 membered heterocyclic group, or R3 and R7, the atoms directly connected thereto, and the atoms between the atoms connected thereto, together form a 3-6 membered heterocyclic group, or R3 and R8, the atoms directly connected thereto, and the atoms between the atoms connected thereto, together form a 3-6 membered heterocyclic group; R 11 Selected from methyl and ethyl.

12. The compound according to any one of claims 1 to 11, its stereoisomer, tautomer or a pharmaceutically acceptable salt thereof, characterized in that: Structural unit Selected from the following groups:

13. The compound according to any one of claims 1 to 12, its stereoisomer, tautomer or a pharmaceutically acceptable salt thereof, characterized in that: Ring C is selected from 3-10 membered heterocyclic group, C 6-8 Aryl and 5-10 membered heteroaryl; Each R4 is independently selected from hydrogen, deuterium, hydroxyl, halogen, cyano, nitro, amino, C 1-4 Alkyl, C 1-4 Alkoxy, halogenated C 1-4 Alkyl and halogenated C 1-4 Alkoxy.

14. The compound according to any one of claims 1 to 13, its stereoisomer, tautomer or a pharmaceutically acceptable salt thereof, characterized in that: Ring C is selected from phenyl, pyridyl, thienyl and Each R4 is independently selected from hydrogen, deuterium, hydroxyl, amino, fluorine, chlorine, bromine, cyano, methyl, ethyl, propyl, isopropyl, trifluoromethyl, difluoromethyl, fluoromethyl, trifluoroethyl, difluoroethyl, fluoroethyl, methoxy, ethoxy, isopropoxy, trifluoromethoxy, difluoromethoxy, fluoromethoxy, trifluoroethoxy, difluoroethoxy and fluoroethoxy.

15. The compound according to claim 1, its stereoisomer, tautomer or pharmaceutically acceptable salt thereof, characterized in that: Selected from the following compounds:

16. The compound according to claim 1, its stereoisomer, tautomer or pharmaceutically acceptable salt thereof, characterized in that: Selected from the following compounds:

17. A pharmaceutical composition comprising the compound according to any one of claims 1 to 16, its stereoisomer, tautomer or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.

18. Use of the compound according to any one of claims 1 to 16, its stereoisomer, tautomer or pharmaceutically acceptable salt thereof, or the pharmaceutical composition according to claim 17 in the preparation of a medicament for treating and / or preventing diseases mediated or associated with the SARM1 enzyme.

19. Use of the compound according to any one of claims 1 to 16, its stereoisomer, tautomer or pharmaceutically acceptable salt thereof or the pharmaceutical composition according to claim 17 in the preparation of a medicament for preventing and / or treating a neurological disease or disorder.

20. Use of the compound according to any one of claims 1 to 16, its stereoisomer, tautomer or pharmaceutically acceptable salt thereof, or the pharmaceutical composition according to claim 17 in the preparation of a drug for preventing and / or treating Alzheimer's disease, Parkinson's disease, multiple sclerosis, amyotrophic sclerosis, or peripheral neuropathy.

Images