Chicken infectious anemia virus, chicken infectious anemia virus egg yolk antibody and preparation method and application thereof

Abstract

The invention relates to the technical field of bioengineering, and particularly discloses a chicken infectious anemia virus, a chicken infectious anemia virus egg yolk antibody and a preparation method and application thereof. The invention relates to a chicken infectious anemia virus, which is preserved in the China General Microbiological Culture Collection Center (CGMCC), and is named as the chicken infectious anemia virus RD240101A, the preservation date is September 23, 2024, and the preservation number is CGMCC NO.46198. The chicken infectious anemia virus has the advantages that the chicken infectious anemia virus is named as the chicken infectious anemia virus RD240101A; the chicken infectious anemia virus egg yolk antibody is prepared by taking an inactivated vaccine prepared from the chicken infectious anemia virus RD240101A as an immunogen, is high in specificity and good in safety, does not have any local or whole-body adverse reaction caused by injection of the antibody after being inoculated to chicks, can provide effective immune protection for chicken flocks, and can be used for preparing the chicken infectious anemia virus egg yolk antibody. And the method has a good commercial development prospect.

Description

Technical Field

[0001] The present application relates to the field of bioengineering technology, and more specifically, to a chicken infectious anemia virus, a chicken infectious anemia virus yolk antibody, and a preparation method and application thereof. Background Art

[0002] Chicken infectious anemia is a viral infectious disease caused by Chicken infectious anemia virus (CIAV), characterized by aplastic anemia and systemic lymphoid organ atrophy, resulting in immunosuppression. The main clinical manifestations of chickens infected with CIAV are depression, pale comb and other anemia symptoms, reduced hematocrit, and autopsy shows thymus atrophy and yellow or pink bone marrow. CIAV can be transmitted horizontally and vertically in chickens, causing serious economic losses to the poultry industry. There is currently no effective drug for the treatment of CIAV. Clinically, it is recommended to use live vaccine immunization as the main prevention and control measure, combined with comprehensive prevention and control measures such as good biosafety.

[0003] At present, live attenuated vaccines are used in areas where chicken infectious anemia is prevalent, but it may lead to the development of new strains. Inactivated vaccines are more popular than live attenuated vaccines because live attenuated vaccines may restore their virulence after recombination with viral strains, and continued use of live attenuated vaccines is likely to form new strains. Inactivated vaccines are safer in this regard, but they also have disadvantages such as low immune response. Therefore, it is necessary to effectively prevent and control the current occurrence of chicken infectious anemia by isolating strong CIAV strains from diseased chickens, analyzing the biological characteristics of these CIAV strains, screening the currently popular CIAV strains with excellent biological characteristics, cultivating CIAV vaccine candidate strains, and developing CIAV vaccines and egg yolk antibodies. Summary of the invention

[0004] In order to provide more accurate raw materials for the virus strains used in vaccine protection tests and to provide antibodies with better therapeutic effects on infectious anemia viruses, the present application provides a chicken infectious anemia virus, a chicken infectious anemia virus yolk antibody, and a preparation method and application thereof.

[0005] In a first aspect, the present application provides a chicken infectious anemia virus, using the following technical solution: A chicken infectious anemia virus, the chicken infectious anemia virus is named as chicken infectious anemia virus RD240101A (Chicken infectious anemia virus), is deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, the address is Beijing, China, the preservation date is September 23, 2024, and the preservation number is CGMCCNO.46198.

[0006] By adopting the above technical solution, raw materials are provided for the virus strains used in vaccine protection tests for poultry farming, which is of great significance in the prevention and control of chicken epidemics.

[0007] In a second aspect, the present application provides a chicken infectious anemia virus yolk antibody, which adopts the following technical solution: a chicken infectious anemia virus yolk antibody, which is prepared using an inactivated vaccine prepared with chicken infectious anemia virus RD240101A as an immunogen.

[0008] By adopting the above technical scheme, egg yolk antibodies can be used for the treatment and prevention of specific diseases of livestock and poultry, especially for the specific treatment of viral diseases. It is a convenient, efficient, non-antibiotic biological poultry medicine with no toxic side effects, which has been widely recognized and used in clinical practice, and can also avoid the virus contamination that may be caused by vaccines. Infectious anemia virus is used to prepare egg yolk antibodies, and the obtained egg yolk antibodies have good immune effects, can prevent large-scale outbreaks of infectious anemia in chickens, and produce effective protective effects.

[0009] In a third aspect, the present application provides a method for preparing chicken infectious anemia virus yolk antibodies, using the following technical solution: A method for preparing chicken infectious anemia virus yolk antibody comprises the following steps: (1) Preparing antigens from chicken infectious anemia virus RD240101A; (2) inactivating the antigen with a formaldehyde solution to obtain an inactivated antigen; (3) preparing the immune antigen: mixing the inactivated antigen and sterilized Tween 80, stirring evenly to obtain an aqueous phase, and emulsifying the aqueous phase with the oil phase to prepare the immune antigen; (4) Preparation of chicken infectious anemia virus yolk antibody: The immune antigen is inoculated into laying hens, and highly immune eggs are collected. The highly immune eggs are sterilized, the yolks are separated, acidified and extracted, caprylic acid is used for fat removal, filtration is performed, and concentration is performed to obtain yolk antibodies.

[0010] By adopting the above technical solution, the infectious anemia virus is immunized in laying hens, which has low cost, good safety and strong stability.

[0011] Optionally, the method for preparing an antigen of Chicken Infectious Anemia Virus RD240101A in step (1) is as follows: inoculate 6-day-old SPF chicken embryos with Chicken Infectious Anemia Virus RD240101A via yolk sac, harvest the allantoic fluid, liver tissues of dead chicken embryos of 1-14 days and surviving chicken embryos of 14 days, crush and grind the liver tissues of dead chicken embryos and surviving chicken embryos, and then mix them with the allantoic fluid in a ratio of 1:1, centrifuge, pass the sterility test, obtain the antigen, and store it in cryopreservation.

[0012] By adopting the above technical scheme, chicken embryos are used to produce allantoic fluid, and antigens are prepared with the liver tissues of dead and surviving chicken embryos. This makes the antigens highly specific, can accurately identify the target virus, reduce the possibility of cross-reaction, and improve the accuracy and reliability of diagnosis. Moreover, this method is relatively simple and practical.

[0013] Optionally, the method for preparing the inactivated antigen in step (2) is specifically as follows: adding a 10% formaldehyde solution to the antigen to make the final concentration of the formaldehyde solution 0.1%, sealing after mixing, stirring and inactivating at 37°C for 24h to obtain the inactivated antigen, and storing at 2-8°C.

[0014] By adopting the above technical solution, formaldehyde can completely inactivate the antigen and ensure the safety of the vaccine.

[0015] Optionally, the method for preparing the immune antigen in step (3) is: Prepare the oil phase: mix white oil and Span 80, add aluminum stearate, and stir while heating until transparent and sterilized to prepare the oil phase; prepare the water phase: mix the inactivated antigen and sterilized Tween 80, stir evenly to prepare the water phase; Emulsification: Mix the oil phase and the water phase in a volume ratio of 3:1, stir and emulsify to prepare the immune antigen.

[0016] By adopting the above technical scheme, the inactivated antigen can be better dispersed in the oil phase and the water phase through emulsification to form a stable immune antigen, which can non-specifically enhance the animal body's characteristic immune response to the antigen, thereby permanently improving the antibody titer and enhancing the immune effect of the vaccine.

[0017] Optionally, the preparation method of chicken infectious anemia virus yolk antibody in step (4) is as follows: 4.1 Immunization antigen vaccination: The immune antigen is injected intramuscularly into laying hens for four immunizations, and eggs are collected 15 days after the four immunizations. Eggs are sampled for testing of chicken infectious anemia virus antibody titer in the yolk ≥ 1:20000, which is a qualified high-immunity egg; 4.2 Preparation of yolk antibody: disinfect the highly immune eggs, separate the egg white and yolk, mix the egg yolk and 0.02 mol / L disodium hydrogen phosphate solution in a mass ratio of 1:3, add a sedimentation agent in a mass ratio of 1:1 to the egg yolk, adjust the pH value to 6 with citric acid solution, settle for 12 hours, and settle to a supernatant titer of not less than 1:13000; add caprylic acid to the supernatant to a final caprylic acid concentration of 0.1%, stir, and place at room temperature for 2-6 hours, filter, and concentrate until the titer of chicken infectious anemia virus ELASA is not less than 1:13000.

[0018] By adopting the above technical scheme, the yolk of highly immune eggs is used to prepare yolk antibodies, which has high efficiency, low cost, high stability, and no residues or toxic side effects.

[0019] Optionally, the sedimentation agent comprises PVP and trehalose in a mass ratio of 6.66:4.16.

[0020] By adopting the above technical solution, PVP and trehalose can work synergistically to jointly enhance the stability and sedimentation effect of egg yolk. PVP provides physical stability through thickening and adhesion, while trehalose enhances the quality of egg yolk through moisturizing and biochemical stability.

[0021] Optionally, in the step 4.1, the four immunization procedures are as follows: first immunization: intramuscular injection of immunizing antigen into 140-day-old laying hens, 0.5 ml / hen; second immunization: intramuscular injection of immunizing antigen 15 days after the first immunization, 1 ml / hen; third immunization: intramuscular injection of immunizing antigen 15 days after the second immunization, 1.5 ml / hen; fourth immunization: intramuscular injection of immunizing antigen 30 days after the third immunization, 2 ml / hen, and start collecting eggs 15 days after the fourth immunization.

[0022] In a fourth aspect, the present application provides a use of chicken infectious anemia virus yolk antibody in the treatment or prevention of chicken infectious anemia disease.

[0023] By adopting the above technical scheme, infectious anemia yolk antibodies provide an effective means for clinical prevention and treatment of chicken infectious anemia.

[0024] In summary, this application has the following beneficial effects: 1. The chicken infectious anemia virus obtained in this application has the advantages of stable virulence, good immunogenicity, and strong virulence.

[0025] 2. The chicken infectious anemia virus yolk antibody in this application has the advantages of safety, high specificity, good therapeutic effect, and low production cost. It can effectively prevent and treat diseases caused by chicken infectious anemia virus, protect the entire growth cycle of chickens, significantly improve breeding income, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 These are the PCR test results for chicken infectious anemia virus RD240101A (lane 1 is the marker, lane 2 is the chicken infectious anemia virus RD240101A, and lane 3 is the CIAV negative control group).

[0027] Figure 2 This is the appearance of chicks in the challenge group infected with the infectious anemia virus RD240101A strain.

[0028] Figure 3 This is the appearance of the normal group of chicks that are not infected with the infectious anemia virus RD240101A strain.

[0029] Figure 4The autopsy pictures of chicks in the challenge group infected with infectious anemia virus RD240101A strain and the uninfected normal group (Figure A shows diffuse hemorrhage in the liver of the challenge group, and Figure B shows that the bursa of Fabricius in the challenge group was atrophied compared with the control group.

[0030] Figure 5 Image of wing bleeding in chicks in the challenge group infected with infectious anemia virus RD240101A strain. DETAILED DESCRIPTION

[0031] The following examples further illustrate the present application in detail. Example

[0032] Example 1: Isolation and identification of a chicken infectious anemia virus: 1. Virus isolation: 50-100 g of diseased tissue (liver, spleen, kidney, pancreas) of chickens suspected of infectious anemia in Pingdu City, Qingdao, Shandong Province were aseptically collected, sterile PBS was added at a ratio of 1:2 (W / V), homogenized in a mortar, centrifuged at 8000 rpm for 10 min, frozen at -20°C, thawed at 25°C, repeated 3 times, centrifuged at 10000 rpm for 10 min, the supernatant was taken for strain separation, filtered with a 0.22 μm sterile filter to obtain the virus filtrate, and stored at -20°C for use; the virus filtrate was inoculated on 20 6 Day-old SPF chicken embryo yolk sac, 0.2 mL per embryo, incubate at 37°C for 168 h, illuminate the embryos twice a day, discard dead embryos before 24 h, take out the chicken embryos that died 24-120 h in time and cool them to 2-8°C. If there is no death at 168 h, place the living chicken embryos at 2-8°C for 20 h, harvest the chicken embryo fluid and embryo body one by one, grind them into a homogenate with a grinder, centrifuge at 8000 rpm for 10 min, obtain the supernatant, continue to freeze and thaw 3 times, then centrifuge, collect the supernatant, mix and package after passing the sterility test, and freeze at -80°C. After blind transmission for 3 generations using the above method, the harvested virus liquid is stored in a -80°C refrigerator.

[0033] (2) Virus identification: PCR amplification: Take 30 μL of virus solution to extract DNA and perform PCR detection. The primer sequences are: CIAV-F: GACTGTAAGATGGCAAGACGAGCT; CIAV-R:GGCTGAAGGATCCCTCATTC; The fragment length of this identification primer is 676bp; 20μl amplification system was used for extension, the specific reagents are shown in Table 1, and the amplification program is: 94℃ pre-denaturation for 3min, 94℃ denaturation for 30s, 56℃ annealing for 40s, 72℃ extension for 40s, 30 cycles; 72℃ extension for 10min, 4℃ storage, 1% agarose gel electrophoresis to detect PCR products, the PCR results obtained are as follows Figure 1 As shown, Figure 1 Lane 1 is the marker, lane 2 is the chicken infectious anemia virus RD240101A, and lane 3 is the CIAV negative control group. As can be seen from the figure, the target fragment was successfully amplified, and the size of the amplified band was consistent with the expectation, proving that the isolated virus is indeed chicken infectious anemia virus RD240101A.

[0034] Table 1 PCR amplification system Components Total system (20μl) template 4 2×Tap PCR Star Mix 10 Upstream primer 2 Downstream primer 2 <![CDATA[ddH 2 The]]> 2 2. Virus virulence test: after the chicken infectious anemia virus RD240101A of above-mentioned screening was diluted 1:100 with PBS (0.01mol / L, pH=7.2), 50 SPF chicken embryos of 6 age in days were inoculated through yolk sac, every 0.2ml was placed at 37 ℃ for incubation for 14d, and the chicken embryo morbidity was recorded in Table 2.

[0035] 3. Table 2 Statistics of chicken embryo disease Time / h 12 24 36 48 60 72 84 96 Virus RD240101A 0 0 0 0 0 5 2 5 Time / h 108 120 132 144 156 168 Total number of cases Overall incidence Virus RD240101A 10 20 5 0 0 0 47 94％ (4) Half of the infection dose of chicken embryos ELD 50 Determination The isolated chicken infectious anemia virus RD240101A was diluted 10 times with PBS (0.01mol / L, Ph=7.2), with a total of 8 dilutions. Ten 6-day-old SPF chicken embryos (200 μL / embryo) were inoculated into the yolk sac at each dilution, and another 10 embryos were set as a blank control group and incubated at 37°C. After inoculation of the virus, the chicken embryos were observed every day, and the chicken embryos that died within 24 hours were discarded. After that, the chicken embryos were observed every 12 hours for 168 hours. The cumulative number of chicken embryos with lesions and those without lesions at each dilution was counted, and the ELD of chicken infectious anemia virus RD240101A in each 0.2 mL virus solution was calculated according to the Reed-Muench method. 50 The statistical results are shown in Table 3.

[0036] Table 3 Mortality of inoculated chicken embryos and ELD of infectious anemia isolates 50 It can be seen that the ELD of the chicken infectious anemia virus RD240101A strain 50 Value is 10 -4.8 / 0.2mL, with strong virulence and high mortality rate of infection.

[0037] Example 2: A method for preparing chicken infectious anemia virus yolk antibody, comprising the following steps: (1) Preparation of antigens from chicken infectious anemia virus RD240101A: The chicken infectious anemia virus RD240101A obtained in Example 1 was inoculated into 6-day-old SPF chicken embryos via the yolk sac at a dose of 0.2 ml / piece, and the allantoic fluid, liver tissue of 1-14d dead chicken embryos and 14d surviving chicken embryos were harvested. The liver tissue of the dead chicken embryos and the surviving chicken embryos were ground with a wall breaking machine, mixed with the allantoic fluid at a mass ratio of 1:1, and then centrifuged at a speed of 8000r / min for 10min. The supernatant that passed the sterility test was quantitatively packaged as the antigen and stored at -80°C.

[0038] (2) Inactivating the antigen to prepare the inactivated antigen: The antigen was tested. If the pathogenicity of SPF chicken embryo was ≥90% and the bands of PCR electrophoresis were correct and clear, it was a qualified antigen. 10% formaldehyde solution was added to the qualified antigen, and shaking was performed while adding to mix it thoroughly. The final concentration of the formaldehyde solution was 0.1%. Then, it was poured into another sterile stainless steel barrel, and inactivated by stirring at 37°C for 24 hours (the timing started from when the temperature of the antigen rose to 37°C, and stirring was performed 3-4 times during the period) to obtain the inactivated antigen. Samples were taken separately for inactivation test, and the inactivated antigen was stored at 2-8°C for standby use.

[0039] Antigen inactivation test: ① Sterility test: Take the inactivated antigen solution and test it according to the appendix of the current "Chinese Veterinary Pharmacopoeia".

[0040] ② Inactivation test: Inoculate 6 6-day-old SPF chicken embryos with the inactivated antigen liquid through the yolk sac, 0.2 mL per embryo, and observe for 14 days. All the SPF chicken embryos should be alive. Blindly propagate one generation according to this method, and all the chicken embryos should still be alive.

[0041] ③Results: The antigen was sterile after inactivation and was completely inactivated. Six 6-day-old SPF chicken embryos were inoculated and blindly propagated for one generation, and all the embryos were healthy.

[0042] (3) Preparation of immune antigens: 3.1. Preparation of oil phase: Mix 94 g of white oil for injection with 6 g of Span 80, add 2 g of aluminum stearate, heat and stir until transparent, and then sterilize by high pressure to obtain the oil phase; 3.2. Prepare the aqueous phase: Mix 96 g of inactivated antigen with 4 g of sterilized Tween 80 and shake well to dissolve the Tween 80 completely to prepare the aqueous phase; 3.3 Emulsification: Take 3 portions of oil phase, place them in a high-speed shear instrument, stir at a speed of 15000r / min, and quickly add the water phase at the same time, stir for 6 minutes to fully emulsify. After emulsification, aseptically divide them into 250ml sterile bottles, and indicate the name, preparation time and filling amount on the outside of the bottle, and store at 2-8℃.

[0043] Immune antigen test: 1. Shape: Appearance: Milky white uniform emulsion.

[0044] Dosage form: Oil-in-water type. Take a clean pipette and draw a small amount of immune antigen and drop it into cold water. Except for the first drop, it will not spread.

[0045] Stability: Pipette 10 ml of immune antigen into a centrifuge tube and centrifuge at 3000 r / min for 15 min. The water phase precipitated at the bottom of the tube should be 0.1 ml and should not exceed 0.5 ml.

[0046] Viscosity: Tested in accordance with the appendix of the current "Chinese Veterinary Pharmacopoeia", it is 100cP and does not exceed 200cP.

[0047] 2. Sterility test: Test according to the appendix of the current Chinese Pharmacopoeia of Veterinary Medicine, and the product must be sterile after the test.

[0048] ③Safety test: 10 14-day-old SPF chickens were injected with 2 ml of immune antigen into the leg muscles and observed for 14 days. No local or systemic adverse reactions caused by the injection of immune antigen were found.

[0049] (4) Preparation of yolk antibodies: 4.1 Immunization with immune antigens: The prepared immune antigens were immunized four times to obtain highly immune eggs, specifically: First immunization: 140-day-old commercial laying hens were intramuscularly injected with immune antigens, 0.5 ml / hen; Second immunization: 15 days after the first immunization, 1 ml / hen was intramuscularly injected with immune antigens; Third immunization: 15 days after the second immunization, 1.5 ml / hen was intramuscularly injected with immune antigens; Fourth immunization: 30 days after the third immunization, 2 ml / hen was intramuscularly injected with immune antigens. Eggs were collected for sampling and testing 15 days after the fourth immunization. When the ELASA titer of the eggs was not less than 1:20000, they were highly immune eggs and were stored at 4°C for future use; 4.2 Preparation of yolk antibody: ① Cleaning and disinfection: Soak the high-immunity eggs in 0.1% 42℃ syngerm solution for 15 minutes, remove them and drain the water, rinse with running water to remove surface dirt, fumigate the eggs with 0.1% glutaraldehyde spray for 30 minutes, and blow dry; ② Separation of egg white and egg yolk: Use a single-egg beating machine to separate egg white and egg yolk, mix the egg yolk and 0.02 mol / L sodium hydrogen phosphate solution in a mass ratio of 1:3 and stir evenly, transfer to a sedimentation tank, and stir at 1000 rpm for 60 minutes; ③ Acid extraction: PVP, trehalose and water are mixed and dissolved to prepare a sedimentation agent, the PVP concentration is 6.66g / L, the trehalose concentration is 4.16g / L, and the sedimentation agent is added to the sedimentation tank. The mass ratio of the sedimentation agent to the egg yolk is 1:1. At this time, the solution is milky yellow, uniform and turbid; 30% citric acid solution is used to adjust the pH of the solution to 6, and sediment at 4℃ for 12h. After the sedimentation is completed and the ELASA titer of the supernatant is not less than 1:13000, the supernatant is transferred out; ④ Caprylic acid degreasing: add caprylic acid with a final concentration of 0.1% as an inactivator and extractant to the extracted supernatant, stir, and place at room temperature for 2-6 hours; ⑤ Sterile filtration: Sterilize with a 0.22μm microporous filter; ⑥Ultrafiltration to remove viruses: Use ultrafiltration membrane with a molecular weight cutoff of 1000kDa to remove viruses; ⑦Ultrafiltration concentration: Use ultrafiltration membrane with a molecular weight cutoff of 100kDa to concentrate the egg yolk antibody twice; ⑧ Antibody titer determination: The titer of infectious anemia antibody ELASA should not be less than 1:13000; ⑨ Packaging: Pack in quantitative quantities, seal with a lid, and store at 2-8℃.

[0050] Performance test The chicken infectious anemia virus RD240101A obtained in Example 1 was used for animal regression test. 100 one-day-old SPF chickens were selected and divided into 2 groups. One group was injected with 0.5 mL of sterile PBS in the leg muscle as the normal group; the other group was injected with 0.5 mL / chicken of chicken infectious anemia virus RD240101A strain in the leg muscle as the challenge group. The clinical symptoms of the experimental animals were observed for 14 consecutive days. After 14 days, all were euthanized for autopsy and pathological changes were observed.

[0051] Experimental results: The chicken infectious anemia virus RD240101A strain virus solution was injected into the leg muscle of one-day-old SPF chickens. Figure 2 , chicks infected with infectious anemia virus were depressed and had fluffy feathers, while chicks in the normal group without infection, see Figure 3 , fluffy feathers, normal appearance, and 8% less body weight compared to the control group.

[0052] The challenge group and the normal group were dissected. Figure 4 Figures A and B show the clinical symptoms of the challenge group: hemorrhage under the wing, dense hemorrhage spots on the liver, and atrophy of the bursa of Fabricius. Figure 5 , bleeding under the wings of the chicks in the challenge group was visible.

[0053] The chicken infectious anemia virus yolk antibody prepared in Example 2 is used for specific prevention and treatment: 200 one-day-old SPF chickens were selected and randomly divided into 4 groups, with 50 chickens in each group. The challenge and treatment schemes of the 4 groups of one-day-old SPF chickens are shown in Table 4. They were raised in isolation and clinical observation was carried out day by day after the challenge. The number of cases was counted on day 14, and the incidence rate and protection rate were calculated, as shown in Table 5.

[0054] Table 4 Virus challenge treatment plan for 1-day-old SPF chickens Table 5 Morbidity of 1-day-old SPF chickens at 14 days As can be seen from the data in Table 5, the first group used PBS buffer as the negative control group, and the incidence of chickens was 0 after 14 days of the virus attack. The second group of the virus attack non-treatment group had 48 cases of SPF chickens after the 14th day, and the incidence rate reached 96%, indicating that the virulence of chicken infectious anemia virus was strong. The third group of the virus attack treatment group had 3 cases of SPF chickens after the 14th day, and the protection rate was 94%. The protection rate of chickens in the fourth group of the virus attack prevention group was 92%. In addition, clinical observations showed that compared with the negative control group, the virus attack treatment group, and the virus attack prevention group, the chickens in the virus attack non-treatment group had decreased appetite, fluffy feathers, and a 5% decrease in body weight on the 14th day; the autopsy on the 14th day of the experiment showed that the virus attack non-treatment group had obvious lesions, manifested as hemorrhage under the wings, dense hemorrhage spots in the liver, atrophy of the bursa of Fabricius, and yellow bones; while the chicks in the other three groups all performed normally. In the face of the attack of infectious anemia virus, the protection rate of yolk antibodies is high, which can effectively prevent and treat the onset of infectious anemia in chicks.

[0055] The chicken infectious anemia virus yolk antibody prepared in Example 2 was used to conduct a large-group test on infectious anemia: A large chicken breeding area in Qingdao, Shandong Province was selected, and one of the chickens infected with infectious anemia virus was selected as the test object. The chicken house was divided into two isolation areas, and 5000 2-week-old chickens were raised in each area. The chickens infected with infectious anemia virus in the two isolation areas were treated separately. The first isolation area: intramuscular injection of infectious anemia yolk antibody purchased from the market 1ml / chicken, the second isolation area: intramuscular injection of RD204101A virus yolk antibody 1ml / chicken, continuous observation for 14 days, record the recovery of the chicks (judgment of the clinical symptoms of infectious anemia: chickens are listless, feathers are disheveled, chicken feet and combs are pale, and weight loss is ≥5%), and the number of chickens recovered is counted in Table 6.

[0056] Table 6 Recovery of chickens infected with infectious anemia virus It can be seen that after 14 days of treatment with commercially available egg yolk antibodies, the protection rate of the chicken flock was only 82.5%, while the protection rate of the chicken infectious anemia virus egg yolk antibody prepared in Example 2 of the present application reached 91.2% after 14 days. In the face of the attack of infectious anemia virus, the chicken infectious anemia virus egg yolk antibody prepared in the present application has a better protection effect and has a better prevention and control effect.

[0057] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed, but such modifications are protected by the patent law as long as they are within the scope of the claims of the present application.

Claims

1. A chicken infectious anemia virus, deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, named Chicken Infectious Anemia Virus RD240101A, with a preservation date of September 23, 2024, and a preservation number of CGMCCNO.46198.

2. A chicken infectious anemia virus yolk antibody, characterized in that: The inactivated vaccine prepared by using the chicken infectious anemia virus RD240101A described in claim 1 is prepared as an immunogen.

3. A method for preparing chicken infectious anemia virus yolk antibody as claimed in claim 2, characterized in that: The following steps are involved: (1) Preparing antigens from chicken infectious anemia virus RD240101A; (2) inactivating the antigen with a formaldehyde solution to obtain an inactivated antigen; (3) Preparing immune antigens: mixing the inactivated antigen and sterilized Tween 80, stirring evenly to obtain an aqueous phase, and emulsifying the aqueous phase with the oil phase to prepare immune antigens; (4) Preparation of yolk antibodies against chicken infectious anemia virus: The immune antigen is inoculated into laying hens, and highly immune eggs are collected. The highly immune eggs are sterilized, the yolks are separated, acidified and extracted, degreased with caprylic acid, filtered, and concentrated to obtain yolk antibodies.

4. The method for preparing chicken infectious anemia virus yolk antibody according to claim 3, characterized in that: The method for preparing the antigen of chicken infectious anemia virus RD240101A in step (1) is as follows: chicken infectious anemia virus RD240101A is inoculated into 6-day-old SPF chicken embryos via yolk sac, and the allantoic fluid, liver tissues of dead chicken embryos of 1-14 days and surviving chicken embryos of 14 days are harvested, the liver tissues of dead chicken embryos and surviving chicken embryos are crushed and ground, and then mixed with the allantoic fluid in a ratio of 1:1, centrifuged, and the antigen is obtained after passing the sterility test, and then frozen for storage.

5. The method for preparing chicken infectious anemia virus yolk antibody according to claim 3, characterized in that: The method for preparing the inactivated antigen in step (2) is specifically as follows: adding a 10% formaldehyde solution to the antigen to make the final concentration of the formaldehyde solution 0.1%, mixing and sealing, stirring and inactivating at 37°C for 24h to obtain the inactivated antigen, and storing at 2-8°C.

6. The method for preparing chicken infectious anemia virus yolk antibody according to claim 3, characterized in that: The method for preparing the immune antigen in step (3) is: Prepare the oil phase: mix white oil and Span 80, add aluminum stearate, and heat and stir until transparent and sterilized to obtain the oil phase; Prepare the aqueous phase: mix the inactivated antigen and sterilized Tween 80, stir evenly, and prepare the aqueous phase; Emulsification: Mix the oil phase and the water phase in a volume ratio of 3:1, stir and emulsify to prepare the immune antigen.

7. The method for preparing chicken infectious anemia virus yolk antibody according to claim 3, characterized in that: The method for preparing chicken infectious anemia virus yolk antibody in step (4) is as follows:

1. Vaccination with immune antigens: Inject the immune antigens into laying hens intramuscularly for four times, collect eggs 15 days after the four immunizations, sample eggs for testing chicken infectious anemia virus yolk antibodies, and those with a titer of ≥1:20,000 are qualified high-immunity eggs; 2 Preparation of yolk antibody: Disinfect high-immune eggs, separate egg white and yolk, mix the egg yolk and 0.02 mol / L disodium hydrogen phosphate solution in a mass ratio of 1:3, add a sedimentation agent with a mass ratio of 1:1 to the egg yolk, adjust the pH value to 6 with citric acid solution, and settle at 4°C for 12 hours. The titer of the supernatant is not less than 1:13000; add caprylic acid to the supernatant to a final concentration of 0.1%, stir, and place at room temperature for 2-6 hours, filter and concentrate until the titer of chicken infectious anemia virus ELASA is not less than 1:13000.

8. The method for preparing chicken infectious anemia virus yolk antibody according to claim 7, characterized in that: The sedimentation agent includes PVP and trehalose in a mass ratio of 6.66:4.

16.

9. The method for preparing chicken infectious anemia virus yolk antibody according to claim 7, characterized in that: In the step 4.1, the four immunization procedures are as follows: first immunization: intramuscular injection of immunizing antigen into 140-day-old laying hens, 0.5 ml / hen; second immunization: intramuscular injection of immunizing antigen 15 days after the first immunization, 1 ml / hen; third immunization: intramuscular injection of immunizing antigen 15 days after the second immunization, 1.5 ml / hen; fourth immunization: intramuscular injection of immunizing antigen 30 days after the third immunization, 2 ml / hen, and eggs are collected starting 15 days after the fourth immunization.

10. Use of the chicken infectious anemia virus yolk antibody according to claim 2 in treating or preventing chicken infectious anemia.

Images