BCG1059c gene knock-down recombinant bacillus calmette guerin vaccine as well as construction method and application thereof

Abstract

The invention discloses a BCG1059c gene knock-down recombinant bacillus calmette guerin vaccine strain, and the BCG1059c gene of the strain is knocked down. A CRISPRi / dCas9th1 technology is utilized to block RNA polymerase movement in space through a compound formed by crRNA, dCas9 protein and sgRNA at a transcriptional level, so that the expression of the BCG1059c gene in the BCG vaccine is inhibited. The strain has the characteristics of low-abundance polar fat and high-abundance fat arabinomannan compared with wild BCG (Bacillus Calmette Guerin); in an in-vitro experiment, compared with a wild type BCG, the macrophage treated by the BCGkd can secrete IL-2 and TNF-alpha at a higher level, and shows a stronger bactericidal ability on escherichia coli; in an in-vivo experiment, after intravenous injection of a mouse, the survival time of the gene knock-down strain BCGkd in the lung can reach more than 16 weeks, and a more lasting anti-tuberculosis capability can be provided.

Description

Technical Field

[0001] The invention relates to the field of genetic engineering and recombinant BCG vaccine, a BCG_1059c gene knockout recombinant BCG vaccine, and a construction method and application thereof. Background Art

[0002] The information disclosed in this background technology section is only intended to increase some understanding of the overall background of the invention, and should not be necessarily regarded as an admission or any form of suggestion that the information constitutes the prior art already known to ordinary technicians in this field.

[0003] Tuberculosis (TB) is an infectious disease caused by Mycobacterium tuberculosis (M.tb). Bacille Calmette–Guerin (BCG) is the only licensed vaccine for the prevention of TB and has been used for 100 years. BCG vaccination of newborns can reduce the incidence of severe tuberculosis (such as tuberculous meningitis and disseminated tuberculosis) and pulmonary tuberculosis in children to a certain extent, but the efficacy is unstable and cannot effectively prevent the onset of adult pulmonary tuberculosis, let alone provide long-term immunity. Every year, about 352 million newborns in about 180 countries and regions around the world are vaccinated with BCG at birth. It can be said that BCG is the most widely vaccinated vaccine in human history, and there is a feasible basis for its optimization.

[0004] There are currently three strategies to optimize BCG: recombinant BCG (rBCG) live vaccine, changing the BCG immune pathway, and combining adjuvants, proteins, carriers, etc. with BCG to enhance immunity. The recombinant BCG live vaccine strategy has been widely studied. There are three main ways to develop recombinant BCG live vaccines: ① Increase the antigenic diversity of existing BCG strains, including the introduction of MTB-specific antigens that are lacking in BCG, such as ESAT6 and CFP10 in the RD1 region, or highly expressed BCG autoantigens with strong immunogenicity, such as Ag85, lipoprotein family PstS3, Mpt83, RpfB, etc. Typical representatives include the MVA85A vaccine, which is also the first among many recombinant BCG vaccines to enter IIb clinical trials, but has not shown protection superior to BCG; ② Improve the antigen presentation ability of BCG, such as BCG△ureC::hly, namely VPMl002, which highly expresses listeriolysin protein, and has entered clinical phase III trials; ③ Knock out or knock down BCG's immunosuppressive genes to activate host immune responses. For example, knocking out autophagy inhibitory genes or regulatory factors of inflammatory signaling pathways related to pathogen-host interactions.

[0005] The protein encoded by BCG_1059c is called protein mannosyltransferase (PMT). Bioinformatics shows that it is an 11-transmembrane protein that catalyzes the initiation of mannosylation to connect to Thr or Ser amino acid residues in protein polypeptide chains. In M.tb, PMT is encoded by Rv1002c and is a growth essential and virulence key gene. In addition, PMT also regulates the important immune inflammatory macromolecule lipoarabinomannan (LAM). BCG_1059c and Rv1002c have high homology in nucleotide sequence (only C and G at position 342 are different). Summary of the invention

[0006] In view of the prior art, the inventors speculate that BCG_1059c is a potential target for regulating BCG inflammatory response in addition to regulating the mannosylation modification of BCG protein. The present invention found that the recombinant BCG strain obtained by knocking out the BCG_1059c gene in wild-type BCG (hereinafter referred to as BCG kd The present invention uses the CRISPRi technology to construct a recombinant BCG with suppressed expression of BCG_1059c. The recombinant BCG has the characteristics of secreting low-abundance polar lipids and producing high-abundance LAM complexes. In the in vitro experiment, heat-inactivated BCG kd After the treatment, the expression levels of IL-2 and TNF-α in human macrophage THP-1 cells were significantly increased compared with the wild BCG treatment group, and they showed stronger bactericidal ability against Escherichia coli. After intravenous injection into mice, it was confirmed that the gene knockout strain could survive in the lungs for more than 16 weeks, providing a more lasting anti-tuberculosis ability.

[0007] The technical solution adopted by the present invention is as follows:

[0008] In a first aspect of the present invention, a recombinant BCG strain is provided, wherein the gene BCG_1059c of the recombinant BCG strain is knocked down or silenced, and the nucleotide sequence of the gene BCG_1059c is shown in SEQ ID No:1.

[0009] In one or some embodiments of the present invention, the recombinant BCG strain has the following characteristics compared with the wild-type BCG strain or the starting strain: (1) enhanced secretion level of lipoarabinomannoside (LAM); (2) reduced secretion level of polar lipids.

[0010] In one or some embodiments of the present invention, the gene BCG_1059c in the recombinant BCG strain is cloned by CRISPR / dCas9sth1 Technology is knocked down.

[0011] During the knockdown process, the BCG_1059c gene sgRNA sequence used was the nucleotide molecule shown in SEQ ID No: 2, i.e., 5'-GAAATGGCGCCATGGTCGCTGC-3'.

[0012] In a second aspect of the present invention, a method for constructing the recombinant BCG strain is provided, wherein CRISPR / dCas9 sth1 The gene BCG_1059c in the wild-type BCG strain was obtained by knocking down the gene BCG_1059c in the wild-type BCG strain.

[0013] In one or some embodiments of the present invention, the specific construction method includes:

[0014] (1) Design a primer comprising SEQ ID No: 2, with 5'-GGGA-3' added to its 5' end as a top oligo, and a primer complementary to SEQ ID No: 2 and with 5'-AAAC-3' added to its 5' end as a bottom oligo,

[0015] Top oligo 5'-GGGAGAAATGGCGCCATGGTCGCTGC-3',

[0016] Bottom oligo: 5'-AAACGCAGCGACATGGCGCCATTTC-3';

[0017] (2) annealing the top oligo and bottom oligo in step (1) to room temperature to form sgRNA oligos for use;

[0018] (3) Use T4 ligase to connect the annealed sgRNA oligos in step (2) to the CRISPRi backbone plasmid (plJR965) after BsmBI-v2 digestion;

[0019] (4) The ligation product in step (3) was transformed into E. coli Novablue, and sgRNA oligo-positive clones were screened based on the kanamycin resistance in the plJR965 plasmid and sequenced for verification;

[0020] (5) The recombinant plasmid verified by sequencing in step (4) was electro-transfected into a BCG competent cell (2500V, 1000Ω, 25μF), and positive colonies were screened using a 7H10 plate containing kanamycin and induced with tetracycline to screen the induction concentration and induction time;

[0021] (6) The expression of BCG_1059c in the positive cloned bacteria was detected, and there was a significant difference compared with the control group, i.e., wild-type BCG, to obtain a recombinant BCG with BCG_1059c gene knocked down, i.e., BCG kd .

[0022] In the third aspect of the present invention, an integration plasmid for BCG_1059c gene knockdown is provided, which is CRISPR / dCas9 sth1 The backbone plasmid PLJR965 of the system is connected to sgRNA, and the sgRNA sequence is the nucleotide molecule shown in SEQ ID No:2.

[0023] In a fourth aspect of the present invention, a composition is provided, comprising the recombinant BCG strain (ie, BCG kd ) and adjuvants.

[0024] In one or some embodiments of the present invention, the product form of the composition is BCG vaccine; the adjuvant is aluminum; and the immunization route adopted is intravenous injection.

[0025] In a fifth aspect of the present invention, there is provided use of the above-mentioned recombinant BCG strain and / or integrated plasmid and / or composition in the preparation of a tuberculosis vaccine.

[0026] In one or some embodiments of the present invention, the tuberculosis is pulmonary tuberculosis.

[0027] In vitro experiments, heat-inactivated BCG kd Compared with the wild BCG-treated group, the expression levels of IL-2 and TNF-α in human macrophage THP-1 cells after treatment were significantly increased, and they showed stronger bactericidal ability against Escherichia coli. kd The survival time in the lungs can reach more than 16 weeks, providing a more lasting anti-tuberculosis capability. This improved recombinant BCG strain can be used for the prevention and control of tuberculosis.

[0028] Compared with the related art known to the inventor, one of the technical solutions of the present invention has the following beneficial effects:

[0029] The recombinant BCG with BCG_1059c gene knockdown provided by the present invention is BCG kd , effectively inhibiting the expression of BCG_1059c gene in BCG by spatially blocking the movement of RNA polymerase through the complex formed by crRNA, dCas9 protein and sgRNA (shown in SEQ ID NO: 2) at the transcriptional level. kd The treated macrophages released higher levels of IL-2 and TNF-α, showing stronger bactericidal ability against Escherichia coli; in vivo experiments, BCGkd It can survive in the lungs of mice for more than 16 weeks, providing the host with more lasting anti-tuberculosis capabilities and has the potential to serve as a candidate vaccine for tuberculosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] The accompanying drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their description are used to explain the present invention and do not constitute improper limitations on the present invention.

[0031] Figure 1 : Schematic diagram of BCG_1059c gene knockdown in Example 1 of the present invention: using CRISPR / dCas9 sth1 The BCG_1059c gene was knocked down systematically.

[0032] Figure 2 : Partial sequencing results of the PLJR965-sgRNA integration plasmid constructed in the present invention for inducing BCG_1059c gene knockdown (the underlined sequence is the complementary sequence of the sgRNA sequence of SEQ ID No: 2).

[0033] Figure 3 : In one embodiment of the present invention, qPCR is used to identify BCG kd Results of BCG_1059c gene knockdown: BCG kd and BCG_1059c gene expression levels in BCG.

[0034] Figure 4 : In one embodiment of the present invention, BCG kd Phosphomolybdic acid (PMA) staining results of polar lipids of strains and wild-type BCG.

[0035] Figure 5 : In one embodiment of the present invention, wild-type BCG and BCG kd Glycogen staining (PAS) results of LAM of strains: color development results (A) and grayscale analysis quantification results (B), *** indicates P < 0.001.

[0036] Figure 6 : In one embodiment of the present invention, BCG and BCG kd The treated macrophages secreted IL-2 ( Figure 6 A), TNF-α ( Figure 6 B) and the phage CFU results at different infection time points of E. coli ( Figure 6 C). In the figure, * indicates P < 0.05, and ** indicates P < 0.001.

[0037] Figure 7 : In one embodiment of the present invention, BCG and BCG kdResults of bacterial persistence in lung tissue at different time points after intravenous injection of mice ( Figure 7 A) and acid-fast staining of lung prints 16 weeks after infection ( Figure 7 B, arrows indicate acid-fast bacilli). DETAILED DESCRIPTION

[0038] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0039] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations and / or combinations thereof.

[0040] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0041] Example 1 Construction of BCG_1059c gene knockout strain, i.e. BCG kd .

[0042] The knockdown schematic is shown in Figure 1 .

[0043] 1.1. Design of primers for sgRNA oligoes

[0044] It contains SEQ ID No: 2, with 5'-GGGA-3' added to the 5' end as a top oligo, and is complementary to SEQ ID No: 2 and with 5'-AAAC-3' added to the 5' end as a bottom oligo.

[0045] top oligo 5'-GGGAGAAATGGCGCCATGGTCGCTGC-3'

[0046] bottom oligo: 5'-AAACGCAGCGACATGGCGCCATTTC-3'

[0047] 1.2 Primer annealing

[0048] The top oligo and bottom oligo in step (1) were annealed at 95°C for 2 min and the temperature was decreased to 25°C at 0.1°C / s.

[0049] 1.3 Enzyme digestion of pLJR965 plasmid and recovery of large fragments

[0050] The CRISPRi backbone plasmid (pLJR965) was digested with BsmBI-v2 enzyme, and the large fragment (8443 bp) was recovered by agarose gel electrophoresis.

[0051] 1.4 Ligation of sgRNA oligoes with large fragments after restriction digestion of plasmid pLJR962

[0052] Use T4 ligase to ligate the large fragment of pLJR965 in step (2) after restriction digestion.

[0053] 1.5 Transformation of ligation products into E. coli and screening of positive clones

[0054] The pLJR965-sgRNA ligation product in 1.4 was transformed into E. coli Nova blue, and pLJR965-sgRNA positive clones were screened based on the kanamycin resistance in the pLJR965 plasmid.

[0055] 1.6 Sequencing verification of pLJR965-sgRNA positive clones

[0056] Pick the positive clones in 1.5 to extract the plasmid and sequence it. The sequencing primer sequence is 5'-TTCCTGTGAAGAGCCATTGATAATG-3'. Figure 2 The sequencing results are shown, and the underline is the sequence of sgRNA (complementary), which proves that pLJR965-sgRNA was successfully constructed.

[0057] 1.7pLJR965-sgRNA electroporation into BCG strain to construct recombinant BCG strain

[0058] The pLJR965-sgRNA plasmid verified by sequencing in 1.6 was electroporated into BCG competent cells and plated on 7H10 plates containing kanamycin. Visible colonies appeared in about 4 weeks.

[0059] 1.8 BCG_1059c gene knockout strain, i.e. BCG kd Induction culture

[0060] The positive clone colonies in 1.7 were inoculated into 7H9 liquid culture medium containing kanamycin, and stably cultured for more than three generations. They were diluted at a ratio of 1:50 and inoculated into 7H9 liquid culture medium. Different tetracycline (ATc) induction groups, i.e., 50 ng / ml, 100 ng / ml, 200 ng / ml and (0 ng / ml) non-induced groups were set up and cultured under the same conditions.

[0061] 1.9 BCG_1059c gene knockout strain, i.e. BCGkd Verification

[0062] After about one week of induction in 1.8, the bacteria were collected, and the bacterial RNA was extracted in advance. Then, the BCG was detected by real-time fluorescence quantitative PCR (RT-qPCR). kd The mRNA expression of BCG_1059c gene in

[0063] 5'GCGTGTACTTCGTGCTGTTC3', the downstream primer is

[0064] 5'AGCGTAGGTGGCCAGATAGA3', the internal reference gene is sigA. Figure 3 As shown, compared with the non-induction group (BCG), BCG kd The degree of knockdown of BCG_1059c gene was positively correlated with ATc concentration, and the higher the ATc concentration, the higher the knockdown degree. Under 50, 100 and 200 ng / ml ATc induction, the BCG_1059c gene was reduced by about 15.3%, 89.7% and 99.97%. Considering that BCG_1059c may be necessary for BCG growth, the present invention selected 100 ng / ml as the BCG kd The optimal induction concentration.

[0065] Example 2 BCG_1059c gene knockout strain (BCG kd ) characterization, mainly including the analysis of polar lipids and lipoarabinomannoside (LAM).

[0066] 2.1 Extraction of BCG kd Polar lipids of BCG

[0067] Take the bacteria in the logarithmic growth phase of 7H9 whole base, collect the bacteria by centrifugation, suspend the bacteria in methanol / chloroform with a volume ratio of 2:1, 1:1 and 1:2, shake at room temperature overnight, extract the organic phase, filter and collect the filtrate, collect the lipid extract after rotary evaporation and weigh it. Then dissolve it in chloroform, load it on the TLC plate, develop it with a polar lipid developing agent (chloroform / methanol / water 65 / 25 / 5, v / v), and then stain it with phosphomolybdic acid (PMA).

[0068] 2.2 Characterization of polar lipids in BCG

[0069] like Figure 4 As shown, BCG kd Wild-type BCG is characterized by low abundance of polar lipids.

[0070] 2.3 Extraction of BCG kd and BCG’s LAM

[0071] After defatting in 2.1, the bacteria were ultrasonically disrupted on ice to remove nucleic acids and proteins. The aqueous phase was extracted with methanol / chloroform / water extract, and the weight was weighed after rotary evaporation. SDS-PAGE electrophoresis was performed and glycogen (PAS) staining was performed.

[0072] 2.4BCG kd and BCG's LAM characterization

[0073] like Figure 5 As shown, the molecular weight of LAM is about 35KDa, and that of LM is about 20KDa. Figure 5 A shows BCG after PAS staining kd and BCG's LAM characteristics, Figure 5 B is the comparison result after grayscale analysis by image J software, *** indicates P < 0.001. kd Wild-type BCG is characterized by high abundance of LAM.

[0074] Example 3 BCG_1059c gene knockdown, i.e. BCG kd Anti-tuberculosis applications.

[0075] 3.1 BCG_1059c gene knockdown at the in vitro cell level kd Application of regulating Th1 cytokines and bactericidal ability.

[0076] 1*10 6 / ml concentration of THP-1 human macrophages using heat-killed BCG kd After treatment with BCG (final concentration of 10ug / ml) for 24 hours and centrifugation to remove extracellular bacteria, the cells were cultured for 24 hours and induced to differentiate with PMA. The phagocytosis experiment with Escherichia coli was started (the bacteria and cells were infected at a multiplicity of 5:1). After 20 minutes of action, the extracellular residual bacteria were washed away and the lysed cells were collected at T0, 4h and 8h after infection for CFU colony count. At the same time, the cell supernatant was collected 8h after infection to detect the levels of IL-2 and TNF-α. The results are as follows Figure 6 As shown, BCG kd There was no difference in the number of phages between the BCG group and the BCG group at the initial T0 point, but 8 hours after infection, the number of phages in the BCG group was significantly higher than that in the BCG group. kd Treated macrophages secrete higher levels of IL-2 ( Figure 6 A) and TNF-α ( Figure 6 B), showing stronger phagocytic ability against E. coli ( Figure 6 C).

[0077] 3.2 In vivo BCG_1059c gene knockdown, i.e. BCG kd Measurement of lung retention time.

[0078] Select 6-8 week old Balb / c female mice and place about 10 5 CFU equal volume of BCG kd , BCG was injected into the tail vein of mice, and the mice were euthanized at 3 days, 2 weeks, 4 weeks, 8 weeks and 16 weeks after injection. Lung tissue prints were collected for acid-fast staining and tissue homogenates were used for CFU count to observe bacterial persistence. Figure 7 As shown, BCG kd Compared with the BCG group, the bacteria remained in the lungs of mice for a longer time and still survived in the lungs 16 weeks after infection. CFU count results ( Figure 7 A) and acid-fast staining ( Figure 7 B) can be detected.

[0079] SEQ ID NO: 1 is the nucleotide sequence of the BCG deletion strain knockout gene BCG_1059c of the present invention, and the full length of the sequence is 1512 bp.

[0080] >BCG_1059c5'

[0081] GTGGTACCCGTCGTCAGCCCGGCCCGCTGGTGCCGGTCGCGGATTTCG

[0082] GGCCCCTGGAC

[0083] CGGTTACGCGGCTGGATCGTGACCGGCCTGATCACGCTGCTGGCCAC

[0084] GGTGACCCGGTTC

[0085] CTGAACCTGGGCTCGCTGACCGATGCCGGCACCCCCATCTTCGACGA

[0086] GAAGCATTACGCA

[0087] CCCCAGGCCTGGCAGGTGCTGAACAACCATGGGGTGGAAGACAACC

[0088] CCGGGTACGGCCTG

[0089] GTGGTTCACCCGCCGGTCGGTAAGCAGCTGATCGCGATCGGGGAGG

[0090] CCATCTTCGGTTAC

[0091] AACGGATTCGGCTGGCGGTTCACCGGCGCCCTGCTGGGTGTGCTCCT

[0092] GGTGGCGCTGGTG

[0093] GTGCGGATCGTGCGGCGGATCAGCCGGTCGACATTGGTCGGCGCCAT

[0094] CGCCGGGGTGCTG

[0095] CTGATCTGCGACGGGGTCAGCTTCGTCACCGCGCGGACCGCGCTGCT

[0096] GGACGGCTTCCTG

[0097] ACGTTCTTCGTCGTCGCGGCGTTCGGCGCGCTCATCGTCGACCGCGA

[0098] TCAGGTTCGCGAA

[0099] CGGATGCACATCGCTCTGCTGGCCGGCCGCAGCGCCGCCACCGTGTG

[0100] GGGACCGCGGGTG

[0101] GGTGTGCGCTGGTGGCGGTTCGGCGCCGGGGTGCTGCTGGGATTGGC

[0102] TTGCGCCACCAAG

[0103] TGGTCCGGCGTGTACTTCGTGCTGTTCTTCGGCGCGATGGCGCTGGC

[0104] GTTCGACGTGGCG

[0105] GCGCGACGTCAGTACCAAGTGCAAAGACCGTGGCTGGGGACAGTGC

[0106] GGCGTGACGTGCTT

[0107] CCCAGCGGGTATGCGCTGGGGTTGATCCCGTTCGCGGTCTATCTGGC

[0108] CACCTACGCTCCG

[0109] TGGTTCGCGTCCGAGACCGCGATCGATCGGCATGCGGTCGGTCAAGC

[0110] GGTCGGTCGCAAC

[0111] TCGGTTGTTCCGCTGCCCGACGCCGTGCGCTCGCTCTGGCACTACAC

[0112] CGCCAAAGCGTTC

[0113] CACTTCCACGCGGGCCTGACGAATTCCGCAGGCAACTACCACCCTTG

[0114] GGAATCCAAACCG

[0115] TGGACCTGGCCCATGTCGTTGCGGCCGGTGCTGTACGCCATCGACCA

[0116] GCAAGACGTTGCA

[0117] GGCTGCGGCGCACAGTCGTGCGTCAAGGCCGAGATGCTGGTCGGCA

[0118] CGCCCGCGATGTGG

[0119] TGGCTGGCGGTGCCAGTCCTGGCATACGCGGGGTGGCGTATGTTTGT

[0120] GCGCCGGGACTGG

[0121] CGTTATGCGGTGGTCCTGGTCGGCTACTGCGCCGGTTGGCTGCCGTG

[0122] GTTCGCCGACATC

[0123] GACCGGCAGATGTACTTCTTCTACGCAGCGACCATGGCGCCATTTCT

[0124] GGTGATGGGCATT

[0125] TCGCTGGTTCTCGGCGATATCCTCTATCACCCCGGTCAGGGCTCCGA

[0126] ACGACGCACACTG

[0127] GGGCTGATCGTCGTCTGCTGCTACGTGGCCCTCGTGGTGACGAACTT

[0128] TGCGTGGCTGTAT

[0129] CCGGTGCTCACCGGTCTGCCAATCTCACAACAGACCTGGAACCTGGAGATCTGGCTGCCC

[0130] AGCTGGCGGTGA 3'

[0131] SEQ ID No: 2 is the sgRNA used in the present invention for knocking out BCG_1059c.

[0132] That is 5'-GAAATGGCGCCATGGTCGCTGC-3'.

[0133] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A recombinant BCG strain, characterized in that: The gene BCG_1059c of the recombinant BCG strain is knocked down or silenced, and the nucleotide sequence of the gene BCG_1059c is shown in SEQ ID No:

1.

2. The recombinant BCG strain according to claim 1, characterized in that: Compared with the wild-type BCG strain or the starting strain, the recombinant BCG strain has the following characteristics: (1) enhanced secretion level of lipoarabinomannoside; and (2) reduced secretion level of polar lipids.

3. The recombinant BCG strain according to claim 1, characterized in that: The gene BCG_1059c in the recombinant BCG strain was transformed by CRISPR / dCas9 sth1 The technology was knocked down; during the knockdown process, the BCG_1059c gene sgRNA sequence used was the nucleotide molecule shown in SEQ IDNo:

2.

4. The method for constructing the recombinant BCG strain according to claims 1 to 3, characterized in that: Through CRISPR / dCas9 sth1 The gene BCG_1059c in the wild-type BCG strain was obtained by knocking down the gene BCG_1059c in the wild-type BCG strain.

5. The method for constructing a recombinant BCG strain according to claim 4, characterized in that: (1) Design a primer comprising SEQ ID No: 2, with 5'-GGGA-3' added to its 5' end as a top oligo, and a primer complementary to SEQ ID No: 2 and with 5'-AAAC-3' added to its 5' end as a bottom oligo, Top oligo 5'-GGGAGAAATGGCGCCATGGTCGCTGC-3', Bottom oligo: 5'-AAACGCAGCGACATGGCGCCATTTC-3'; (2) annealing the top oligo and bottom oligo in step (1) to room temperature to form sgRNA oligos for use; (3) Use T4 ligase to connect the annealed sgRNA oligos in step (2) to the CRISPRi backbone plasmid (plJR965) after BsmBI-v2 digestion; (4) The ligation product in step (3) was transformed into E. coli Novablue, and sgRNA oligo-positive clones were screened based on the kanamycin resistance in the plJR965 plasmid and sequenced for verification; (5) The recombinant plasmid verified by sequencing in step (4) is electro-transfected into BCG competent cells, and positive colonies are screened using 7H10 plates containing kanamycin and then induced with tetracycline to screen the induction concentration and induction time; (6) The expression of BCG_1059c in the positive cloned bacteria was detected, and there was a significant difference compared with the wild-type BCG, thus obtaining a recombinant strain with BCG_1059c gene knocked out, i.e., a recombinant BCG strain.

6. An integration plasmid for BCG_1059c gene knockdown, characterized in that: The integration plasmid is CRISPR / dCas9 sth1 The backbone plasmid PLJR965 of the system is connected to sgRNA, and the sgRNA sequence is the nucleotide molecule shown in SEQ ID No:

2.

7. A composition, characterized in that: It comprises the recombinant BCG strain according to any one of claims 1 to 3 and an adjuvant.

8. The composition according to claim 7, characterized in that The product form of the composition is BCG vaccine; the adjuvant is aluminum; and the immunization route adopted is intravenous injection.

9. Use of the recombinant BCG strain according to any one of claims 1 to 3 and / or the integration plasmid according to claim 6 and / or the composition according to claim 7 or 8 in the preparation of a tuberculosis vaccine.

10. The use according to claim 9, characterized in that: The tuberculosis is pulmonary tuberculosis.

Images