Method for delivering double-stranded RNA (Ribonucleic Acid) molecule into locust body through epidermis, product and application

Abstract

The invention provides a method for delivering double-stranded RNA (Ribonucleic Acid) molecules into locusts through epidermis, a product and application. The method provided by the invention comprises the following steps: mixing double-stranded RNA molecules to be delivered with a polymer carrier as shown in a formula 1 to obtain a mixture of the double-stranded RNA molecules and the polymer carrier; adding a surfactant into the mixture of the double-stranded RNA molecules and the polymer carrier to obtain a delivery mixture; the delivery mixture is contacted with the epidermis of the locust, so that the double-stranded RNA molecule enters the locust body through the epidermis. According to the method provided by the invention, the double-stranded RNA molecules can penetrate through relatively thick epidermis to enter the locust body, so that the stability of the double-stranded RNA molecules in the locust body is improved, and efficient gene interference is realized. The method provided by the invention can be used for research of locust gene functions and application of RNA pesticides.

Description

Technical Field

[0001] The present invention relates to the technical field of pest control, and in particular to a method, product and application of delivering double-stranded RNA molecules into locusts through the epidermis. Background Art

[0002] RNA interference (RNAi) is a phenomenon in which double-stranded RNA (dsRNA) induces the specific degradation of homologous mRNA, leading to gene silencing. RNAi technology can specifically reduce or shut down the expression of specific genes and has been widely used in the control of agricultural pests, providing a biological basis for RNA-based pest control. RNAi-based RNA pesticides demonstrate significant potential in agricultural pest control, and the development of RNA pesticides that specifically target pests while being safe to non-target organisms has become a hot topic in pest control.

[0003] Locusts are a worldwide migratory agricultural pest, and their swarming behavior poses a significant threat and significant losses to agricultural and animal husbandry production. Research on locust gene function, revealing the biological mechanisms of locust growth, development, swarming, and damage, will help develop new methods for controlling locust outbreaks. Currently, research on locust gene function primarily relies on RNA interference (RNAi). The commonly used method for delivering dsRNA to locusts is injection, where dsRNA is delivered into the locust hemolymph using a syringe. Furthermore, because dsRNA degrades more rapidly in the locust midgut fluid than in the hemolymph, gene silencing efficiency is poor with feeding. Recent studies have leveraged the protective effect of nanoparticles on dsRNA, mitigating this rapid degradation in the locust gut and enabling dsRNA delivery via feeding. However, when locust swarms occur, the most direct control method remains large-scale pesticide spraying, using both contact and stomach poisoning to kill the locusts. Due to the thick cuticle of locusts, no technology exists to allow RNA to enter the hemolymph through direct contact and exert its gene interference function. These current RNA delivery methods are not conducive to the application of RNA pesticides in locust control. Therefore, key technologies for delivering RNA through direct contact are urgently needed. Summary of the Invention

[0004] The technical problem to be solved by the present invention is how to deliver double-stranded RNA molecules into the body of locusts through the epidermis.

[0005] In a first aspect, the present invention provides a method for delivering a double-stranded RNA molecule into a locust, comprising: The double-stranded RNA molecule to be delivered is mixed with the polymer carrier shown in Formula 1 to obtain a mixture of the double-stranded RNA molecule and the polymer carrier: adding a surfactant to the mixture of the double-stranded RNA molecule and the polymer carrier to obtain a delivery mixture; contacting the delivery mixture with the locust epidermis to deliver the double-stranded RNA molecule into the locust body through the locust epidermis; ; In formula 1, R1 and R2 are each independently selected from H, CH3, CH2CH3 or CH2CH2CH3; n1, n2, n3, and n4 are each independently 1-100.

[0006] According to the method described above, the double-stranded RNA molecule targets and silences the locust idgf4 gene, and the locust idgf4 gene is a double-stranded DNA with a nucleotide sequence of SEQ ID NO: 2; SEQ ID NO: 2 is specifically as follows:

[0007] The double-stranded RNA molecule consists of the nucleotides shown in SEQ ID NO: 1 and the nucleotides shown in its reverse complementary sequence.

[0008] SEQ ID NO: 1 is specifically as follows: 5'-CUGCUCACCCUCACCGUCAUCCCCUACAUCAACCAGUCGCUGUACUACGACCUGACGGCGCUGAACCAGCAAGUGGACCACUCCGACCUGACGGCGCUGACCCAGCAAGUGGACCAGGUGCAGCUGCUGGCCUACGACUACCGCAACCCCGAGAGGGACCCCAAGGAGGCCGACUACCCGGCGCCCCUCUACCCGGCCGGCCAGAGGGACUCAGACCUCUCCGUCGACGGCA ACGUCCGCUGGUUCCCGAGAACGCCUUCCCAGCUAGCAAGCUGGUGCUGGGCAUCCCGACGUUCGCGCGCACCUGGAAGCUGACGGAGGACAGCAAGGGUCCGGGGCCCCUCCCAUCGAGACGGACGGCCCGGCGACCAGGACGCGAUCGCCAGCACGCCGGGCCUGCUGGCCUACCAGUCGGUGUGCACGCUGCUGCCCAACCCCGCCAACAAGGACAAGCCGACGA-3'.

[0009] According to the method described above, in the structure shown in Formula 1, R1 and R2 are both CH3, and n1, n2, n3, and n4 are all 40.

[0010] Furthermore, the polymer carrier represented by Formula 1 can be prepared by the preparation method disclosed in Chinese invention patent publication number CN108794710A.

[0011] In the method described above, the surfactant is a non-ionic surfactant to promote the adhesion and spread of double-stranded RNA molecules on the surface of the insect body.

[0012] Furthermore, the surfactant is alkyl polyglycoside (APG).

[0013] In the method described above, the mass ratio of the double-stranded RNA molecule to the polymer carrier represented by Formula 1 is 1:1.

[0014] In the above method, the final concentrations of the double-stranded RNA molecule and the polymer carrier represented by Formula 1 in the delivery mixture can be 100-1000 ng / μL, respectively.

[0015] As described above, the volume concentration of the surfactant in the delivery mixture is 0.1%-1%.

[0016] As described above, the solvent used in the delivery mixture may be nuclease-free water.

[0017] As described above, the double-stranded RNA molecule to be delivered is mixed with the polymer carrier shown in Formula 1 to obtain a mixture of the double-stranded RNA molecule and the polymer carrier, specifically comprising: mixing the double-stranded RNA molecule with the above-mentioned polymer carrier and incubating at 0-35°C for at least 15 min to form a mixed system of the double-stranded RNA molecule and the carrier.

[0018] Furthermore, the incubation temperature of the double-stranded RNA molecule and the above polymer carrier is 18-28°C.

[0019] As described above, the locust epidermis includes but is not limited to the pronotum.

[0020] In a second aspect, the present invention provides a product comprising a polymer carrier represented by Formula 1 and a surfactant; ; In formula 1, R1 and R2 are each independently selected from H, CH3, CH2CH3 or CH2CH2CH3; n1, n2, n3, and n4 are each independently 1-100.

[0021] The product as described above further comprises at least one of a double-stranded RNA molecule and a substance for preventing or controlling plants from being attacked by locusts.

[0022] For the product as described above, the double-stranded RNA molecule, the polymer carrier represented by Formula 1 and the surfactant are as described above.

[0023] The product as described above may specifically be a kit or an RNA preparation.

[0024] For the product as described above, various substances in the product can be stored separately.

[0025] In a third aspect, the present invention provides an application of the above method or product, wherein the application is at least one of A1) to A6): A1) Application in locust control; A2) Use in the preparation of products for locust control; A3) Application in preventing or controlling locust infestation on plants; A4) Use in the preparation of products for preventing or controlling locust infestation on plants; A5) Application in identifying gene functions in locusts; A6) Application in the preparation of products for identifying locust gene functions.

[0026] In a fourth aspect, the present invention provides a method for identifying the gene function of locusts, comprising: designing a double-stranded RNA molecule that targets and silences the gene to be identified, and delivering the double-stranded RNA molecule into the locust through the locust epidermis according to the method described in the first aspect of the present invention to identify the gene function of the locust.

[0027] In the above method, the gene to be identified can specifically be the idgf4 gene, which is a double-stranded DNA having a nucleotide sequence of SEQ ID NO: 2. The double-stranded RNA molecule that targets and silences the gene to be identified is composed of the nucleotide sequence of SEQ ID NO: 1 and the nucleotide sequence of its reverse complement. The function of the idgf4 gene is to promote locust cuticle formation.

[0028] The method described above can identify locust gene functions by identifying gene expression levels and observing locust phenotypes.

[0029] In a fifth aspect, the present invention provides a double-stranded RNA molecule, which consists of the nucleotides shown in SEQ ID NO: 1 and the nucleotides shown in its reverse complementary sequence.

[0030] In a sixth aspect, the present invention provides a biomaterial, wherein the biomaterial is selected from at least one of B1) to B6): B1) a DNA molecule corresponding to the double-stranded RNA molecule; B2) an expression cassette containing the DNA molecule described in B1); B3) a recombinant expression vector containing the DNA molecule described in B1); B4) a recombinant microorganism containing the DNA molecule described in B1); B5) a recombinant microorganism containing the expression cassette described in B2); B6) A recombinant microorganism containing the recombinant expression vector described in B3).

[0031] In a seventh aspect, the present invention provides a method for reducing the thickness of locust epidermis, comprising: delivering a double-stranded RNA molecule that targets and knocks out the idgf4 gene in the locust into the locust body, and reducing the thickness of the locust epidermis by interfering with the expression of the idgf4 gene in the locust body.

[0032] The method as described above, the delivery method is specifically the method provided by the first aspect of the present invention.

[0033] In the method described above, the locust epidermis is specifically the locust inner epidermis.

[0034] In an eighth aspect, the present invention provides a method for preventing or controlling locust infestation on plants, comprising: preparing a delivery mixture, the delivery mixture comprising at least a double-stranded RNA molecule that targets and silences the idgf4 gene in locusts and a polymer carrier represented by Formula 1; contacting the delivery mixture and the substance for preventing or treating plants from being attacked by locusts with locusts, and allowing the double-stranded RNA molecule and the substance for preventing or treating plants from being attacked by locusts to be delivered into the locusts, thereby preventing or treating plants from being attacked by locusts; ; In formula 1, R1 and R2 are each independently selected from H, CH3, CH2CH3 or CH2CH2CH3; n1, n2, n3, and n4 are each independently 1-100.

[0035] In the method described above, the plants are plants susceptible to locust infestation, such as grasses, sedges, beans, potatoes, sugarcane, cotton, vegetables, bamboo, forage, trees, fruit trees, etc., and grasses include wheat, corn, sorghum, rice, sugarcane, etc.

[0036] The method as described above, wherein the delivery mixture further comprises a surfactant.

[0037] In the above method, the substance for preventing or controlling the invasion of plants by locusts is a substance that is toxic or lethal to locusts, and specifically can be a microorganism, such as Beauveria bassiana or its spores.

[0038] In the above method, the delivery mixture and the prevention or treatment of locust infestation on plants can be contacted with the locust epidermis simultaneously or separately, and the order of the two is not further limited.

[0039] According to the above method, the delivery mixture and the agent for preventing or treating plants from being attacked by locusts can be directly sprayed on the surface of the plants, or the delivery mixture, the agent for preventing or treating plants from being attacked by locusts can be mixed with pesticides and then sprayed on the surface of the plants.

[0040] The method provided by the present invention enables double-stranded RNA molecules to penetrate the thick cuticle and enter the locust body, thereby improving the stability of the double-stranded RNA molecules in the locust body and achieving efficient gene interference. The method provided by the present invention can be used for the study of locust gene function and the application of RNA pesticides. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1Figure 2 is a graph showing the results of measuring the effect of the dsidgf4-Flurescein / SPc complex on the epidermis of locust nymphs. A is a fluorescence image obtained by observing the dorsal abdomen of third-instar locust nymphs using a fluorescence microscope after H2O, dsidgf4-Flurescein, and dsidgf4-Flurescein / SPc complex were dripped onto the dorsal abdomen of the third-instar locust nymph, respectively. The scale bar is 250 μm. B is a statistical analysis result of the mean gray value corresponding to A. Different lowercase letters in the figure represent the P The difference was significant at the <0.05 level, and the same lowercase letters indicate P The difference was not significant at the <0.05 level; Figure 2 The results of the stability analysis of the dsidgf4 / SPc complex in locust hemolymph are shown in Figure 1. A shows the agarose gel electrophoresis results of dsidgf4 and the dsidgf4 / SPc complex; B shows the agarose gel electrophoresis results of dsidgf4 mixed with locust hemolymph solutions containing different concentrations for 4 hours; C shows the agarose gel electrophoresis results of dsidgf4 mixed with solutions containing or not containing SPc and locust hemolymph for 4 hours. Figure 3 The expression level and function identification of idgf4 gene; A is the relative expression of idgf4 gene in locusts after different treatment times when dseGFP, dsidgf4, dseGFP / SPc and dsidgf4 / SPc were dripped onto the lower part of the pronotum of third-instar locust nymphs. idgf4 ) Statistical results; B is the statistical results of the relative expression of the idgf4 gene after the introduction of dsidgf4 by injection; C is the thinning of the inner epidermis of locusts after idsf4 gene interference as observed by transmission electron microscopy and the statistical results; Figure 4 dsidgf4 promotes the lethal effect of Beauveria bassiana on locusts; the statistical graph shows the survival rate of each group of locusts after dseGFP, dsidgf4, dseGFP / SPc, and dsidgf4 / SPc were dripped onto the lower part of the pronotum of the third instar locust nymphs after dripping Beauveria bassiana. DETAILED DESCRIPTION

[0042] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. Obviously, the embodiments described are part of the embodiments of the present invention, not all of the embodiments, and they should not be understood as limitations on the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. In the description of the present invention, it should be understood that the terms used are only for descriptive purposes and cannot be understood as indicating or implying relative importance.

[0043] The experimental methods in the following examples, unless otherwise specified, are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, are all commercially available.

[0044] The East Asian migratory locusts used in the following examples were provided by the Insect Behavior and Green Control Laboratory, College of Plant Protection, China Agricultural University. The East Asian migratory locusts were reared in cylindrical metal cages (50 cm long, 15 cm diameter) at a density of 80–100 individuals per cage at a temperature of 30 ± 1°C, a humidity of 70 ± 5%, and a photoperiod of 16 h day:8 h night. They were fed fresh wheat seedlings daily until the end of the experiment.

[0045] The nucleic acid carrier SPc used in the following examples is the star polymer P2 disclosed in Example 2 of the Chinese invention patent application with publication number CN108794710A, and its structural formula is as follows: .

[0046] The surfactant alkyl polyglycoside (APG) was purchased from Wanhua (Guangzhou) Supply Chain Service Co., Ltd., catalog number APG0810. M5 HiPer Total RNA Extraction Reagent (TRIgent) was purchased from Beijing Polymer Biotechnology Co., Ltd. T7 RNAi Transcription Kit and Gel DNA Extraction Mini Kit were purchased from Nanjing Novogene. TransScript Uni All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) and TransStart Top Green qPCR SuperMix (+Dye II) were purchased from Beijing Quanshijin Biotechnology. PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect RealTime) was purchased from Baoriyi Biotechnology (Beijing) Co., Ltd. DH5α competent cells and Trelief Plasmid MiniKit Plus were purchased from Qingke Biotechnology. Fluorescein RNA Labeling Mix was purchased from Roche. 5× Transcription Buffer and T7 RNA Polymerase were purchased from Thermo Fisher.

[0047] The following examples were processed using GraphPad Prism 8.0.2 statistical software. The experimental results are expressed as mean ± standard deviation, and the significance of the difference was analyzed using independent sample analysis. T Test, ** represents the level of significance of the difference P <0.01, * represents the significant difference level P <0.05, ns represents the significant difference level P >0.05.

[0048] The primers involved in the following examples are shown in Table 1.

[0049] Table 1 Primers involved in the embodiments of the present invention

[0050] In Table 1, the underlined sequence is the T7 promoter sequence.

[0051] Example 1: Determination of epidermal penetration ability of dsidgf4 / SPc complex 1. Synthesis of fluorescent dsidgf4 Total RNA was extracted from Locust migratory locusts using the M5 Hiper Total RNA Extraction Reagent (Trigent) kit. The purity and concentration of the total RNA were determined using a Nanodrop 2000 UV spectrophotometer, and the RNA quality was checked by agarose gel electrophoresis. cDNA was synthesized using the PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) using 1 g of RNA as a template according to the kit's instructions.

[0052] Using the cDNA as a template, PCR was performed to amplify the idgf4 fragment using primers dsidgf4-T7F and dsidgf4-T7R, which carry the T7 promoter sequence. After completion of the amplification reaction, the amplified product was electrophoresed on a 1% agarose gel to confirm its size and purified using the Gel DNA Extraction Mini Kit. The recovered product was ligated into the pMD19-T vector (purchased from Takara, Cat. No. 6013) to construct a recombinant vector. The recombinant vector was then transformed into DH5α competent cells, and the transformed product was evenly plated on Amp-resistant LB medium and cultured overnight at 37°C. Positive single colonies were selected and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. After sequencing verification, the strain with the correct sequence was expanded. Plasmids were extracted using the Trelief Plasmid Mini Kit Plus High-Purity Plasmid Extraction Kit. Using the plasmid as a template, PCR was performed using primers dsidgf4-T7F and dsidgf4-T7R, which carry the T7 promoter sequence, to amplify the idgf4 fragment containing the T7 promoter sequence. After gel electrophoresis confirmed that the PCR product was the expected size, it was recovered and purified.

[0053] Using the IDGF4 fragment with a T7 promoter sequence as a template, the following system was prepared: 0.5 μg of the IDGF4 fragment with a T7 promoter sequence; 2 μL of Fluorescein RNA Labeling Mix; 2 μL of T7 RNA Polymerase; and 4 μL of 5× Transcription Buffer. The total volume was brought to 20 μL with RNase-free H₂O. The sample was gently mixed and incubated at 37°C overnight, followed by incubation at 70°C for 10 minutes. The sample was then allowed to cool to room temperature. The reaction was terminated by adding 2 μL of 0.2 M EDTA. The reaction product was purified using a QIAquick PCR Purification Kit to obtain fluorescently labeled IDGF4.

[0054] 2. Preparation of Fluorescently Labeled dsidgf4 / SPc Complex and Detection of Epidermal Penetration Ability Fluorescently labeled dsidgf4 and the nucleic acid carrier SPc were mixed in a mass ratio of 1:1 to obtain a mixture with a final concentration of 80 ng / μL of both fluorescently labeled dsidgf4 and SPc. The mixture was incubated at room temperature for 15 min, and then the surfactant APG was added to a final volume concentration of 1% and mixed evenly. The resulting mixture was named dsidgf4-Flurescein / SPc.

[0055] At the same time, fluorescently labeled dsidgf4 was mixed with surfactant APG, and the final volume concentration of surfactant APG was controlled to be 1%, and the final concentration of fluorescently labeled dsidgf4 was 80 ng / μL. The resulting mixture was named dsidgf4-Flurescein.

[0056] Eighteen third-instar nymphs of the East Asian migratory locust (Locust migratoria migratoria) were divided into three groups, with six nymphs in each group. The first group received 5 μL of the aforementioned dsidgf4-Flurescein / SPc mixture on the dorsal abdomen of the third-instar nymphs; the second group received 5 μL of the aforementioned dsidgf4-Flurescein mixture on the dorsal abdomen of the third-instar nymphs; and the third group received 5 μL of H2O on the dorsal abdomen of the third-instar nymphs as a control. After being treated with the different reagents, the nymphs in each group were allowed to rest for 1 hour and then washed three times with 500 μL of sterile water to remove any residual fluorescently labeled dsidgf4 on the surface. The dorsal abdomen of the third-instar nymphs was directly observed using a fluorescence microscope (Nikon Ti-E, Japan). The resulting fluorescence images are shown in Figure 2. Figure 1 As shown in A, the mean gray value (AU) of the dorsal abdomen of the third-instar locust nymphs in each group was statistically analyzed. Figure 1 As shown in B.

[0057] according to Figure 1 It can be seen that after the third-instar locust nymphs were treated with the mixture dsidgf4-Flurescein / SPc, a large amount of fluorescent signals were distributed on the dorsal side of the abdomen, while after the third-instar locust nymphs were treated with the mixture dsidgf4-Flurescein, there was almost no fluorescence on the dorsal side of the abdomen, indicating that SPc can help dsidgf4 penetrate into the epidermis faster.

[0058] Example 2: Determination of the Stability of the dsidgf4 / SPc Complex in Locust Hemolymph 1. Synthesis of dsidgf4 The idgf4 fragment with the T7 promoter sequence obtained in Example 1 was used as a template for dsidgf4 synthesis using the T7 RNAi Transcription Kit. The reaction mixture consisted of: 8 μL NTP Mix, 2 μL 10× Transcription Buffer, 1 μg template DNA, 2 μL T7 Enzyme Mix, and RNase-free H₂O to a total volume of 20 μL. The sample was gently mixed and incubated at 37°C overnight. Following incubation, a double enzyme digestion was performed using the following system: 20 μL transaction product, 17 μL RNase-free H₂O, 1 μL DNase I, and 2 μL RNase T1 (10 U / μL). The sample was gently mixed and incubated at 37°C for 30 min. After incubation, add 0.1 volumes of 3 M sodium acetate (pH 5.2) and 1 volume of isopropanol, mix well, and place on ice for 5 minutes. Centrifuge at 12,000 g for 10 minutes, and discard the supernatant. Wash the precipitate three times with 0.5 mL of cold 70% ethanol. After air-drying, add an appropriate amount of RNase-free H2O to dissolve the dsRNA. Determine the dsRNA concentration using a Nanodrop 2000 UV spectrophotometer and store at -20°C. The resulting dsRNA molecule, designated dsidgf4, consists of the nucleotide sequence set forth in SEQ ID NO:1 and its reverse complement.

[0059] SEQ ID NO: 1 is specifically as follows: 5'-CUGCUCACCCUCACCGUCAUCCCCUACAUCAACCAGUCGCUGUACUACGACCUGACGGCGCUGAACCAGCAAGUGGACCACUCCGACCUGACGGCGCUGACCCAGCAAGUGGACCAGGUGCAGCUGCUGGCCUACGACUACCGCAACCCCGAGAGGGACCCCAAGGAGGCCGACUACCCGGCGCCCCUCUACCCGGCCGGCCAGAGGGACUCAGACCUCUCCGUCGACGGCA ACGUCCGCUGGUUCCCGAGAACGCCUUCCCAGCUAGCAAGCUGGUGCUGGGCAUCCCGACGUUCGCGCGCACCUGGAAGCUGACGGAGGACAGCAAGGGUCCGGGGCCCCUCCCAUCGAGACGGACGGCCCGGCGACCAGGACGCGAUCGCCAGCACGCCGGGCCUGCUGGCCUACCAGUCGGUGUGCACGCUGCUGCCCAACCCCGCCAACAAGGACAAGCCGACGA-3'.

[0060] 2. Complexation of nucleic acid carrier SPc and dsidgf4 1 μg of dsidgf4 was mixed with 1 μg of SPc (mass ratio 1:1) and incubated at room temperature for 15 min. 1 μg of dsidgf4 without SPc was used as a control and then subjected to agarose gel electrophoresis. Figure 2 As shown in Figure A, the electrophoresis of dsidgf4 alone shows a band of about 500 bp. Since SPc is a positively charged cation and nucleic acid is negatively charged, the combination of the two causes the nucleic acid to lose its electrical properties, resulting in dsidgf4 being blocked in the electrophoresis, resulting in bright nucleic acid residues in the gel wells where SPc is added (such as Figure 2 The result was shown as the arrow in A), indicating that the nucleic acid carrier SPc successfully bound to dsidgf4, and was named as dsidgf4 / SPc complex.

[0061] 3. Analysis of the stability of the dsidgf4 / SPc complex in hemolymph Use Venus scissors to cut off the hind legs of the third-instar nymph of the East Asian migratory locust, gently pinch the insect body, and use a pipette to aspirate the hemolymph and transfer it to a centrifuge tube on ice. Add N-Phenylthiourea at a final concentration of 1 μg / μL to the centrifuge tube to inhibit the melanization of the hemolymph. Dilute the hemolymph with PBS to 100%, 50%, 25%, 12.5%, 6.25%, and 3.125%, respectively. Mix 1 μg dsidgf4 with solutions containing 100%, 50%, 25%, 12.5%, 6.25%, 3.125%, and 0% hemolymph, respectively, and incubate at 25°C for 4 hours. After incubation, perform agarose gel electrophoresis detection, and the detection results are as follows. Figure 2 As shown in middle B, it can be seen that when the hemolymph content is 12.5%, dsidgf4 is completely degraded, and the 12.5% ​​hemolymph solution is selected for the next experiment.

[0062] 1 μg of dsidgf4 was incubated with SPc at a mass ratio of 1:1 at room temperature for 15 min, and then hemolymph was added at a final concentration of 12.5% ​​and incubated at 25°C for 4 h. After the incubation, SDS was added at a final concentration of 0.1% to disaggregate the dsidgf4 / SPc complex, and the results were detected by agarose gel electrophoresis. Figure 2 As shown in middle C, it can be seen that in the presence of SPc, the dsidgf4 band is still clear, while in the absence of SPc, dsidgf4 is completely degraded by hemolymph, indicating that SPc can enhance the stability of dsidgf4 in hemolymph and protect dsidgf4 from rapid degradation by hemolymph.

[0063] Example 3: Detection of idgf4 interference efficiency and gene function by body wall permeation method 1. Synthesis of control dseGFP Using the eGFP plasmid (purchased from Zhuangmeng Biotechnology, Catalog No. ZK2378) as a template, PCR was performed with primers dseGFP-T7F and dseGFP-T7R, which carry the T7 promoter sequence, to amplify an eGFP fragment containing the T7 promoter sequence. Using the eGFP plasmid with the T7 promoter sequence as a template, dseGFP was prepared using the same method as for dsidgf4 in Example 2. dseGFP consists of the nucleotide sequence described in SEQ ID NO:3 and its reverse complement.

[0064] SEQ ID NO: 3 is specifically as follows: 5'-CACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAG GAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAAC-3'.

[0065] 2. Epidermal penetration method for dsRNA administration dseGFP and dsidgf4 were mixed with the surfactant APG, respectively, to a final dsRNA concentration of 600 ng / μL and a final volume concentration of 1% APG, to obtain dseGFP reagent and dsidgf4 reagent, named dseGFP and dsidgf4; dseGFP and dsidgf4 were incubated with SPc at a mass ratio of 1:1 at room temperature for 15 min, respectively, to a final dsRNA concentration of 600 ng / μL, and then the surfactant APG was added at a final volume concentration of 1%. After mixing evenly, dseGFP / SPc reagent and dsidgf4 / SPc reagent were obtained, named dseGFP / SPc and dsidgf4 / SPc.

[0066] Forty-eight third-instar nymphs of the East Asian migratory locust (Locust migratoria migratoria) were divided into four groups of 12 each. The first group received 5 μL of dseGFP, the second group received 5 μL of dsidgf4, the third group received 5 μL of dseGFP / SPc, and the fourth group received 5 μL of dsidgf4 / SPc. Subsequent experiments were performed 12, 24, 48, and 60 hours after the inoculation.

[0067] 3. Real-time fluorescence quantitative PCR detection of idgf4 gene expression after drip treatment After different treatment times, locust nymphs were sampled and total RNA was extracted. Then, reverse transcription was performed using First-Strand cDNASynthesis SuperMix for qPCR (One-Step gDNA Removal) to obtain cDNA, and the cDNA was diluted 5-fold with RNase-Free ddH2O. Real-time fluorescence quantitative PCR was performed using TransStart Top Green qPCR SuperMix (+Dye II) reagent with the primers idgf4-qF / idgf4-qR shown in Table 1 to detect the expression level of the locust idgf4 gene. Elongation factor 1 alpha The gene (NCBI accession number is HQ388819) was used as the internal reference, and the target Elongation factor 1 alpha Real-time fluorescence quantitative PCR was performed using primers EF1α-qF / EF1α-qR, and the CT value was determined by the average of 3 biological replicates and 3 technical replicates. -ΔΔCt Methods The relative expression level of idgf4 gene was calculated.

[0068] The results are as follows Figure 3 As shown in Figure A, dsidgf4 expression was reduced after 24 and 48 hours of treatment with dsidgf4, but there was no significant difference compared to the control dseGFP. Treatment with dsidgf4 / SPc for 12, 24, 48, and 60 hours significantly reduced idgf4 expression, with gene expression levels at the four time points decreasing by 36.46%, 54.66%, 44.33%, and 23.39%, respectively. The gene disruption rate at the lowest point exceeded half. Therefore, SPc can help dsidgf4 penetrate the epidermis faster, and the gene disruption effect is far greater than that of treatment without SPc.

[0069] 4. Comparison of IDGF4 interference efficiency with injection method In order to compare the interference efficiency with that of the commonly used injection method, 3 μg of dsidgf4 and dsGFP were injected into the third instar nymphs of Locust migratory birds, respectively. 24 h after injection, real-time fluorescence quantitative PCR was performed using the same method as in 3.

[0070] The results are as follows Figure 3 As shown in Figure B, after injection of dsidgf4, the gene knockdown efficiency of idgf4 reached 62.95%. Compared to the aforementioned epidermal penetration method, the injection method achieved slightly better gene knockdown efficiency at a dsRNA dosage of 3 μg, due to dsRNA loss and incomplete absorption by the insects. During the epidermal penetration method, the dsRNA dosage can be increased to achieve a higher gene knockdown rate.

[0071] 5. Detection of gene function after IDGF4 interference After 48 hours of treatment with dseGFP / SPc and dsidgf4 / SPc, the third-instar locust nymphs were removed from the 2nd to 4th abdominal segments of the locust nymphs. The epidermal structure of the locust nymphs was observed using a transmission electron microscope, and the thickness of the endocuticle was calculated using Image J software. Figure 3 As shown in Figure C, dsidgf4 / SPc treatment significantly thinned the locust protocuticle, driven by a significant decrease in the inner cuticle from 5.02 µm to 3.52 µm, while the outer cuticle remained unchanged. In summary, idgf4 gene disruption alters the thickness of the locust inner cuticle, and SPc can be used to investigate gene function.

[0072] Example 4: Application of epidermal penetration method to interfere with idgf4 Beauveria bassiana (Bb) spores were collected using 0.05% Tween-80 sterile water and the spore concentration was determined using a hemocytometer. The spore suspension was diluted to 10 7 / mL, 2 μL of spore suspension was dripped onto the pronotum of locusts. Four groups, 80 each, were dripped; 2 μL of Tween-80 sterile water was dripped as a control, designated as the control. Using the epidermal penetration method described in step 2 of Example 3, dsidg4, dseGFP, dsidg4 / SPc, and dseGFP / SPc dsRNAs were dripped onto the underside of the pronotum of third-instar locust nymphs that had been inoculated with Beauveria bassiana spores. These dsRNAs were designated as Bb+dsidg4, Bb+dseGFP, Bb+dsidg4 / SPc, and Bb+dseGFP / SPc dsRNA, respectively. After the dripping, each group of locusts was fed normally, and mortality was counted daily for 10 days.

[0073] The results are as follows Figure 4 As shown, compared with the control, Bb+dsidgf4 / SPc showed a lower survival rate and a shorter median lethality of 5.5 days, significantly better than the 7 days of Bb+dseGFP / SPc. However, there was no significant difference between Bb+dsidgf4 and Bb+dseGFP without SPc. Therefore, SPc-mediated idgf4 gene disruption can enhance the control of Beauveria bassiana.

[0074] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A method for delivering double-stranded RNA molecules into locusts, characterized in that: include: Mixing the double-stranded RNA molecule to be delivered with the polymer carrier shown in Formula 1 to obtain a mixture of the double-stranded RNA molecule and the polymer carrier; adding a surfactant to the mixture of the double-stranded RNA molecule and the polymer carrier to obtain a delivery mixture; contacting the delivery mixture with the locust epidermis to deliver the double-stranded RNA molecule into the locust body through the locust epidermis; ； In formula 1, R1 and R2 are each independently selected from H, CH3, CH2CH3 or CH2CH2CH3; n1, n2, n3, n4 are each independently 1-100.

2. The method according to claim 1, characterized in that The surfactant is a nonionic surfactant.

3. A product, characterized in that: It includes a polymer carrier and a surfactant as shown in Formula 1; ； In formula 1, R1 and R2 are each independently selected from H, CH3, CH2CH3 or CH2CH2CH3; n1, n2, n3, n4 are each independently 1-100.

4. The product according to claim 3, characterized in that The product also includes at least one of a double-stranded RNA molecule and a substance for preventing or controlling plants from being attacked by locusts.

5. Use of the method according to any one of claims 1 to 2 or the product according to any one of claims 3 to 4, characterized in that: The application is at least one of A1) to A6): A1) Application in locust control; A2) Use in the preparation of products for locust control; A3) Application in preventing or controlling locust infestation on plants; A4) Use in the preparation of products for preventing or controlling locust infestation on plants; A5) Application in identifying gene functions in locusts; A6) Application in the preparation of products for identifying locust gene functions.

6. A method for identifying locust gene function, characterized in that: include: A double-stranded RNA molecule is designed to target and silence the gene to be identified, and according to the method described in any one of claims 1 to 2, the double-stranded RNA molecule is delivered into the locust through the locust epidermis to identify the locust gene function.

7. A double-stranded RNA molecule, characterized in that The double-stranded RNA molecule consists of the nucleotides shown in SEQ ID NO: 1 and the nucleotides shown in its reverse complementary sequence.

8. Biomaterial, characterized in that The biological material is selected from at least one of B1) to B6): B1) a DNA molecule corresponding to the double-stranded RNA molecule according to claim 7; B2) an expression cassette containing the DNA molecule described in B1); B3) a recombinant expression vector containing the DNA molecule described in B1); B4) a recombinant microorganism containing the DNA molecule described in B1); B5) a recombinant microorganism containing the expression cassette described in B2); B6) A recombinant microorganism containing the recombinant expression vector described in B3).

9. A method for reducing the thickness of locust epidermis, characterized in that: include: Double-stranded RNA molecules that target and silence the idgf4 gene in locusts are delivered into the locusts, thereby reducing the thickness of the locust epidermis by interfering with the expression of the idgf4 gene in the locusts.

10. A method for preventing or controlling locust infestation on plants, characterized in that: include: preparing a delivery mixture, the delivery mixture comprising at least the double-stranded RNA molecule of claim 7 and the polymer carrier shown in Formula 1; contacting the delivery mixture and the substance for preventing or treating plants from being damaged by locusts with locusts, and delivering the double-stranded RNA molecule and the substance for preventing or treating plants from being damaged by locusts into the body of the locust to prevent or treat plants from being damaged by locusts; ； In formula 1, R1 and R2 are each independently selected from H, CH3, CH2CH3 or CH2CH2CH3; n1, n2, n3, n4 are each independently 1-100.

Images