Use of dhrs4 as a biomarker in the diagnosis of preeclampsia
By detecting DHRS4 expression levels and regulating LONP2, DHRS4, as a biomarker, has solved the diagnostic and treatment challenges of preeclampsia, revealed its pathogenesis in preeclampsia, and provided new diagnostic and treatment methods.
Patent Information
- Application Number
- CN202411511921.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-28
- Publication Date
- 2026-03-20
- Estimated Expiration
- 2044-10-28
AI Technical Summary
Current technologies lack effective methods for diagnosing and treating preeclampsia, and its pathogenesis remains unclear, affecting maternal and fetal health and increasing the risk of future chronic diseases.
By using DHRS4 as a biomarker, its expression level and regulation of LONP2 expression can influence mitochondrial function, thereby regulating the occurrence and development of preeclampsia, and providing diagnostic kits and therapeutic drugs.
DHRS4 can serve as a biological marker for preeclampsia, helping to predict and diagnose preeclampsia and providing a theoretical basis for clinical treatment. It can reduce the risk of the disease by regulating mitochondrial function and influencing the remodeling process of the uterine spiral arteries.
Smart Images

Figure CN119753125B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of clinical medicine, and particularly relates to application of DHRS4 as a biomarker in diagnosis of preeclampsia. BACKGROUND
[0002] Preeclampsia (PE) is a serious complication during pregnancy, mainly manifested as new-onset hypertension after 20 weeks of gestation accompanied by proteinuria or edema, etc. Severe PE can be secondary to hemolysis, elevated liver enzymes, and thrombocytopenia, etc., and even lead to damage to multiple systems and organs of the body, seriously affecting the health of mothers and children. At the same time, the risk of major chronic diseases in the future of PE patients and their children is also significantly increased. According to statistics, the global incidence of PE reaches 5% to 10%, and about 630,000 pregnant women die of PE every year, of which about 10% to 15% are in China (Kong Beihua, Duan Tao. Obstetrics and Gynecology (10th edition) [M]. People's Medical Publishing House, 2024.; Gestational Hypertension and Preeclampsia: ACOG Practice Bulletin, Number 222 [J]. Obstet Gynecol, 2020, 135(6):e237-e60). At present, PE still lacks effective clinical treatment methods, and termination of pregnancy in advance is often the only effective means. Therefore, it is of great significance to actively carry out research on the pathogenesis of PE and seek more effective diagnosis and treatment methods.
[0003] The function and mechanism of DHRS4 in the occurrence of PE have not been reported, so the application provides new theoretical support for understanding the pathogenesis of PE, and may be a potential target for clinical prediction, diagnosis and treatment of PE. SUMMARY
[0004] To solve the above problems, the application discloses application of DHRS4 as a biomarker in diagnosis of preeclampsia. DHRS4 binds and up-regulates expression of LONP2, ubiquitinates and degrades TFAM protein, causes mitochondrial dysfunction, reduces oxidative phosphorylation, thereby promotes increase in apoptosis of EVTs, decrease in invasion ability, affects remodeling process of uterine spiral arteries, and further causes occurrence and development of PE.
[0005] To achieve the above purpose, the technical scheme of the application is as follows:
[0006] The application provides application of a reagent for detecting expression level of DHRS4 in preparation of a preeclampsia diagnosis kit, wherein the sequence of DHRS4 is shown as SEQ ID NO. 1.
[0007] Further, the reagent for detecting DHRS4 includes a primer pair for specifically detecting expression of DHRS4.
[0008] Further, the sequence of the upstream primer of the primer pair is shown as SEQ ID NO. 2, and the sequence of the downstream primer of the primer pair is shown as SEQ ID NO. 3.
[0009] Further, DHRS4 is highly expressed in patients with preeclampsia.
[0010] The application also provides a use of a DHRS4 low-expression reagent in the preparation of a drug for treating preeclampsia, and the sequence of the DHRS4 is shown as SEQ ID NO. 1.
[0011] Further, the low-expression reagent includes shDHRS4-1#, shDHRS4-2# and shDHRS4-3#, the sequence of the shDHRS4-1# is shown as SEQ ID NO. 4 and SEQ ID NO. 5, the sequence of the shDHRS4-2# is shown as SEQ ID NO. 6 and SEQ ID NO. 7, and the sequence of the shDHRS4-3# is shown as SEQ ID NO. 8 and SEQ ID NO. 9.
[0012] SEQ ID NO. 8
[0013] 5'-3' CCGGGGCTTGGAATTCGGTGCGGATCTCGAGATCCGCACCGAATTCCAAGCCT TTTTG;
[0014] SEQ ID NO. 9
[0015] 5'-3' AATTCAAAAAGGCTTGGAATTCGGTGCGGATCTCGAGATCCGCACCGAATTCC AAGCC.
[0016] The application also provides a kit for diagnosing preeclampsia, and the kit includes the primer pair described above.
[0017] The application also provides a drug for treating preeclampsia, and the drug includes a DHRS4 low-expression reagent, and the sequence of the DHRS4 is shown as SEQ ID NO. 1.
[0018] The application has the following beneficial effects:
[0019] The application first discovers that DHRS4 is significantly highly expressed in PE placental tissue, and DHRS4 can be used as a biological marker for diagnosing and treating preeclampsia.
[0020] The application further verifies that changes in mitochondrial structure and function are related to mtDNA abnormalities, and the ratio of mtDNA / nDNA is calculated through an RT-qPCR experiment, and the results show that high expression of DHRS4 may affect abnormal mtDNA synthesis, leading to mitochondrial morphological structure disorder and functional abnormalities.
[0021] The application finds that DHRS4 combines and up-regulates the expression of LONP2, thereby accelerating the degradation of TFAM, affecting the biological function of mitochondria, and participating in the regulation and control of preeclampsia occurrence and development.
[0022] The application discloses a new regulatory network mediated by DHRS4, which is an important determinant of the pathogenesis of PE, helps the prediction and diagnosis of preeclampsia, deeply understands the mechanism of embryo implantation, and provides a new theoretical basis for the treatment of preeclampsia with DHRS4 as a target in clinic. BRIEF DESCRIPTION OF DRAWINGS
[0023] Figure 1 DHRS4 gene is screened for PE placenta and normal placenta tissue mass spectrum analysis;
[0024] Among them, (A) is a cluster analysis heat map of proteins differentially expressed by 1.5 times or more in the placental tissue of PE patients compared with the placental tissue of normal pregnant women; (B) is a sample Venn diagram between the PE group and the normal pregnant women placental tissue group; (C) is a volcano plot drawn according to the protein expression difference fold change (Fold change) and p value (T-test) two factors, wherein the significantly down-regulated proteins are marked in green (FC<0.63 and p<0.05), the significantly up-regulated proteins are marked in red (FC>1.5 and p<0.05), and the proteins without difference are black;
[0025] Figure 2 DHRS4 is significantly highly expressed in PE placental tissue;
[0026] (A) RT-qPCR detects the expression level of DHRS4 mRNA in normal placental tissue (n=50) and PE placental tissue (n=50); (B) Western blotting experiment detects the expression amount of DHRS4 protein in 6 pairs of normal placenta and PE placenta tissue; (C) H&E staining analysis of the structure changes of PE placental tissue and normal placental tissue; (D) Immunohistochemistry (Immunohistochemistry, IHC) experiment detects the distribution and expression amount of DHRS4 protein in normal placenta and PE placenta; (E) Immunofluorescence (Immunofluorescence, IF) experiment detects the fluorescence intensity of DHRS4 protein in normal placenta and PE placenta; the above experiments are repeated three times; * P<0.05, **P<0.01);
[0027] Figure 3 DHRS4 overexpression inhibited the proliferation, migration and invasion of trophoblast HTR-8 / SVneo and BeWo cells, and increased the proportion of apoptosis;
[0028] (A) After overexpression of DHRS4 in trophoblast cell lines HTR-8 / SVneo and BeWo, the change of proliferation ability of trophoblast cells after overexpression of DHRS4 was explored by EDU experiment. Scale bar: 50 μm; (B) MTT experiment was used to detect the change of proliferation ability of HTR-8 / SVneo and BeWo cells after overexpression of DHRS4; (C) Transwell experiment was used to detect the change of invasion and migration ability of trophoblast cell lines HTR-8 / SVneo and BeWo after overexpression of DHRS4; Scale bar: 100 μm; (D) Vessel formation experiment was used to detect the change of vessel formation ability of trophoblast cell lines after overexpression of DHRS4; The above experiments were repeated three times; (E) Flow cytometry was used to detect the proportion of apoptosis of HTR-8 / SVneo and BeWo cells after overexpression of DHRS4; The above experiments were repeated three times; * P<0.05, ** P<0.01);
[0029] Figure 4 RNA-seq result analysis after overexpression of DHRS4;
[0030] (A) Heat map analysis of differentially expressed gene profiles in control and DHRS4 overexpression treated HTR-8 / SVneo trophoblast cells; (B) Heat map (right) analysis of differentially expressed gene profiles in control and DHRS4 knockdown treated HTR-8 / SVneo trophoblast cells; (C) GO analysis of biological processes in which differentially expressed genes in DHRS4 overexpression treated HTR-8 / SVneo trophoblast cell lines are involved; (D) GO analysis of biological processes in which differentially expressed genes in DHRS4 knockdown treated HTR-8 / SVneo trophoblast cell lines are involved; (E) KEGG functional enrichment analysis of signal pathways in which differentially expressed genes in DHRS4 overexpression treated HTR-8 / SVneo trophoblast cell lines are involved; (F) KEGG functional enrichment analysis of signal pathways in which differentially expressed genes in DHRS4 knockdown treated HTR-8 / SVneo trophoblast cell lines are involved; * P<0.05, ** P<0.01);
[0031] Figure 5 DHRS4 affects the related phenotype experiment of mitochondrial morphology;
[0032] Wherein, (A) the change of mtDNA / nDNA ratio in HTR-8 / SVneo cells after overexpression of DHRS4 was verified by mitochondrial separation experiment and RT-qPCR experiment; (B) the change of mtDNA / nDNA ratio in HTR-8 / SVneo cells after knockdown of DHRS4 was verified by mitochondrial separation experiment and RT-qPCR experiment; (C) the changes of mitochondrial morphology and fluorescence intensity in HTR-8 / SVneo after overexpression of DHRS4 and the quantification graph under confocal microscope; scale bar: 20 μm; (C) the changes of mitochondrial morphology and fluorescence intensity in HTR-8 / SVneo after overexpression of DHRS4 and the quantification graph under confocal microscope; scale bar: 20 μm; (D) the changes of mitochondrial morphology and fluorescence intensity in BeWo after overexpression of DHRS4 and the quantification graph under confocal microscope; scale bar: 20 μm; the above experiments were repeated three times; * P<0.05, ** P<0.01);
[0033] Figure 6 DHRS4 affects mitochondrial mass and oxidative phosphorylation;
[0034] Wherein, (A) the mitochondrial fluorescence intensity of HTR-8 / SVneo trophoblast cell line after overexpression of DHRS4 was verified by flow cytometry analysis experiment; (B) OCR experiment: the OCR of HTR-8 / SVneo trophoblast cells after transfection of Vector and OE-DHRS4 overexpression plasmid respectively and the comparison of basal respiration, maximum oxygen consumption, proton leakage and ATP synthesis between the two groups were quantified; (C) OCR experiment: the OCR of BeWo trophoblast cells after transfection of Vector and OE-DHRS4 overexpression plasmid respectively and the comparison of basal respiration, maximum oxygen consumption, proton leakage and ATP synthesis between the two groups were quantified; (D) the change of OCR in HTR-8 / SVneo trophoblast cells after knockdown of DHRS4 and quantitative analysis; (E) the change of OCR in BeWo trophoblast cells after knockdown of DHRS4 and quantitative analysis; the above experiments were repeated three times; * P<0.05, ** P<0.01);
[0035] Figure 7 DHRS4 overexpression can down-regulate the expression of TFAM;
[0036] Among them, (A) RT-qPCR experiment detected the changes in mRNA expression of five mitochondrial-related genes after overexpression of DHRS4 in HTR-8 / SVneo (left) and BeWo (right) trophoblast cell lines; (B) RT-qPCR experiment verified the expression of TFAM after overexpression of DHRS4 in HTR-8 / SVneo trophoblast cells; (C) Western blotting experiment verified the expression of TFAM after overexpression of DHRS4 in HTR-8 / SVneo trophoblast cells; (D) Western blotting experiment analyzed the expression of TFAM after overexpression of DHRS4 in BeWo trophoblast cells; (E) RT-qPCR experiment verified the expression of TFAM after overexpression of DHRS4 in BeWo trophoblast cells; (F) RT-qPCR experiment verified the expression of TFAM after knockdown of DHRS4 in HTR-8 / SVneo trophoblast cells; (G) Western blotting experiment verified the expression of TFAM after knockdown of DHRS4 in HTR-8 / SVneo trophoblast cells; (H) Blending experiments were used to verify the expression of TFAM after DHRS4 knockdown in HTR-8 / SVneo feeder cells; (H) RT-qPCR experiments were used to verify the expression of TFAM after DHRS4 knockdown in BeWo feeder cells; (I) Western blotting experiments were used to analyze the expression of TFAM after DHRS4 knockdown in BeWo feeder cells. All experiments were repeated three times; *P<0.05, **P<0.01).
[0037] Figure 8 DHRS4 can bind to the LONP2 protein;
[0038] Among them, (A) GO functional enrichment analysis and mass spectrometry analysis after Co-IP experiment showed the biological processes involved by proteins that may bind to DHRS4; (B) KEGG functional enrichment analysis and mass spectrometry analysis after Co-IP experiment showed the signaling pathways involved by proteins that may bind to DHRS4; (C) PPI diagram showed the protein-protein interactions after Co-IP experiment; (d) Co-IP experiment verified the relationship between DHRS4 and LONP; (D) PLA experiment verified the interaction between DHRS4 and LONP2 in feeder cells. Scale bar: 20 μm. All experiments were repeated three times; *P<0.05, **P<0.01);
[0039] Figure 9 Overexpression of DHRS4 can upregulate the expression of LONP2;
[0040] (A) RT-qPCR experiment to verify the expression of LONP2 after overexpression of DHRS4 in HTR-8 / SVneo trophoblast cells; (B) Western blotting experiment to verify the expression of LONP2 after overexpression of DHRS4 in HTR-8 / SVneo trophoblast cells; (C) RT-qPCR experiment to verify the expression of LONP2 after overexpression of DHRS4 in BeWo trophoblast cells; (D) Western blotting experiment to verify the expression of LONP2 after overexpression of DHRS4 in HTR-8 / SVneo trophoblast cells; (E) Western blotting experiment to verify the expression of LONP2 after knockdown of DHRS4 in HTR-8 / SVneo trophoblast cells; (F) RT-qPCR experiment to verify the expression of LONP2 after knockdown of DHRS4 in HTR-8 / SVneo trophoblast cells; (G) RT-qPCR experiment to verify the expression of LONP2 after knockdown of DHRS4 in HTR-8 / SVneo trophoblast cells; (H) Western blotting experiment to verify the expression of LONP2 after knockdown of DHRS4 in HTR-8 / SVneo trophoblast cells. The above experiments were repeated three times; * P < 0.05, ** P < 0.01);
[0041] Figure 10 RNA-seq analysis and ubiquitination experiment after knockdown of LONP2;
[0042] Among them, (A) GO analysis was used to analyze the biological processes involved by differentially expressed genes in HTR-8 / SVneo feeder cells treated with LONP2 knockdown; (B) KEGG functional enrichment analysis and PPI mapping were used to analyze the signaling pathways involved by differentially expressed genes in HTR-8 / SVneo feeder cells treated with LONP2 knockdown; (C) RT-qPCR experiments were used to verify the expression of TFAM after LONP2 overexpression in HTR-8 / SVneo feeder cells; (D) Western blotting experiments were used to verify the expression of TFAM after LONP2 overexpression in HTR-8 / SVneo feeder cells; (E) RT-qPCR experiments were used to verify the expression of TFAM after LONP2 overexpression in BeWo feeder cells; (D) Western blotting experiments were used to verify the expression of TFAM after LONP2 overexpression in BeWo feeder cells; (G) Western blotting experiment to verify the expression of TFAM after LONP2 overexpression in BeWo trophoblast cells; (H) RT-qPCR experiment to verify the expression of TFAM after LONP2 knockdown in HTR-8 / SVneo trophoblast cells; (I) RT-qPCR experiment to verify the expression of TFAM after LONP2 knockdown in BeWo trophoblast cells; (J) Western blotting experiment to verify the expression of TFAM after LONP2 knockdown in BeWo trophoblast cells; (K) CHX experiment to verify the changes in TFAM expression over time in the control group and the LONP2 overexpression group after the addition of CHX; (L) MG132 experiment to verify the difference in TFAM expression between the control group and the LONP2 overexpression group after the addition of MG132 protease inhibitor. All experiments were repeated three times. * P<0.05, ** P<0.01);
[0043] Figure 11 To validate the DHRS4 pathway in L-NAME animals in vivo;
[0044] (A) L-NAME induced PE model of pregnant rats, and the timeline of injection of drugs and sampling; (B) Changes in blood pressure (systolic and diastolic blood pressure) of pregnant rats in the control group and the L-NAME group during pregnancy; (C) Placenta and fetal weight quantification chart of the control group and the L-NAME induced PE group of pregnant rats (left); Placenta and fetal weight quantification chart of the control group and the L-NAME induced PE group of pregnant rats (right); (D) Western blotting experiment to verify the expression difference of DHRS4 and its downstream LONP2 and TFAM in the placental tissues of the control group and the L-NAME induced PE group of pregnant rats and the quantification chart; (E) H&E staining of the placenta of the normal rat group and the L-NAME group; scale, 100 μm (left), 50 μm (right); (F & I) DHRS4 and TFAM immunohistochemistry and quantification chart (I) of the placenta of the normal rat group and the L-NAME group; scale, 100 μm (left), 50 μm (right); (G-H & J) DHRS4 and TFAM immunofluorescence and quantification chart (J) of the placenta of the normal rat group and the L-NAME group; scale, 100 μm (left), 50 μm (right); all the above experiments were repeated three times; * P<0.05, ** P<0.01);
[0045] Figure 12 To verify the DHRS4 pathway in the overexpression DHRS4 gene group of mice in vivo experiment;
[0046] (A) Mode chart of Cas9 construction of placenta specific overexpression DHRS4 gene mice; (B) Changes in blood pressure (systolic and diastolic blood pressure) of pregnant rats in the control group and the overexpression DHRS4 gene group during pregnancy; (C-D) Placenta and fetal weight quantification chart of the control group and the overexpression DHRS4 gene group; (E) H&E staining of the placenta of the control group and the overexpression DHRS4 gene group; scale, 100 μm (left), 50 μm (right); (F-G) DHRS4 and TFAM immunohistochemistry and quantification chart of the placenta of the control group and the overexpression DHRS4 gene group; scale, 100 μm (left), 50 μm (right); (H) Western blotting experiment to verify the expression difference of DHRS4 and its downstream LONP2 and TFAM in the placental tissues of the control group and the overexpression DHRS4 gene group of pregnant rats and the quantification chart; all the above experiments were repeated three times; * P<0.05, ** P<0.01);
[0047] Figure 13 Schematic diagram of DHRS4-LONP2-TFAM regulatory axis;
[0048] The present application is further illustrated by the following drawings and detailed description, it should be understood that the following detailed description is only used to illustrate the present application and is not used to limit the scope of the present application.
[0049] Example 1
[0050] Detecting the RNA expression level of DHRS4 in placental tissue
[0051] Methods
[0052] Sample collection
[0053] Placental tissues of 50 pairs of normal pregnant women and preeclampsia pregnant women who delivered by cesarean section in Nanjing Medical University Affiliated Hospital of Obstetrics and Gynecology from January 2021 to December 2021 were collected. The placental tissue sample was taken from the maternal side of the umbilical cord attachment site, avoiding placental calcified infarction, and the size was 1x1x1cm, which was stored in liquid nitrogen for extraction of tissue RNA and tissue protein. This study has obtained the approval of the Ethics Committee of Nanjing Medical University Affiliated Hospital of Obstetrics and Gynecology, and all patients have signed the written informed consent form.
[0054] LC-MS / MS proteomics technology
[0055] Proteins were extracted from placental tissues of PE patients and normal pregnant women, and trypsin was used to decompose the proteins into peptide segments. The peptide segments were separated by liquid chromatography column according to their physical and chemical properties, and the separated peptide segments were sent to mass spectrometer for separation and detection according to mass and charge ratio (m / z) after ionization. Software tools were used to analyze mass spectrometry data, identify peptide segments and corresponding proteins, and perform relative or absolute quantification.
[0056] Extraction of tissue (cell) RNA and RT-qPCR
[0057] Trizol reagent (Invitrogen) was used to separate total RNA from tissues and cultured cells, and anoDrop2000c (Fisher Scientific, Waltham, Massachusetts, USA) was used to evaluate its quality and quantity. RNA was reverse transcribed into cDNA by HIScriptIII All-in-one RT SuperMix kit (Vazyme). Then Taq Prouniversal SYBR qPCR master mix kit (Vazyme) and specific DHRS4 primers were used for quantitative PCR, the upstream primer sequence of the DHRS4 primer pair is shown in SEQ ID NO. 2, and the downstream primer of the DHRS4 primer pair is shown in SEQ ID NO. 3.
[0058] SEQ ID NO. 2
[0059] 5'-3' CGTGTGGTCAAAGTGTGGTC;
[0060] SEQ ID NO. 3
[0061] 5'-3' TCTCTGTTCAGGTCCGTTCC.
[0062] Western Blotting experiment
[0063] HTR-8 / SVneo, BeWo cells after transfection in 6-well plates were harvested. Then, total protein was extracted using RIPA protein extraction reagent (MCE, USA) and protease inhibitor (MCE, USA). The proteins were separated by 10% SDS-PAGE and transferred to 0.22 μm PVDF membrane (Sigma). The PVDF membrane was blocked in 5% skim milk and then placed in a 4°C shaker, immersed in diluted DHRS4 primary antibody (dilution ratio: 1:1000, Proteintech, China). The next day, after TBST washing, secondary antibody incubation (dilution ratio: 1:10000, Proteintech, China), images were collected and processed by FusionCapt Advance Fx5 software (Vilber Lourmat). All experiments were repeated independently three times.
[0064] Statistical analysis
[0065] Normally distributed data are shown as x ± SEM and compared by two-tailed Student's t test using GraphPad Prism 7.0 (www.GraphPad.com). The number of independent experiments is indicated in the figure legends. A p value less than 0.05 was considered statistically significant (*p < 0.05 and **p < 0.01; ns, not statistically significant).
[0066] Results
[0067] DHRS4 was significantly highly expressed in PE placental tissue as shown in Figure 1 and Figure 2 .
[0068] The present application uses LC-MS / MS proteomics technology to analyze 8 pairs of PE patient placental tissues and normal pregnant woman placental tissues, and finds that DRSH4 is significantly highly expressed in PE patient placental tissues. A total of 3756 proteins are detected, of which 3407 proteins are common to PE and normal placental tissues, 82 proteins have a difference of more than 1.5 times (p value < 0.05), of which 28 proteins are up-regulated in PE placenta, and 54 proteins are down-regulated in PE placenta Figure 1A-C). The present application further detected the expression level of DHRS4 mRNA in 50 pairs of placental tissues of normal group and PE group by RT-qPCR experiment, and the experimental results showed that the expression level of DHRS4 mRNA in PE placental tissues was significantly increased Figure 2 A). Western blotting experiment also confirmed that the expression level of DHRS4 protein in placental tissues of PE patients was also significantly higher than that of normal group Figure 2 B). In addition, the H&E staining results of placental tissues confirmed that the placental villi in PE group had fibrous necrosis of the blood vessel wall, thickening of the villi vessel wall, and poor development of the distal villi Figure 2 C). Further, by using IHC and IF experiments, the present application found that the expression level of DHRS4 in PE placental tissues was significantly increased Figure 2 D-E).
[0069] Example 2
[0070] Effect of DHRS4 on the proliferation, migration and invasion of trophoblast HTR-8 / SVneo
[0071] Methods
[0072] Cell culture and transfection
[0073] The trophoblast cell lines were cultured in a 90% humidity, 37°C and 5% CO2 incubator, and four human trophoblast cell lines (HTR-8 / SVneo, JAR, JEG3 and BeWo) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). HTR-8 / SVneo cells were cultured in DMEM (Gibco, USA) medium containing 10% FBS, JAR cells were cultured in RPMI 1640 (Gibco, USA) medium containing 10% FBS, JEG3 cells were cultured in MEM (Gibco, USA) medium containing 10% FBS, and BeWo cells were cultured in F12k (Gibco, USA) medium containing 20% FBS, and 100 U / ml penicillin and 100 mg / ml streptomycin were added to the above culture. The trophoblast cell lines HTR-8 / SVneo and BeWo cells were cultured in a 6-well plate until 80% confluence, and the DHRS4-flag high expression vector was constructed. The DHRS4-flag high expression vector was transfected into the trophoblast HTR-8 / SVneo cells, and the empty vector was used as a control. The sequence of DHRS4 is shown in SEQ ID NO. 1. RT-qPCR was used to verify the high expression level of DHRS4 mRNA, and the upstream primer sequence of the DHRS4 primer pair is shown in SEQ ID NO. 2, and the downstream primer of the DHRS4 primer pair is shown in SEQ ID NO. 3. Western Blotting experiment used DHRS4 polyclonal antibody (dilution ratio: 1:1000, Proteintech, China).
[0074] SEQ ID NO. 1
[0075] GCCACCATGCACAAGGCGGGGCTGCTAGGCCTCTGTGCCCGGGCTTGGAATTCGGTGCGGATGGCCAGCTCCGGGATGACCCGCCGGGACCCGCTCGCAAATAAGGTGGCCCTGGTAACGGCCTCCACCGACGGGATCGGCTTCGCCATCGCCCGGCGTTTGGCCCAGGACGGGGCCCATGTGGTCGTCAGCAGCCGGAAGCAGCAGAATGTGGACCAGGCGGTGGCCACGCTGCAGGGGGAGGGGCTGAGCGTGACGGGCACCGTGTGCCATGTGGGGAAGGCGGAGGACCGGGAGCGGCTGGTGGCCACGGCTGTGAAGCTTCATGGAGGTATCGATATCCTAGTCTCCAATGCTGCTGTCAACCCTTTCTTTGGAAGCATAATGGATGTCACTGAGGAGGTGTGGGACAAGACTCTGGACATTAATGTGAAGGCCCCAGCCCTGATGACAAAGGCAGTGGTGCCAGAAATGGAGAAACGAGGAGGCGGCTCAGTGGTGATCGTGTCTTCCATAGCAGCCTTCAGTCCATCTCCTGGCTTCAGTCCTTACAATGTCAGTAAAACAGCCTTGCTGGGCCTGACCAAGACCCTGGCCATAGAGCTGGCCCCAAGGAACATTAGGGTGAACTGCCTAGCACCTGGACTTATCAAGACTAGCTTCAGCAGGATGCTCTGGATGGACAAGGAAAAAGAGGAAAGCATGAAAGAAACCCTGCGGATAAGAAGGTTAGGCGAGCCAGAGGATTGTGCTGGCATCGTGTCTTTCCTGTGCTCTGAAGATGCCAGCTACATCACTGGGGAAACAGTGGTGGTGGGTGGAGGAACCCCGTCCCGCCTCGACTACAAGGACGACGATGACAAGTGA。
[0076] EDU experiment
[0077] 5-ethynyl-2-deoxyuridine labeling / detection kit (Ribobio, Guangzhou, China) was used for EdU detection to analyze the cell proliferation ability. HTR-8 / SVneo and BeWo cells were seeded into 24-well plates at (2-3) x 10 4
[0078] MTT assay
[0079] Experimental procedure:
[0080] After transfecting cells in 6-well plates for 24-48 h, resuspend with 0.25% trypsin (containing EDTA) (Gibco, USA), and adjust the cell density (3000-4000 cells / well) by cell counting. Then, 100 μl cell suspension was inoculated in 96-well plates, and multiple replicates were set up for each sample, with 5 replicates recommended. Four commonly used time periods were selected, including 0 h, 24 h, 48 h, and 72 h. MTT detection solution (90 μl of culture medium and 10 μl of MTT) was added and incubated for 4 h. Then, detection reagent was added to each well at the four time points, and incubated for 4 h. The detection reagent in the wells was carefully aspirated, and 100 μl of DMSO was added to terminate the reaction and dissolve the water-insoluble crystalline MTT in the cells. Subsequently, the 96-well plate was measured on a microplate reader at a specific wavelength (490 nm) to determine the absorbance value of each well.
[0081] Transwell assay
[0082] Transwell assay was used to analyze the cell migration and invasion ability. Chambers with a pore size of 8 μm were used, and 3 x 10 4
[0083] Flow cytometry analysis of the proportion of apoptotic cells
[0084] Take the right amount of logarithmic growth period cells inoculated in 6 well plate, 24-48h after transfection, using 0.25% trypsin (without EDTA) digestion and resuspended cells, collect the cell suspension to 1.5ml centrifuge tube, 1000g / min, centrifugal 5min. Carefully discard the supernatant; resuspended cells with 1ml PBS 2-3 times, placed in centrifuge 1000g / min, centrifugal 5min. After the residual PBS in the centrifuge tube is absorbed, the cells are resuspended with 200ul buffer after centrifugation, and the cell number is counted, which can reach 2x106 / pore; control group and experimental group use double staining, and the positive control group uses single staining. The double staining tube includes 5ul of each dye (Annexin V, 7-AAD), and one of the dyes is added to the tube alone in the single staining group, and the name of the dye added to the tube is marked. Lightly shake the tube contents and incubate in the dark for 15min. Prepare the flow cytometer and filter membrane during the incubation process. After the flow cytometer is turned on, check the sheath fluid and waste. After 15min of staining incubation, add 1mL of PBS and centrifuge at 2000rpm for 5min. Keep the cell pellet, resuspend the cells with PBS 100ul and filter with filter membrane. Open the corresponding channels in the flow cytometry software, including SSC, FSC, FITC and 7-ADD. Remove the unnecessary channels, run the instrument, record and analyze the data. DHRS4 high expression inhibits the proliferation, migration and invasion ability of trophoblast HTR-8 / SVneo and BeWo, and increases the apoptosis ratio as shown in Figure 3
[0085] Results
[0086] To explore the potential role of DHRS4 in regulating the biological function of extravillous trophoblasts, the present application constructs a high expression plasmid vector of DHRS4 in vitro. The present application uses EDU experiment to verify that the proliferation ability of HTR-8 / SVneo and BeWo trophoblast cell lines is significantly decreased after high expression of DHRS4 ( Figure 3 A). At the same time, the present application also uses MTT experiment to verify that the proliferation ability of HTR-8 / SVneo and BeWo trophoblast cell lines is significantly decreased after high expression of DHRS4 ( Figure 3 B). Through Transwell experiment, the present application finds that the invasion and migration ability of HTR-8 / SVneo trophoblast cell line with high expression of DHRS4 is significantly decreased ( Figure 3 C). In addition, the present application uses flow cytometry analysis to verify whether DHRS4 is involved in regulating apoptosis, and the results show that the proportion of HTR-8 / SVneo cell apoptosis (early apoptosis + late apoptosis) is significantly increased after high expression of DHRS4 ( Figure 3 E).
[0087] To further explore the change of DHRS4 in regulating the biological behavior of trophoblast cells, the present application uses the blood vessel formation experiment to verify that the blood vessel formation ability of HTR-8 / SVneo trophoblast cell line with high expression of DHRS4 is significantly down-regulated. Figure 3 D).
[0088] In combination with the above experimental results, the present application considers that high expression of DHRS4 significantly inhibits the proliferation, migration and invasion ability of trophoblast cell line HTR-8 / SVneo, and the apoptosis rate is increased.
[0089] Example 3
[0090] Verification of DHRS4 participating in the biological process of regulating mitochondrial function
[0091] Method
[0092] (1) The influence of high expression of DHRS4 on the mitochondrial function of trophoblast cells was observed under a confocal fluorescence microscope:
[0093] Trophoblast cells HTR-8 / SVneo were cultured on glass slides, and were transfected with plasmid Empty vector and pcDNA3.1(+)-DHRS4 respectively, and were dyed with MitoTracker Red CMXRos (100 nM, Invitrogen, USA) at 37℃ for 30 min. After dyeing, the cells were washed with preheated PBS for two times, and were fixed with preheated 4% paraformaldehyde for 15 min. After washing with PBS, nuclear staining was performed at room temperature for 10 min after adding DAPI, and a fluorescence image was acquired by using a Zeiss LSM 700 laser scanning confocal microscope (Zeiss, Germany). The excitation wavelength of MitoTracker Red CMXRos and DAPI was 579 nm and 405 nm respectively, and the image was collected and analyzed, and the sequence of DHRS4 is shown as SEQ ID NO. 1.
[0094] (2) The mitochondrial respiratory rate was detected to evaluate the energy metabolism state of cells
[0095] After high expression of DHRS4 or knockdown of DHRS4 in trophoblast HTR-8 / SVneo, Seahorse XFp Cell Energy Metabolic Analysis System (Seahorse Bioscience, Billerica, MA, USA) was used to determine OCR and ECAR by mitochondrial stress test, respectively using Glycolysis Stress Test Kit and Mito Stress Test Kit; 200 μL sterile calibrant (Catalog: 100840-000) was used in each well of the XFe96 sensor cartridge (Catalog: 102416-100) to hydrate the XFe96 sensor cartridge. The assembled sensor cartridge and the common plate were placed in a 37°C CO2-free incubator overnight. The treated cells were seeded into the XFe96 cell culture microplate (Catalog: 101085-004) at a density of 10,000 cells / well (for OCR measurement), and the cell culture medium was replaced with Seahorse XF DMEM medium containing 10 mM glucose, 2 mM glutamine, 1 mM pyruvate overnight, and placed in a 37°C CO2-free incubator for 1 hour. Finally, the baseline OCR was determined, and then three compounds that affect cellular bioenergetic processes were injected in sequence: 20 μL oligomycin (1 μM) was added to port A, 22 μL FCCP (1 μM) was added to port B, and 25 μL Rotenone / Antimycin A (0.5 μM) was obtained in port C; similarly, ECAR measurement: glucose was added to port A, oligomycin was added to port B, and 2-DG was added to port C; OCR and ECAR were measured in Seahorse Bioscience XF96 Extracellular Flux Analyzer (Agilent Technologies). The overexpression DHRS4 reagent used for transfection of cells, the sequence of DHRS4 is shown as SEQ ID NO. 1; the sequence of shDHRS4-1# is shown as SEQ ID NO. 4, SEQ ID NO. 5; the sequence of shDHRS4-2# is shown as SEQ ID NO. 6, SEQ ID NO. 7.
[0096] SEQ ID NO. 4
[0097] 5'-3' CCGGGCCCGGGCTTGGAATTCGGTGCTCGAGCACCGAATTCCAAGCCCGGGCT TTTTG;
[0098] SEQ ID NO. 5
[0099] 5'-3' AATTCAAAAAGCCCGGGCTTGGAATTCGGTGCTCGAGCACCGAATTCCAAGCC CGGGC;
[0100] SEQ ID NO. 6
[0101] 5'-3' CCGGGCCTCTGTGCCCGGGCTTGGACTCGAGTCCAAGCCCGGGCACAGAGGC TTTTTG;
[0102] SEQ ID NO. 7
[0103] 5'-3' AATTCAAAAAGCCTCTGTGCCCGGGCTTGGACTCGAGTCCAAGCCCGGGCAC AGAGGC.
[0104] (3) qPCR detection of mtDNA / nDNA ratio after mitochondrial isolation experiment
[0105] After the cells were broken by a grinder, the cell nuclei and mitochondria were separated by a mitochondrial isolation and protein extraction kit (Proteintech, PK10016). After the cell nuclei and mitochondria were lysed by a cell nucleus lysis solution and a mitochondrial lysis solution, the nuclear DNA and mitochondrial DNA were extracted by a DNA extraction box, and then qPCR quantification and comparison were performed. The qPCR used tRNA Leu and β2M primer pairs. The tRNA Leu primer sequences are shown in SEQ ID NO. 10 and SEQ ID NO. 11; and the β2M primer sequences are shown in SEQ ID NO. 12 and SEQ ID NO. 13. The RNA-seq result analysis after overexpression of DHRS4 is shown in Figure 4 , the related phenotype experiment result of DHRS4 affecting mitochondrial morphology is shown in Figure 5 , and the DHRS4 affecting mitochondrial mass and oxidative phosphorylation is shown in Figure 6 .
[0106] SEQ ID NO. 10
[0107] 5'-3' CACCCAAGAACAGGGTTTGT;
[0108] SEQ ID NO. 11
[0109] 5'-3' TGGCCATGGGTATGTTGTTA;
[0110] SEQ ID NO. 12
[0111] 5'-3' TGCTGTCTCCATGTTTGATGTATCT;
[0112] SEQ ID NO. 13
[0113] 5'-3' TCTCTGCTCCCCACCTCTAAGT.
[0114] Results
[0115] The present application screens the differential expression profile of DHRS4 downstream genes by using transcriptome sequencing technology (RNA sequencing, RNA-seq). The RNA-seq result analysis finds the change of mRNA abundance of downstream genes after overexpression or knockdown of DHRS4 (<2 folds) Figure 4 A-B). The expression profile is subjected to GO Figure 4 C-D) and KEGG functional enrichment analysis Figure 4 E-F), and the result finds that the down-regulated genes caused by overexpression of DHRS4 are associated with ATP production, oxidative phosphorylation and hydrogen peroxide (H2O2) production. Therefore, the present application infers that DHRS4 can affect the biological function of EVT by regulating mitochondrial function.
[0116] Subsequently, the present application verifies that the change of mitochondrial structure and function is related to mtDNA abnormality, extracts mtDNA and nDNA by using mitochondrial separation experiment, and calculates the ratio of mtDNA / nDNA by RT-qPCR experiment, and the result finds that the ratio of mtDNA / nDNA is down-regulated after overexpression of DHRS4, while the ratio of mtDNA / nDNA is up-regulated after knockdown of DHRS4, indicating that overexpression of DHRS4 causes the blockage of mtDNA synthesis and replication Figure 5 A-B). Secondly, the present application finds that the mitochondrial fluorescence intensity under confocal microscope is reduced and the morphology is broken into dots after overexpression of DHRS4 in the trophoblast cell line HTR-8 / SVneo by using Mito-Tracker Red CMXRos mitochondrial staining Figure 5 C-D). Further considering that MitoTracker Green FM is located in mitochondria but is not affected by the membrane potential of mitochondria, it can be used for quantification and comparison of mitochondrial mass, and the result verifies that the mitochondrial mass is significantly down-regulated after overexpression of DHRS4 by using flow cytometry to analyze the fluorescence intensity of mitochondria after overexpression of DHRS4 Figure 6 A).
[0117] The present application carries out Seahorse XF experiment, i.e. mitochondrial oxygen consumption rate test (OCR), in HTR-8 / SVneo trophoblast cell line after high expression of DHRS4, and the results show that high expression of DHRS4 in HTR-8 / SVneo will significantly reduce the mitochondrial oxygen consumption rate in BeWo cells, wherein the basal respiration, maximal respiration, proton leak and ATP production in the cells with high expression of DHRS4 are significantly lower than those in the control group Figure 6 B-C). And after knocking down DHRS4, the oxygen consumption rate of the trophoblast cell line significantly increases, i.e. the basal respiration, maximal respiration, proton leak and ATP production are significantly higher than those in the control group Figure 6 D-E).
[0118] Example 4
[0119] Verification of DHRS4 / LONP2-TFAM pathway in L-NAME-induced PE rat placental tissue experiment
[0120] Methods
[0121] Extraction of tissue (cell) RNA and RT-qPCR
[0122] Total RNA was isolated from cells transfected with DHRS4 overexpression vector, shDHRS4-1,2# lentivirus reagent, LONP2 overexpression vector and shLONP2-1,2# lentivirus reagent, respectively, using Trizol reagent (Invitrogen), and its quality and quantity were evaluated by anoDrop2000c (Fisher Scientific, Waltham, Massachusetts, USA). RNA was reverse transcribed into cDNA by HIScript III All-in-one RT SuperMix kit (Vazyme). Then quantitative PCR was performed using TaqPro universal SYBR qPCR master mix kit (Vazyme) and specific DHRS4, LONP2 and TFAM primers. The DHRS4 overexpression vector used for transfection has the sequence shown in SEQ ID NO. 1. The shDHRS4-1,2# reagent used for transfection has the sequence shown in SEQ ID NO. 4, SEQ ID NO. 5 for shDHRS4-1#; and the sequence shown in SEQ ID NO. 6, SEQ ID NO. 7 for shDHRS4-2#. The LONP2 overexpression vector used for transfection has the sequence shown in SEQ ID NO. 14. The shLONP2-1,2# reagent used for transfection has the sequence shown in SEQ ID NO. 15, SEQ ID NO. 16 for shLONP2-1#; and the sequence shown in SEQ ID NO. 17, SEQ ID NO. 18 for shLONP2-2#. The specific DHRS4, LONP2 and TFAM primer sequences used in the RT-qPCR experiment have the sequence shown in SEQ ID NO. 2 for the upstream primer of the DHRS4 primer pair; and the sequence shown in SEQ ID NO. 3 for the downstream primer of the DHRS4 primer pair. The sequence shown in SEQ ID NO. 19 for the upstream primer of the LONP2 primer pair; and the sequence shown in SEQ ID NO. 20 for the downstream primer of the LONP2 primer pair. The sequence shown in SEQ ID NO. 21 for the upstream primer of the TFAM primer pair; and the sequence shown in SEQ ID NO. 22 for the downstream primer of the TFAM primer pair.
[0123] SEQ ID NO. 14
[0124]
[0125] SEQ ID NO. 15
[0126] 5'-3'CCGGGCCAGGAGTAGCAATAGGTTTCTCGAGAAACCTATTGCTACTCCTGGCTTTTTG
[0127] SEQ ID NO. 16
[0128] 5'-3'AATTCAAAAAGCCAGGAGTAGCAATAGGTTTCTCGAGAAACCTATTGCTACTCCTGGC
[0129] SEQ ID NO. 17
[0130] 5'-3'CCGGCCTCAGTCAATGCCAGAATATCTCGAGATATTCTGGCATTGACTGAGGTTTTTG
[0131] SEQ ID NO. 18
[0132] 5'-3'AATTCAAAAACCTCAGTCAATGCCAGAATATCTCGAGATATTCTGGCATTGACTGAGG
[0133] SEQ ID NO. 19
[0134] 5'-3'GTCTTGTTCTTCCAGTGGG
[0135] SEQ ID NO. 20
[0136] 5'-3'GAGGAATAATGACTTGCTTCAG
[0137] SEQ ID NO. 21
[0138] 5'-3'GCCCTAAGTCCCTGTGTCAT
[0139] SEQ ID NO. 22
[0140] 5'-3'TGCATTTGTCCCGAGATGTT
[0141] MG132 ubiquitination experiment
[0142] Experimental preparation: Vector and LONP2 overexpression vectors were transfected into HTR-8 / SVneo trophoblast cells using lipo2000. After 24 hours of transfection, 20 μM of MG132 was added and incubated for 4 hours. Then, pre-cooled cell lysis solution (containing PMSF and phosphatase inhibitors) was added. After lysis on ice for 30 minutes, centrifugation was performed at 12000 r / min for 20 min at 4°C. The supernatant protein was extracted. Western blotting experiment was then performed for verification.
[0143] CHX ubiquitination experiment
[0144] Experimental preparation: Vector and LONP2 overexpression vectors were transfected into HTR-8 / SVneo trophoblast cells using lipo2000. After 24 hours of transfection, cells were treated with CHX at a concentration of 20 μg / ml or 50 μg / ml for 0, 4, 12, and 24 hours. Then, pre-cooled cell lysis solution (containing PMSF and phosphatase inhibitors) was added. After lysis on ice for 30 minutes, centrifugation was performed at 12000 r / min for 20 min at 4°C. The supernatant protein was extracted. Western blotting experiment was then performed for verification. The LONP2 overexpression vector used for transfection has the sequence shown in SEQ ID NO. 14.
[0145] Western Blotting experiment
[0146] HTR-8 / SVneo and BeWo cells after transfection in 6-well plates were harvested. Then, RIPA protein extraction reagent (MCE, USA) and protease inhibitors (MCE, USA) were used to extract total cell protein. Protein was separated by 10% SDS-PAGE and transferred to 0.22 um PVDF membrane (Sigma). The PVDF membrane was blocked in 5% skim milk and then placed in a 4°C shaker, immersed in diluted primary antibody. The next day, after TBST washing, secondary antibody was incubated, and images were collected and processed by FusionCaptAdvance Fx5 software (Vilber Lourmat). All experiments were independently repeated three times. Western Blotting experiment used DHRS4 polyclonal antibody (dilution ratio: 1:1000, Proteintech, China), LONP2 polyclonal antibody (dilution ratio: 1:1000, Proteintech, China), and TFAM polyclonal antibody (dilution ratio: 1:2000, Proteintech, China).
[0147] Immunofluorescence experiment
[0148] Immunofluorescence assay was used to detect the expression of related proteins (DHRS4, LONP2 and TFAM): cells were seeded in 6-well plates at 1 x 10 6 cells per well, and coverslips were placed to allow cells to crawl. When the cells were 60% adherent, DHRS4 overexpression vector was transfected. After 24 hours of transfection, 2 ml of 4% paraformaldehyde was added to each well to fix the cells, and the cells were incubated on a rocking platform at room temperature for 30 min. The cells were washed with PBS for 5 min. 2 ml of blocking solution was added to each well and incubated on a rocking platform at room temperature for 30 min. Then 100 μl of primary antibody was added to each well and incubated at 4°C overnight. The cells were washed with PBS for 3 times / 5 min, and the secondary antibody was incubated for 1.5 h. After washing with PBS, 2 ml of DAPI was added to each well and incubated at room temperature for 10 min. Fluorescence quenching agent was added to the coverslips, and the coverslips in the six-well plate were taken out and placed on the coverslips. After staining, the samples were observed and photographed under a fluorescence microscope. DHRS4 polyclonal antibody (dilution ratio: 1:200, Proteintech, China), LONP2 polyclonal antibody (dilution ratio: 1:200, Proteintech, China) and TFAM polyclonal antibody (dilution ratio: 1:500, Proteintech, China) were used in the immunofluorescence assay.
[0149] Statistical analysis
[0150] Normally distributed data are shown as x ± SEM and compared by two-tailed Student's t test using GraphPad Prism 7.0 (www.GraphPad.com). The number of independent experiments is indicated in the figure legends. A p value less than 0.05 was considered statistically significant (*p < 0.05 and **p < 0.01; ns, not statistically significant).
[0151] Results
[0152] (1) High expression of DHRS4 can inhibit the expression of TFAM, and the results are shown in Figure 7
[0153] Based on the results of transcriptome sequencing and experiments, we screened mitochondria-related genes for further study. First, we detected the expression of mitochondria-related genes, including TFAM, PPAR-γ coactivator 1 alpha (PGC1a), optic atrophy 1 (OPA1), Mitochondrial Fission 1 (FIS1), and Nuclear Respiratory Factor 1 (NRF1), after overexpression of DHRS4 by RT-qPCR. The experimental results showed that the expression of TFAM was significantly down-regulated in HTR-8 / SVneo and BeWo cells with high expression of DHRS4 Figure 7 A). The expression of TFAM was significantly reduced after overexpression of DHRS4 in HTR-8 / SVneo and BeWo trophoblast cell lines by RT-qPCR and western blotting experiments Figure 7 B-E), and the expression of TFAM was significantly up-regulated after knockdown of DHRS4 in trophoblast cell lines HTR-8 / SVneo and BeWo Figure 7 F-I).
[0154] (2) DHRS4 inhibits the expression of TFAM by binding and up-regulating the expression of LONP2, as shown in Figure 8 and 9 .
[0155] According to the results of mass spectrometry analysis, GO and KEGG functional enrichment analysis found that the proteins combined with DHRS4 also participated in biological functions such as mitochondrial oxidative phosphorylation and ATP synthesis Figure 8 A-B). Subsequently, through PPI network analysis, the present application found that DHRS4 was closely combined with LONP2 Figure 8 C). LONP2 is a Lon protease (Lon), and LONP2 is an ATP-dependent protease that is mainly responsible for the degradation of abnormal proteins in cells to maintain protein expression in living organisms and is widely involved in activities such as apoptosis, cell differentiation, and DNA repair. The present application used Co-IP experiments and western blotting to verify the mutual combination of DHRS4 and LONP2 Figure 8 D), and the present application used PLA and IF experiments to verify the co-localization of DHRS4 and LONP2 in trophoblast cells Figure 8E). To further clarify the linear regulatory relationship between DHRS4 and LONP2, RT-qPCR and western blotting experiments were used to verify that high expression of DHRS4 in HTR-8 / SVneo and BeWo feeder cell lines significantly increased LONP2 expression. Figure 9 AD), and after knocking down DHRS4 in HTR-8 / SVneo trophoblast cells, LONP2 was significantly underexpressed. Figure 9 EH).
[0156] The results of RNA-seq analysis and ubiquitination experiments after knocking down LONP2 are as follows: Figure 10 As shown.
[0157] To investigate the regulatory relationship between LONP2 and TFAM, RNA sequencing (RNA-seq) was used to screen for differential expression profiles of downstream genes of LONP2. GO and KEGG functional enrichment analyses revealed a close relationship between LONP2 and autophagy and mitochondrial oxidative phosphorylation. Figure 10 AB). Therefore, RT-qPCR and Western blotting experiments were used to verify that the expression levels of LONP2 and TFAM, which are highly expressed in HTR-8 / SVneo feeder cell lines, were significantly reduced (Figure 1). Figure 10 CF), and knocking down LONP2 in the feeder cell line HTR-8 / VSneo significantly upregulated TFAM expression. Figure 10 GJ). Next, by adding MG132 and CHX, it was verified that LONP2 can inhibit the expression of TFAM protein through ubiquitination modification, thereby leading to a decrease in TFAM protein levels (GJ). Figure 10 KL).
[0158] (3) Validation of the DHRS4 / LONP2-TFAM pathway in L-NAME-induced PE rat placental tissue, the results are as follows: Figure 11 As shown.
[0159] This invention further constructs an L-NAME-induced PE rat model ( Figure 11 A). During pregnancy, this invention recorded the fluctuations in blood pressure (systolic and diastolic) in two groups of pregnant mice. The results showed that, compared to the control group, the blood pressure of the L-NAME group of pregnant mice gradually increased from 7.5 days after gestational age (GD). Figure 11 B), after termination of pregnancy at 18.5 days of gestation, this invention found that the fetal and placental weights of L-NAME-induced PE rats were significantly smaller than those of the control group ( Figure 11C). Western blotting experiments verified that L-NAME induced the expression of DHRS4 and LONP2 increased, while the expression of TFAM decreased in the placenta of PE rats Figure 11 D). In addition, the present application carried out H&E staining of rat placental tissue, and the results showed that L-NAME induced the placenta of pregnant rats with PE to have smaller villous blood vessel cavities, blood vessel blockage, villous edema and hyaline degeneration Figure 11 E). Further, IHC Figure 11 F&I) and immunofluorescence experiments Figure 11 G-H&J) verified that DHRS4 was significantly highly expressed in the placental tissue of L-NAME induced PE rats, while the expression of TFAM was down-regulated Figure 12 F-J).
[0160] Example 5
[0161] Methods
[0162] (1) CRISPR-Cas9 technology to construct a high expression DHRS4 constructed mouse model
[0163] Ensembl data shows that there are 8 transcripts of hDHRS4 gene, of which 6 transcripts have complete CCDS. This scheme selects DHRS4-201 (ENST00000313250.10) to make a model, and the CDS length is 837 nt, encoding 278 aa. H11 is located on mouse chromosome 11, which is a safe site for exogenous gene insertion. The exogenous gene integrated into this site can be stably and efficiently expressed, and at the same time will not damage the function of the endogenous gene. Combined with the use of Cre-loxP recombination system, it can be used to construct a multi-purpose conditional gene knock-in mouse model. The CAG-LSL-hDHRS4-3xFlag-PolyA gene fragment is inserted into the H11 site of the mouse by CRISPR-Cas9 technology. The brief process is as follows: construct the vector in vitro, microinject CRISPR-Cas9 and Donor vector into the zygote of C57BL / 6JGpt mouse to obtain F0 generation mice. The correct F0 generation positive mice are verified by PCR and sequencing, and the F1 generation positive mouse model which can be stably inherited is obtained by mating with C57BL / 6JGpt mice.
[0164] (2) Measure mouse blood pressure, detect urine protein, blood and placental mRNA and protein difference analysis
[0165] The blood pressure was measured by tail-cuff method using BP98A (Softron) according to the method established by the project team (Zou Y et al., Molecules, 2016). The mice were fixed in the mouse cage, and the tail of the mouse was fully exposed. After the heart rate and blood pressure were stable, the blood pressure of all groups was measured using a programmed electronic sphygmomanometer. The systolic and diastolic pressures were recorded at least five times and at most ten times, and the average value was used for further statistical analysis. The serum samples of the mice were prepared, and the concentrations of DHRS4, LONP2 and TFAM were measured using ELISA kits (R&D Systems). The urine of the mice was collected at 0.5 days, 4.5 days, 9 days, 13.5 days and 18.5 days of pregnancy, respectively, and stored at -80℃. The concentrations of urine albumin and creatinine were measured using a kit (Beyotime). The total protein in the placental tissue was extracted using an RNA extraction kit (Sigma), and the differences in the protein levels of DHRS4, LONP2 and TFAM in each group were detected and analyzed by Western Blotting experiment. The Western Blotting experiment used DHRS4 polyclonal antibody (dilution ratio: 1:1000, Proteintech, China), LONP2 polyclonal antibody (dilution ratio: 1:1000, Proteintech, China) and TFAM polyclonal antibody (dilution ratio: 1:2000, Proteintech, China).
[0166] (3) Placental pathological tissue section staining
[0167] After 18.5 days of pregnancy, the experimental mice were killed and the placental samples were obtained. The placental tissue was soaked in 10% neutral formaldehyde for fixation and stored at 4℃. After 24 h, paraffin embedding was performed for pathological section, and the pathological changes of the placental tissue were observed by HE staining. The verification results of the DHRS4 pathway in the overexpression DHRS4 gene group of mice in vivo experiment are shown in Figure 12
[0168] Results
[0169] The present application uses Cas9 technology to construct a placenta-specific high-expression DHRS4 pregnant mouse model (hDHRS4+ / -EIf5-Cre+ / -) Figure 12 A). During pregnancy, the blood pressure (systolic and diastolic pressure) fluctuations of the two groups of pregnant mice were recorded. The results showed that compared with the control group, the blood pressure of the gene mouse group showed a gradual upward trend after 7.5 days of pregnancy ( Figure 12 B), and the weight of the fetus and placenta of the gene mouse group was significantly less than that of the control group ( Figure 12 C-D), the placental tissue of the two groups of pregnant mice was stained by H&E, and the results showed that the infarction in the placenta of the gene mouse was significantly increased ( Figure 12 E) Further, IHC was used to verify that DHRS4 was significantly overexpressed in the placental tissues of the gene rats, while the expression of TFAM was significantly down-regulated Figure 12 F-G) Further, western blotting was used to verify that DHRS4 and LONP2 were significantly overexpressed in the placental tissues of the gene rats, while the expression of TFAM was significantly down-regulated H) Further, these results indicate that the regulation of the DHRS4-mediated LONP2-TFAM axis is involved in the pathogenesis and progression of PE.
[0170] It should be noted that the above merely illustrates the technical idea of the present application, and cannot be used to limit the protection scope of the present application. For those skilled in the art, without departing from the principle of the present application, a number of improvements and refinements can be made, which all fall within the protection scope of the claims of the present application.
Claims
1. The application of a reagent for detecting DHRS4 expression levels in the preparation of a preeclampsia diagnostic kit, characterized in that, The sequence of DHRS4 is shown in SEQ ID NO.
1.
2. The application of the reagent for detecting DHRS4 expression levels according to claim 1 in the preparation of a preeclampsia diagnostic kit, characterized in that, The reagents for detecting DHRS4 include primer pairs that specifically detect DHRS4 expression.
3. The application of the reagent for detecting DHRS4 expression levels according to claim 1 in the preparation of a preeclampsia diagnostic kit, characterized in that, Patients with preeclampsia have high DHRS4 expression.
Citation Information
Patent Citations
Method for genetic marker prediction of risk of gestosis
RU2431842C1
Method for predicting the development of gestational complications associated with impairment of haemodynamic processes in the mother-placenta-foetus system
RU2777686C1