Talaromyces sp., microbial agent and application of talaromyces sp.

Abstract

The invention belongs to the technical field of microbiology and agricultural application thereof, and particularly relates to talaromyces sp., a microbial agent and application of the talaromyces sp. According to the invention, a fungus with antagonistic action on fusarium oxysporum is screened from the root of black nightshade, the fungus is identified as talaromyces, the inhibition rate of the strain on fusarium oxysporum is 68.4%, and pot experiment shows that the relative control effect of the strain on tobacco root rot is 61.1%; a field experiment result shows that the relative prevention effect of the strain on the tobacco root rot is 88.8%, the disease index of the tobacco root rot can be effectively reduced, large-area infection of pathogenic bacteria is inhibited to a certain extent, and meanwhile, the talaromyces sp. Strain screened by the invention can induce the activity of defense enzymes PPO, PAL and POD of tobacco seedlings, improve the disease resistance of the seedlings and protect the growth of tobacco plants. Therefore, talaromyces sp. Has great potential value in the aspect of preventing and treating tobacco root rot.

Description

Technical Field

[0001] The invention belongs to the technical field of microbiology and its agricultural application, and specifically relates to a basket fungus, a microbial agent and application thereof. Background Art

[0002] China is the world's largest tobacco producer, with an estimated annual output of 2.4 million tons. There are many types of tobacco diseases, with at least 100 types worldwide, which directly lead to a yield loss of 10% to 15% each year. In my country, more than 60 infectious diseases have been found so far, among which the main rhizomes and root diseases are tobacco phytophthora black shank, thallus root black rot, Fusarium root rot, bacterial wilt and damping-off. Root rot caused by Fusarium pathogens infecting tobacco roots is a worldwide soil-borne fungal disease, which is common in major tobacco producing areas such as Yunnan, Henan, Fujian, Guizhou and Sichuan in my country. In recent years, the large-scale occurrence and prevalence of the disease has caused great losses to my country's tobacco production. Tobacco Fusarium root rot generally occurs in the tobacco seedling bed period and field growth period. There are few varieties resistant to tobacco root rot in production and cultivation, and the prevention and control of the disease still relies on chemical agents. Tobacco root rot prevention and control agents such as metalaxyl and propamocarb have been used for many years. The pathogen has developed resistance to chemical pesticides, resulting in a decrease in the prevention and control effect. Biological control is environmentally friendly and has better control effects than chemical agents in some cases, especially during the peak period of disease outbreaks accompanied by high temperatures and heavy rains, when chemical agents are difficult to play a role. Therefore, the research on biocontrol agents has become one of the hot spots in recent years.

[0003] Plant disease biocontrol bacteria are mainly isolated and screened from soil or plant rhizosphere soil microorganisms. Studies have found that endophytes exist in almost all healthy plants, and some endophytes have good antibacterial functions. After being developed into microbial pesticides, they have the advantages of long-term colonization in plants, low environmental impact and long lasting effect. Therefore, screening antagonistic bacteria from plant endophytes for biological control is considered to be one of the most promising control methods.

[0004] In the existing technology, endophytes with antagonistic effects on tobacco rhizome pathogens are mostly isolated from tobacco tissues or tobacco seeds, which greatly limits the expansion of biocontrol bacteria resources. Therefore, expanding the resources of antagonistic endophytes for tobacco root rot and enriching the biocontrol bacteria resources for tobacco rhizome diseases are important strategies for tobacco planting disease prevention and control. Summary of the invention

[0005] In order to solve the problems existing in the prior art, one of the purposes of the present invention is to provide a basket fungus that has an antibacterial effect on a variety of pathogens that can cause plant diseases, especially showing a good biocontrol effect on tobacco root rot caused by Fusarium oxysporum.

[0006] The second object of the present invention is to provide a microbial agent, comprising the basket fungus provided by the present invention, which can effectively inhibit spore germination and hyphae growth, degrade hyphae, and make pathogens lose their ability to infect, and has a significant biocontrol effect on tobacco root rot caused by Fusarium oxysporum.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is as follows: A basket fungus, whose preservation number is CGMCC NO.41104.

[0008] A microbial agent containing the above-mentioned basket fungus.

[0009] The above-mentioned microbial agent is a freeze-dried powder or a liquid preparation; the liquid preparation can specifically adopt the fermentation broth of the above-mentioned Basileus strain. In a specific embodiment of the present invention, the strain fermentation broth is prepared by inoculating the above-mentioned Basileus hyphae into PDA liquid culture medium and fermenting at 28°C and 120 r / min with shaking.

[0010] The concentration of the tularensis in the above-mentioned microbial inoculant can be adjusted according to the requirements of the specific application scenario. As an example, the concentration of the tularensis in the microbial inoculant provided in the specific embodiment of the present invention is 1.0×10 6 ~1.0×10 9 cfu / mL.

[0011] The above-mentioned basket fungi and microbial agents are used for preventing and controlling plant diseases caused by plant pathogenic fungi, wherein the plant pathogenic fungi are selected from any one or more of Siamese anthracnose, Fujikura Gibberellum, Pink Trichothecene, Tomato Alternaria, Verticillium, Solanum solani, Fujikura Fusarium, Fusarium oxysporum, Fusarium genus, Cucumber Fusarium, Fusarium variegatum, Mango Anthracnose, and Botrytis cinerea.

[0012] In a specific embodiment of the present invention, the above-mentioned tularemia and microbial agent can be used as biocontrol agents to prevent and control tobacco Fusarium root rot caused by Fusarium oxysporum; specifically, the concentration of tularemia in the microbial agent is 1.0×10 8 cfu / mL.

[0013] At the same time, in a specific embodiment of the present invention, the above-mentioned tularemia and microbial agent can improve the activity of tobacco seedling defense enzymes and can be used to improve the disease resistance of tobacco seedlings; specifically, the concentration of tularemia in the microbial agent is 1.0×10 6 cfu / mL.

[0014] Beneficial effects of the present invention: (1) The present invention screened out a fungus from Solanum nigrum roots that has an antagonistic effect on tobacco root rot caused by Fusarium oxysporum, and the fungus was identified as Talaromyce. The strain has high antibacterial properties against a variety of plant pathogens; (2) The Basilicum of the present invention can effectively inhibit the spore germination and hyphae growth of Fusarium oxysporum, and can degrade the hyphae of Fusarium oxysporum, making the hyphae porous and leaky, and eventually losing the infection activity; potted plant experiments showed that the relative prevention effect of the Basilicum strain on tobacco root rot was 61.1%; the results of field experiments showed that the relative prevention effect on tobacco root rot was 88.8%, which can effectively reduce the disease index of tobacco root rot, and to a certain extent inhibit the large-scale infection of pathogens, protect the growth of tobacco plants, and is significantly better than commercially available biocontrol agents and chemical agents; (3) The activity of cell wall degrading enzymes produced by the fermentation of the present invention's Tallabium is much higher than that of the screened strain of the same type (purple Tallabium Q2). The characterization test of the present invention verifies that the activities of chitinase and cellulase in the fermentation broth of the present invention are 3.50 U / ml and 34.9 U / ml, respectively; the prior art records that the activities of β-1,3-glucanase and chitinase in the fermentation broth of purple Tallabium Q2 are 3.40 U / mL and 1.97 U / mL, respectively; (4) The basket fungus of the present invention can also induce the activity of defense enzymes (POD, PAL, PPO) of tobacco seedlings to increase in a short period of time (3 to 6 days), maintain high activity within 9 days, and improve the disease resistance of tobacco seedlings. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0016] Figure 1 The results of the plate confrontation experiment between strain L1 and the tobacco root rot pathogen (Fusarium oxysporum); Figure 2 This is the colony morphology of strain L1; Figure 3 This is the microscopic morphology of strain L1; Figure 4 This is the electrophoresis diagram of the DNA sequence amplification product of strain L1; Figure 5 is the DNA sequence phylogeny of strain L1; Figure 6 This is a photo of the field experiment on the biocontrol effect of strain L1; Figure 7The diagram shows the observation results of the antagonistic effect of strain L1 on tobacco root rot pathogen (Fusarium oxysporum) under scanning electron microscopy: 6-1: normal hyphae of tobacco root rot pathogen; 6-2: hyphae of strain L1; 6-3, 6-4: antagonism between L1 spores and hyphae of tobacco root rot pathogen; 6-5, 6-6: hyphae were degraded after antagonism between tobacco root rot pathogen and L1; Figure 8 The effect of different concentrations of L1 strain fermentation liquid on PPO enzyme activity in seedlings; Fig. 9 Effects of different concentrations of L1 strain fermentation broth on PAL enzyme activity in seedlings; Fig.10 Effects of different concentrations of L1 strain fermentation broth on POD enzyme activity in seedlings; Fig.11 Schematic diagram of the characterization results of the inhibitory effect of strain L1 on 6 pathogenic bacteria. DETAILED DESCRIPTION

[0017] The above contents of the present invention are further described in detail below through examples, but this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples, and all technologies implemented based on the above contents of the present invention belong to the scope of the present invention.

[0018] The following examples and test examples include: The pathogen of tobacco Fusarium root rot (Fusarium oxysporum): isolated and identified from diseased tobacco root rot plants in the main tobacco producing area of ​​Pingdingshan, and preserved by the Henan Provincial Key Laboratory of Plant-Microbe Interactions; Test tobacco: Nicotiana tabacum var.samsun NN, seeds were provided by Pingdingshan Tobacco Company.

[0019] Reagents: The culture medium and the drugs (analytical grade) required for physiological and biochemical experiments were all products of Shanghai Sinopharm Group. The 16SrDNA fragment amplification reagent was purchased from Beijing Quanshijin Biological Company, and the DNA extraction kit was purchased from Solarbio Technology Co., Ltd.

[0020] Example 1 Screening and identification of target antagonistic bacteria 1.1. Isolation and screening of strains: Wild Solanum nigrum roots were collected from the breeding base of the Dry Pepper Industry Technology Research Center of Shangqiu Normal University. The roots were rinsed with running water for 25 min, cut into small pieces with sterilized scissors, and 1 g of Solanum nigrum roots were placed in a small beaker, sterilized with 70% ethanol for 20 s under sterile conditions, and ground in a mortar. Then 9 mL of sterile water was measured and continued to grind until the liquid became turbid to prepare a Solanum nigrum root suspension, which was then gradiently diluted and separated in PDA medium supplemented with streptomycin.

[0021] Steps of gradient dilution separation method: sterilize 10 centrifuge tubes in advance, label them after sterilization, let the Solanum nigrum root fungus suspension stand for 1 min, pipette 0.1 mL of the suspension into a 1.5 mL centrifuge tube, then pipette 0.9 mL of sterile water, mix the two thoroughly, and obtain 1×10 -2 The same method was used to prepare 10 times dilution. -3 , 10 -4 , 10 -5 , 10 -6 times of Solanum nigrum root fungus suspension. Pipette 1×10 -4 , 10 -5 and 10 -6 0.1 mL of bacterial solution was injected into the solidified PDA solid medium, and evenly spread with a sterilized coating rod. Each gradient of bacterial solution was repeatedly coated on three plates. After the bacterial solution on the plate was dried, the plate was inverted and incubated at 28℃ for 24 h. The growth of the colonies on the plates of each gradient was observed. The gradient with uniform colony distribution and appropriate density was the most suitable gradient for coating. The single colony on this gradient plate was streaked and incubated at 28℃ for 24 h. Repeat three times to obtain purified colonies with a single morphology. The purified colony plates were placed in a 4℃ refrigerator for standby use. A total of 18 strains of endophytes were obtained.

[0022] 1.2. Screening of antagonistic bacteria using plate confrontation method: Initial screening: Inoculate the isolated and purified endophytes and the pathogenic tobacco Fusarium root rot pathogen (Fusarium oxysporum) on carrot culture medium, place it in a constant temperature incubator and culture it at 28℃ for 3 days. After cultivation, conduct a plate confrontation experiment.

[0023] The method of the plate confrontation experiment: ① Use a 1 cm puncher to punch out bacterial cakes, which include antagonistic bacteria and tobacco rhizome disease pathogens. ② Inoculate the pathogen in the center of the 10 cm carrot culture medium, take 3 points in a regular triangle 2 cm away from the edge of the culture dish, take the pathogen block as the center, take the isolated and purified single fungal colony and inoculate it at 3 points on the edge, and use the non-inoculated isolated bacteria as the control, and repeat three times for each group. ③ Place it in a 28℃ incubator, culture it at a constant temperature, and observe and record the growth status of the strain for 7 to 10 consecutive days.

[0024] Rescreening: Use a 1 cm diameter puncher to take the purified bacterial cakes of the antagonistic endophytes in the initial screening and put them into 25 mL PDA liquid culture medium. Put 2 bacterial cakes in each PDA liquid culture medium and culture them at 28°C and 175 r / min for 3 d; use a 1 cm diameter sterile puncher to punch the pathogenic tobacco Fusarium root rot pathogen (Fusarium oxysporum) and inoculate it in the center of a 10 cm carrot culture dish. Take 3 points in a regular triangle 2 cm away from the edge of the culture dish, use a pipette to transfer 5 mL of antagonistic bacterial solution and inoculate it at the 3 points on the edge. Use no inoculation of isolated bacteria as the control. Repeat three times for each group. Culture in a constant temperature in a 28°C incubator, observe and record the growth of the strain, observe continuously for 7-10 days and record the inhibition radius, and finally calculate the inhibition rate.

[0025] Inhibition diameter = diameter of pathogen colonies in the control group - diameter of pathogen colonies in the treatment group.

[0026] Inhibition rate (%) = [(colony diameter of control group - colony diameter of treatment group) / (colony diameter of control group - diameter of bacterial cake)] × 100%.

[0027] A strain with good antagonistic effect on the pathogenic tobacco Fusarium root rot (Fusarium oxysporum) was screened out and named L1. Figure 1 As shown, the antibacterial diameter of the pathogenic tobacco Fusarium root rot pathogen (Fusarium oxysporum) reached 14.4 mm, and the inhibition rate was 68.4%. The results of the two tests were consistent, and the strain L1 was screened out with good stability in antibacterial effect.

[0028] 1.3. Identification of strains: 1.3.1 Observation of colony morphology and microscopic morphology: Inoculate the selected and purified L1 strains onto PDA solid culture medium and observe for 3 to 7 days until the strains inoculated onto the culture medium gradually grow and the color gradually deepens from light green to green. Pick a small amount of hyphae to make a temporary slide and observe under a microscope. Take photos of the conidia and conidia spores of the strains and preserve them.

[0029] The results showed that the isolated strain L1 was cultured on PDA medium at 28°C. After 7 days of culture, the colony diameter was 3.26 cm. The growth rate of this strain was slower than that of other strains. After 1-2 days of growth, the strain was yellow. After 3-4 days of growth, the color of the strain gradually changed to yellow-green. After 5-6 days of growth, the color of the strain gradually changed from yellow-green to green. The colony was round, dense, with neat edges. The green in the middle of the strain gradually became lighter, the outer periphery was yellow, and the back was yellow-green (such as Figure 2 ); Observation under an electron microscope showed that the conidiophore of strain L1 was a conidiophore, which produced symmetrical double whorls of broom-like stalks that were erect, transparent, and without septa. The apex of the stalk was borne by multiple columnar peduncles, which were sometimes swollen at the apex. Each peduncle had almost equal length and diameter and were usually arranged closely. The spore cells were called phialides, which were mostly lanceolate, each phialide had almost equal length and diameter, and usually the length and diameter of the phialide were equal to that of the peduncles. They were attached with elliptical conidia, with a size of 1.0 μm-1.2 μm×1.6 μm-1.8 μm, and the surface of the spores had fine and rough structures with ridges (see Figure 3 ).

[0030] The L1 strain and the Basileus spp. were analyzed by colony color and morphology combined with microscopic morphology. Talaromyces radicus Most similar.

[0031] 1.3.2 Molecular biological identification of strains: DNA was extracted using the Fungal Genomic DNA Extraction Kit from Solarbio Technology Co., Ltd.

[0032] PCR amplification: Reaction system (20 mL): Premix Taq 10 mL, Forward primer (ITS1:TCCGTAGGTGAACCTGCGG) 0.5 mL, Template 1 mL, ddH2O 8 mL, Reverse primer (ITS4:TCCTCCGCTTATTGATATGC) 0.5 mL. Reaction procedure: Pre-denaturation at 95℃ for 5 min, denaturation at 94℃ for 1 min, annealing at 55℃ for 1 min, extension at 72℃ for 1 min30s, full extension at 72℃ for 10 min (delayed shutdown: 4℃ unlimited), denaturation, annealing, and extension for 30 cycles, 1% agarose gel electrophoresis to detect PCR products, such as Figure 4 As shown, by comparing with the values ​​of the Marker lane, the band of L1 genomic DNA is about 700 bp, which is consistent with the size of the target fragment.

[0033] The PCR product was sent to Tianjin Jinweizhi Biotechnology Co., Ltd. for sequencing. The sequencing results were in the NCBI (https: / / www.ncbi.nlm.nih.gov / ) database. Using MEGA11.0 software, the strains with high homology and already named were selected in the Blast program, and the sequences of these strains were downloaded to construct the phylogenetic tree of the Tularemia strain L1. It was found that the sequence of strain L1 was 99% similar to that of Tularemia, and the closest relationship was (e.g. Figure 5 As shown), it shows that the L1 strain screened by the present invention is a basket fungus.

[0034] In summary, the results of morphological, microscopic morphological and molecular biological identification of strain L1 showed that strain L1 belonged to the genus Talaromyces (Talaromyces sayulitensis), which was deposited in the General Microbiology Center of China National Microbiological Culture Collection on February 20, 2024, with the deposit number CGMCC NO.41104.

[0035] Prepare the fermentation liquid (stock solution) of strain L1: Pick an appropriate amount of strain L1 mycelium and inoculate it into 250 mL PDA liquid medium, and culture it at 28°C and 120 r / min until the spore concentration of the fermentation liquid reaches 10 8 cfu / mL; Preparation of pathogen fermentation broth: Pick an appropriate amount of hyphae of tobacco root rot pathogen (Fusarium oxysporum) and inoculate it into 250 mL PDA liquid culture medium. Cultivate at 28°C and 120 r / min with shaking until the spore concentration of the fermentation broth reaches 108 cfu / mL.

[0036] The fermentation broth of strain L1 and the fermentation broth of pathogenic bacteria prepared above were used in the experimental processes of the following examples. Example 2 Identification of the biocontrol effect and antibacterial mechanism of strain L1 2.1 Analysis of the biocontrol potential of tobacco Fusarium root rot: The fermentation liquid of strain L1 was used to treat tobacco seedlings by root irrigation to determine its potted and field control effects: The pot experiment set up five control treatments, namely (1) CK: only inoculated with pathogens; (2) CK0: no antagonistic bacteria and pathogens were inoculated, only water was inoculated; (3) microbial agent Wangtaibao (Trichoderma harzianum, Trichoderma acanthosporum ≥ 200 million / g, Shanghai Dajing Biological) treatment: 1% Wangtaibao was used to irrigate 650 mL per tobacco plant; microbial agent Bimiao (Shanghai Dajing Biological) treatment: (4) Bimiao water was diluted 1000 times, and 650 ml was used per tobacco plant; (5) chemical reagents formosan frost·mancozeb (Syngenta, Switzerland) treatment: 58% formosan frost·mancozeb wettable powder was diluted 600 times, and 200 mL was applied to each plant. The inoculation amount of antagonistic bacteria solution and pathogen fermentation solution was 200 mL per pot, and each treatment was repeated 8 pots.

[0037] When tobacco enters the vigorous growth period, the first bacterial agent or pesticide is applied; 7 days later, 200 mL of the fermentation liquid of tobacco root rot pathogen is inoculated, and then the bacterial agent is inoculated once every 7 days, for a total of 3 times. Each treatment is repeated 3 times. 14 days after inoculation, the disease situation is investigated and the incidence rate, disease index and relative control effect are calculated.

[0038] The field rescreening test was carried out in Bailongmiao Village, Pingdingshan City. After the tobacco entered the mature stage, the root irrigation method was used for inoculation, and the inoculation volume was 200 mL / plant. There were four control treatments in the field test: CK, Bimiao, Wangtaibao, and carbendazim. Each group treated 50 plants and repeated 3 times. The tobacco plants were transplanted on May 1, 2021. After 20 days, each treatment was applied according to the amount of the potted experiment. The root irrigation was applied every 15 days, for a total of 3 times. The disease situation was investigated 15 days after the last root irrigation. The rest of the measures were carried out in accordance with the production of high-quality tobacco leaves. Then the observations were made and recorded every week, and the incidence rate, disease index and relative prevention effect were calculated.

[0039] The grading standard for tobacco root rot is based on the tobacco industry standard of the People's Republic of China (GB / T 23222-2008): Incidence rate = number of diseased plants / total number of tobacco plants × 100%.

[0040] Disease index = Σ(number of diseased plants at each level × value of the disease level) / total number of plants surveyed × highest level value.

[0041] Relative protective effect = control disease index - treatment disease index / control disease index × 100%.

[0042] The results of the potted plant protection test are shown in Table 1:

[0043] The results of the potted test showed that the incidence rates of the control treatments CK, CK0, Bimiao, Wangtaibao and Mancozeb were 85.7%, 62.5%, 57.1%, 71.4% and 57.1%, respectively, and the disease indexes were 57.1, 53.1, 57.1, 53.6 and 32.1, respectively; compared with the control, the tobacco plants treated in each group showed a certain disease prevention effect, among which the incidence rate and disease index of the L1 strain were the lowest at 44.4% and 22.2, respectively; and the control effect and relative prevention efficiency of the L1 strain were the highest, at 61.1%.

[0044] The results of field control are shown in Table 2 and Figure 6 As shown:

[0045] The results of the field test showed that the disease situation was investigated on August 25. The disease incidence rates of the control treatments CK, Mancozeb, Bimiao, and Wangtaibao were 14.3%, 7.7%, 6.2%, and 7.7%, respectively, and the disease indexes were 11.1, 5.6, 5.1, and 13.0, respectively. Except for the Wangtaibao treatment, the other treatments showed certain control effects and relative control efficiencies. The effect of L1 was the best, with a disease incidence rate of only 2.9%; the disease index was significantly reduced to 0.7; the control effect reached 79.7%; and the relative control efficiency was 93.7%.

[0046] In summary, it can be concluded that Bacillaceae L1 has a significant antagonistic effect on tobacco root rot, and its disease prevention and control effect is significantly better than commercially available chemical agents and biocontrol agents.

[0047] 2.2 Determination of antibacterial mechanism of antagonistic strains 2.2.1 SEM observation of antagonism between L1 and root rot pathogens The Fusarium oxysporum and the Fusarium oxysporum treated with C-1 fermentation broth were observed using a scanning electron microscope. Figure 7 As shown in Figure 6, the skeletal hyphae of normal root rot pathogen (Fusarium oxysporum) are tubular, thick-walled and very long with a diameter of 2-3 μm, which is smaller than the average diameter of fungal hyphae of 4-5 μm. They are plump, unbranched, and have a velvety sticky structure on the hyphae surface (see Figure 6-1). Figures 6-3 and 6-4 show that L1 hyphae and spores antagonize the hyphae of Fusarium oxysporum. There are a large number of L1 spores in the figure, but no Fusarium oxysporum spores are seen. After antagonism with L1, the hyphae of Fusarium oxysporum are sunken, shrunken, prismatic, and no longer smooth on the surface, and fibrous thorns are produced, thus losing the ability to continue to infect. In all fields of vision, almost no Fusarium spores can be seen, and they are all surrounded by L1 spores, indicating that L1 can effectively inhibit the spore germination and hyphae growth of Fusarium oxysporum. After antagonism with L1, the hyphae are degraded, and porous (6-5) and leaky (6-6) appear, and eventually lose their infectivity.

[0048] 2.2.2 Detection of chitinase and cellulase activities in the fermentation broth of strain L1 Pick an appropriate amount of strain L1 hyphae and inoculate it in 250 mL PDA liquid medium, shake and culture at 28°C and 120 r / min until the logarithmic growth phase, and then centrifuge to obtain the supernatant; send the bacterial solution to Shanghai Yuanxin Biological Co., Ltd. to detect chitinase and cellulase activities. The method refers to the company's soil cellulase activity detection kit (YX-SH-TQ22025). The results are shown in Table 3:

[0049] The enzyme activity test results of L1 fermentation broth showed very high chitinase and cellulase activities, which were 3.50 U / ml and 34.9 U / ml, respectively.

[0050] Example 3 Characterization of the feasibility of strain L1 in improving disease resistance in tobacco seedlings Effects of strain L1 on defense enzyme activities in tobacco seedlings Tobacco seedlings were infected with L1 fermentation solution, 10-fold diluted bacterial solution and 100-fold diluted bacterial solution respectively. Clean water was used as control. The changes of polyphenol oxidase (PPO), phenylalanine ammonia lyase (PAL) and peroxidase (POD) activities were studied after root irrigation of tobacco seedlings with L1 bacterial solution.

[0051] 3.1 Determination of polyphenol oxidase (PPO) activity Weigh 0.1 g of tobacco seedlings, add 2 mL of 0.05 mol / L phosphate buffer (pH8.0), grind thoroughly in an ice bath, centrifuge at 4°C, 1000 rpm for 5 min, and take the supernatant as the crude enzyme solution. Take 1 mL of 0.02 mol / L catechol solution, 0.5 mL of 0.05 mol / L phosphate buffer (pH8.0), and 0.2 mL of crude enzyme solution (control with 0.2 mL of 0.05 mol / L phosphate buffer pH8.0), blow evenly, react in a 30°C water bath for 15 min, measure the absorbance at 405 nm with a spectrophotometer, and test each three times.

[0052] 3.2 Phenylalanine ammonia lyase (PAL) activity assay Weigh 0.1 g tobacco seedlings, add 0.05 g PVP (polyvinyl pyrrolidone), and then add 2 mL 0.2 mol / L boric acid buffer (pH8.8), grind thoroughly in an ice bath, centrifuge at 4 ℃, 1000 rpm for 5 min, and take the supernatant as the crude enzyme solution. Take 1 mL 0.02 mol / L L-phenylalanine, 1 mL 0.2 mol / L boric acid buffer (pH8.8), and 0.2 mL crude enzyme solution (control with 0.2 mL 0.2 mol / L boric acid buffer pH8.8), blow evenly, react in a 30 ℃ water bath for 30 min, and measure the absorbance at a wavelength of 280 nm with a spectrophotometer.

[0053] 3.3 Peroxidase (POD) activity assay Weigh 0.1 g of tobacco seedlings, add 2 mL of 0.05 mol / L phosphate buffer solution (pH 5.5), grind thoroughly in an ice bath, centrifuge at 4 °C, 1000 rpm for 5 min, and take the supernatant as the crude enzyme solution. Take 1 mL of 0.05 mol / L phosphate buffer solution (pH 5.5), 0.3 mL of 2% H2O2, 0.3 mL of 0.05 mol / L guaiacol, and 0.1 mL of crude enzyme solution (control with 0.1 mL of 0.05 mol / L phosphate buffer solution pH 5.5), blow evenly, react in a 37 °C water bath for 15 min, and measure the absorbance at a wavelength of 490 nm with a spectrophotometer.

[0054] The results showed that compared with the root irrigation treatment with clear water, the enzyme activity in all three treatments was significantly increased. After the L1 fermentation solution treatment, the PPO enzyme activity was relatively stable. After the 10-fold dilution solution treatment, the PPO enzyme activity first increased, then decreased, and then increased again. After the 100-fold dilution solution treatment, the PPO enzyme activity reached the highest on the 6th day (see Figure 8After the L1 bacterial solution was infecting tobacco, the PAL enzyme activity showed an overall trend of first decreasing and then increasing. The PAL enzyme activity reached the highest level on the 6th day after treatment and then gradually decreased. The enzyme activity was proportional to the dilution multiple of the bacterial solution (see Fig. 9 ). The POD enzyme activity of the four treatments decreased slightly during the 0-3 days, and then continued to increase, with the activity of 100-fold dilution > 10-fold dilution > fermentation broth (see Fig.10 ).

[0055] In summary, root irrigation of tobacco seedlings with 100-fold diluted solution for 9 days can induce PPO, PAL and POD to maintain high activity.

[0056] Example 4 Determination of the antibacterial spectrum of strain L1 The plate confrontation method was used to detect the antibacterial effect of strain L1 on other plant pathogenic fungi. Five plates were used for each treatment and the experiment was repeated three times. The results are as follows: Fig.11 As shown in Table 4 below:

[0057] The results showed that strain L1 had a significant inhibitory effect on the growth of six pathogenic fungi ( Fig.11 ), the inhibition rates of Siamese Anthracnose, Pink Trichothecene, Alternaria tomato, Fusarium solani, Fujikura Fusarium, and Fusarium variegata were 92.34%, 91.80%, 86.79%, 90.09%, 87.54%, and 87.84% respectively (Table 4), and the inhibition effect was obvious. This shows that the strain L1 screened by the present invention has great potential application value in the prevention and control of plant diseases. In addition to having a preventive effect on tobacco Fusarium root rot, it also has potential application value in the prevention and control of plant diseases caused by the above pathogenic fungi parasitizing other crops.

[0058] In summary, the present invention screened out a fungus with antagonistic effect on Fusarium oxysporum from the root of Solanum nigrum, which was identified as Talaromyce and named L1. The antibacterial rate of the strain to Fusarium oxysporum was 68.4%. The pot experiment showed that the relative prevention effect of Talaromyce strain L1 on tobacco root rot was 61.1%; the field experiment results showed that the relative prevention effect of strain L1 on tobacco root rot was 88.8%, which can effectively reduce the disease index of tobacco root rot and inhibit the large-scale infection of pathogens to a certain extent. At the same time, the Talaromyce strain L1 screened by the present invention can induce the activities of tobacco seedling defense enzymes PPO, PAL and POD, improve the disease resistance of seedlings, and protect the growth of tobacco plants. Therefore, Talaromyce L1 has great potential value in preventing and controlling tobacco root rot.

[0059] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A basket fungus, characterized in that Its accession number is CGMCC NO.41104.

2. A microbial agent containing the Basileus as described in claim 1.

3. The microbial agent according to claim 2, characterized in that The microbial agent is freeze-dried powder.

4. The microbial agent according to claim 2, characterized in that The microbial agent is a liquid preparation.

5. The microbial agent according to claim 4, characterized in that The microbial agent is the fermentation broth of the Basileus strain as claimed in claim 1.

6. The microbial agent according to claim 5, characterized in that The strain fermentation broth was prepared by inoculating the hyphae of Basileus fasciatus into PDA liquid culture medium and fermenting at 28° C. and 120 r / min with shaking.

7. The microbial agent according to any one of claims 4 to 6, characterized in that The concentration of the tricholoma in the microbial agent is 1.0×10 6 ~1.00×10 8 cfu / mL.

8. Use of the Basileus according to claim 1 or the microbial agent according to any one of claims 2 to 7 in preventing and controlling plant diseases caused by plant pathogenic fungi, characterized in that: The plant pathogenic fungi are selected from any one or more of Siamese Anthracnose, Fujikura Gibberella, Pink Trichothecene, Alternaria alternata, Verticillium fusariotii, Fusarium solani, Fujikura Fusarium, Fusarium oxysporum, Fusarium genus, Cucumber Fusarium, Fusarium variegata, Mango Anthracnose, and Botrytis cinerea.

9. The use according to claim 8, characterized in that The plant disease is tobacco Fusarium root rot caused by Fusarium oxysporum; Optionally, the concentration of Basilicum in the microbial agent is 1.0×10 8 cfu / mL.

10. Use of the tularensis according to claim 1 or the microbial agent according to any one of claims 2 to 7 in improving the disease resistance of tobacco seedlings; Optionally, the concentration of Basilicum in the microbial agent is 1.0×10 6 cfu / mL.

Images