Screening method for streptococcus suis serine protein kinase inhibitor and application thereof

Abstract

The application belongs to the technical field of drug target screening, and particularly relates to screening of a streptococcus suis serine protein kinase inhibitor and application thereof. Based on a chemiluminescence technology, possible HPrK inhibitors are screened by measuring luminescence values of different drugs added in a reaction system, and the reaction system comprises streptococcus suis SC19 serine protein kinase (HPrK), streptococcus suis SC19 phosphorylated carrier protein (HPr), ATP, a kinase reaction buffer and Reagent. By screening of the kinase inhibitor library by using the application, an inhibitor CDK9-IN-2 is obtained, the inhibition rate of the inhibitor CDK9-IN-2 to the streptococcus suis serine protein kinase (HPrK) reaches 99%, and the inhibitor CDK9-IN-2 also has obvious inhibitory effects on staphylococcus aureus, mycoplasma hyosynovis and the like.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of drug target screening, and particularly relates to a high-throughput screening method for a streptococcus suis serine protein kinase (HPrK) inhibitor based on chemiluminescence and application thereof. BACKGROUND

[0002] There are various strategies for the treatment of bacteria, such as vaccines, egg yolk antibodies, microecological preparations, etc., and antibiotics are the first choice for prevention and treatment. However, in recent years, the accumulation and spread of antibiotic resistance have made the effectiveness and safety of antibiotic prevention and treatment face serious challenges, and the research and development of new drugs is of great significance, and the discovery of new drug action targets and inhibitor screening is an important way.

[0003] According to the previous laboratory research, more than sixty potential antibacterial drug targets in streptococcus suis have been identified, mainly including ribosomal proteins, DNA replication proteins, protein secretion systems, carbohydrate uptake and metabolic enzymes and regulatory proteins; among them, bacterial enzymes such as kinases and phosphatases play an important role in various functions of bacterial cells, and at the same time, 71 kinds of kinase inhibitors have been approved by FDA, so kinases are effective drug action targets.

[0004] Serine protein kinase HPrK as an important component in the metabolic regulation of bacteria, the main function is to phosphorylate HPr to inhibit the utilization of secondary carbon sources, and ensure sufficient energy supply for bacteria B, Stülke J. Carbon catabolite repression in bacteria: many ways to make the most out of nutrients. Nat Rev Microbiol. 2008 Aug;6(8):613-24). At the same time, HPr phosphorylation reactions are also closely related to bacterial toxicity (Li RF, Cui P, Wei PZ, Liu XY, Tang JL, Lu GT. HprKXcc is a serine kinase that regulates virulence in the Gram-negative phytopathogen Xanthomonas campestris. Environ Microbiol. 2019 Dec;21(12):4504-4520) (Mertins S, Joseph B, Goetz M, Ecke R, Seidel G, Sprehe M, Hillen W, Goebel W, Muller-Altrock S. Interference of components of the phosphoenolpyruvate phosphotransferase system with the central virulence gene regulator PrfA of Listeria monocytogenes. J Bacteriol. 2007 Jan;189(2):473-90).Early studies have shown that when the HPrK gene is deleted or point mutated, the bacteria have a significant growth defect (Huynh PL, Jankovic I, Schnell NF, Bruckner R. Characterization of an HPr kinase mutant of Staphylococcus xylosus. J Bacteriol. 2000 Apr; 182(7): 1895-902) (Hanson KG, Steinhauer K, Reizer J, Hillen W, Stulke J. HPr kinase / phosphatase of Bacillus subtilis: expression of the gene and effects of mutations on enzyme activity, growth and carbon catabolite repression. Microbiology (Reading). 2002 Jun; 148(Pt 6): 1805-1811). Thus, if an effective inhibitor is found to reduce the activity of HPrK, the growth of the bacteria will be inhibited.

[0005] The existing HPrK screening techniques include simulating docking of the molecular model of HPrK protein with the structure of drug compounds through bioinformatics computer simulation technology, so as to screen the drug inhibitors with matching structure (Sandeep Kumar, Rajendra Bhadane, Shruti Shandilya, Outi M.H. Salo-Ahen, Suman Kapila. Identification of HPr kinase / phosphorylase inhibitors: novel antimicrobials against resistant Enterococcus faecalis. Journal of Computer-Aided Molecular Design (2022) 36:507-520) (Li S, Zhou Y, Yan Y, Qin Y, Weng Q, Sun L. Structure-Based Virtual Screening, ADMET Properties Prediction and Molecular Dynamics Studies Reveal Potential Inhibitors of Mycoplasma pneumoniae HPrK / P. Life (Basel). 2024 May 22; 14(6):657). But the disadvantage is that the inhibitory efficiency of the compound obtained by computer simulation in real test does not reach the expected effect, there is a certain difference between the simulation technology and the actual operation, the results obtained are not the same, and the simulation technology needs a certain operation learning and a certain time.

[0006] Early reports also have been made by compound radioactive in vitro test to carry out inhibitor screening (Helena Ramstro¨m, Maryline Bourotte, Claude Philippe, Martine Schmitt, Jacques Haiech and Jean-Jacques Bourguignon. Heterocyclic Bis-Cations as Starting Hits for Design of Inhibitors of the Bifunctional Enzyme Histidine-Containing Protein Kinase / Phosphatase from Bacillus subtilis. Journal of Medicinal Chemistry, 2004, Vol. 47, No. 9) but its experimental operation is complex and the time is far away from now is not the latest technology, and the compound drug library used in its screening has also been updated. In addition to the above method, no other screening technology has been reported. SUMMARY

[0007] The purpose of the present application is to provide a simple and efficient high-throughput screening method for inhibitors of serine protein kinase (HPrK) of Streptococcus suis without complex operation.

[0008] The present application also includes the application of the above-mentioned high-throughput screening method, and the use of the above-mentioned method to screen out compounds that have inhibitory effect on serine protein kinase (HPrK) of Streptococcus suis and the growth of Streptococcus suis.

[0009] The present application adopts the following technical scheme, serine protein kinase HPrK as a kind of protein kinase can catalyze ATP dephosphorylation to convert ADP, which is the process of ATP consumption. And HPrK inhibitor can inhibit the kinase activity, slow down the consumption of ATP. The whole reaction process can be observed by detecting the change of ATP amount to observe the degree of reaction.

[0010]

[0011] ATP fluorescence detection method is a rapid detection technology developed according to the principle of firefly luminescence. Under aerobic conditions, luciferase can catalyze the oxidation reaction between luciferin and ATP to form oxidized luciferin and emit fluorescence, and the emitted fluorescence intensity is proportional to the content of ATP, so the change of ATP amount can be presented by the change of fluorescence intensity.

[0012] Add 1133 kinds of small molecule compounds in the commercial kinase inhibitor drug library to the reaction system respectively, screen out the drugs with inhibitory effect on HPrK by detecting the residual luminescence value (i.e. the residual ATP content) of the reaction, and further analyze and determine the antibacterial spectrum, MIC and MBC of the drugs.

[0013] The specific screening method technical scheme is as follows:

[0014] (1) 10 muL of a mixed system containing a final concentration of 150 mM NaCl, 10 mM MgCl2, 50 mM (pH 8.0) Tris-HCl, 100 muM HPr, 2 muM HPrK and 80 muM ATP, 0.5 mM drug dissolved in dimethyl sulfoxide (DMSO) is added to a black U-shaped bottom 384-well plate, and 10 replicates of positive and negative controls are set;

[0015] (2) The above 384-well plate is incubated at 37 DEG C for 1 h, then taken out and cooled at room temperature for 5 min, 10 muL Reagent is added, and after 10 min of reaction, the luminescence value RLU is measured by an enzyme marker;

[0016] (3) The inhibition rate of the inhibitor enzyme activity is calculated by the following formula: Inhibitor enzyme activity inhibition rate = (measured inhibitor chemiluminescence value - positive group chemiluminescence average value) / (negative group chemiluminescence average value - positive group chemiluminescence average value);

[0017] (4) The kinase inhibitor drug library HY-L001 of MedChem Express Company is screened according to the above steps, and the inhibitor CDK9-IN-2 with an HPrK enzyme activity inhibition rate of 99% is obtained.

[0018] Compared with the prior art, the beneficial effects of the present application are that the HPrK inhibitor targeting Streptococcus suis serine protein kinase provided by the present application has an inhibition rate of 99% on 2 muM HPrK, which can significantly inhibit the growth of Streptococcus suis. Since Staphylococcus aureus, swine erysipelas bacillus and other gram-positive bacteria, as well as Mycoplasma hyopneumoniae and Mycoplasma hyopneumoniae express HPrK kinase protein, the CDK9-IN-2 screened by the present application can effectively act as a broad-spectrum antibacterial inhibitor to inhibit the growth of these bacteria, and the in vivo antibacterial experiment of the wax moth also proves that CDK9-IN-2 can effectively inhibit the growth of Streptococcus suis in the wax moth, thereby improving the survival rate of the wax moth. The present application provides strong support for new drug research and development. In addition, the chemiluminescence screening technology adopted by the present application is not only simple and efficient, but also can realize rapid and high-throughput rescreening of new drug library in a very short time. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 The plasmid construction mode diagram of the present application is shown.

[0020] Figure 2 Optimization of related parameters in HPrK enzyme activity reaction system. Figure 2 In the figure, A is the linear relationship between ATP concentration and RLU; B is the determination of optimal ATP concentration; C is the determination of optimal HPr protein concentration; D is the determination of optimal HPrK protein concentration; E is the determination of optimal reaction time.

[0021] Figure 3 Z-factor determination for high-throughput screening method.

[0022] Figure 4 A in the figure is the inhibition rate of each drug in the drug library; Figure 4 B in the figure is the molecular structural formula of the inhibitor CDK9-IN-2 obtained by the method of the application.

[0023] Figure 5 Antibacterial activity of the inhibitor CDK9-IN-2 on different bacteria.

[0024] Figure 6 Antibacterial activity of the inhibitor CDK9-IN-2 in Galleria mellonella. Specific implementation method

[0025] The following examples are used to further illustrate the application, but should not be understood as limiting the application, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the application shall be equivalent replacement methods, and shall be included in the protection scope of the application.

[0026] Example 1

[0027] Screening steps of the Streptococcus suis serine protein kinase (HPrK) inhibitor CDK9-IN-2.

[0028] 1. Construction of HPrK and HPr recombinant expression plasmids and protein purification:

[0029] After the prokaryotic expression vector pET28a was treated by double enzyme digestion of BamH I and Sal I, it was recovered by 1% agarose gel electrophoresis and purification, and the primer was designed by oligo7 software, with Streptococcus suis SC19 genome (NZ_CP020863) as the template, and the primer (5'→3') was,

[0030] pET28a-HPr-F: CAAATGGGTCGCGGATCCATGGCTTCAAAAGACTTCC;

[0031] pET28a-HPr-R: GCCGCAAGCTTGTCGACTTATGCCAATCCTTCTTTTT;

[0032] pET28a-HPrK-F:AAATGGGTCGCGGATCCATGACCGTTTATGTGAAAG;

[0033] pET28a-HPrK-R:CGCAAGCTTGTCGACTTAAGCCTCTTCTCTATT.

[0034] The intracellular domain fragments of HPrK and HPr were amplified, and the digested vector and PCR fragment were ligated using homologous recombinase. Figure 1 The cells were transformed into DH5α competent Escherichia coli, cultured overnight at 37°C for several hours, and positive clones were identified by colony PCR. Plasmids were extracted by shaking and sent to a commercial sequencing company for sequencing.

[0035] The correctly sequenced recombinant plasmid was transformed into BL21 competent E. coli. The transformed bacteria were then inoculated onto LB broth and grown at 37°C with a shaker at 160 rpm until the bacterial culture reached the OD value. 600 When the concentration is between 0.8 and 1.0, add 1 mM IPTG and incubate at 18°C ​​and 160 rpm for 12-14 h. Then, centrifuge to remove the supernatant, resuspend the bacterial cells in phosphate-buffered saline (PBS) solution, and lyse the bacteria using an autoclave. Centrifuge the lysed bacterial solution, filter the supernatant through a 0.45 μm filter, and react it thoroughly with a nickel column. Then, use a protein purification instrument to elute the nickel column with a buffer containing imidazole. Based on the absorption peak at 280 nm, sample the collected components and perform SDS-PAGE to evaluate protein purity. At the same time, concentrate the protein using an ultrafiltration tube.

[0036] 2. Establishment of the screening method:

[0037] 2.1 Establishment of the standard curve for ATP and luminescent unit RLU

[0038] A 50 μL reaction system contained 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 150 mM NaCl, and different concentrations of ATP (three replicates for each ATP concentration). The ATP concentrations were 0, 20, 40, 60, 80, 100, 120, 140, 160, 180, and 200 μM. The mixture was placed in a 37°C incubator for 30 min, then cooled to room temperature, and commercially available... 50 μL of Reagent was added to a chemiluminescence-specific 96-well plate. After reacting for 10 min, the luminescence value was measured using a microplate reader. Linear regression analysis was performed between the luminescence unit RLU and different concentrations of ATP to obtain the correlation coefficient.

[0039] likeFigure 2 As shown in Figure A of the accompanying drawings, the luminescence unit RLU is positively correlated with the ATP concentration in the range of 0-200 μM.

[0040] 2.2 Determination of optimal ATP concentration

[0041] The 50 μL reaction system contains 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 150 mM NaCl, 10 μM HPr, 1 μM HPrK and different concentrations of ATP (3 replicates for each ATP concentration), and the ATP concentrations are 0, 20, 40, 60, 80, 100, 120, 140, 160, 180, 200 μM, respectively. The mixed system is placed in a 37 °C incubator, and after 30 min, it is cooled to room temperature, and a commercial kinase activity detection reagent Reagent 50 μL is added to a chemiluminescence special 96-well plate for reaction for 10 min. The test group is added with a quantitative HPrK and HPr, and the control group is added with HPr and an equal amount of distilled water. The luminescence value is measured in an enzyme marker, and the relationship between the relative luminescence unit difference ΔRLU of the test group and the control group and the ATP concentration is obtained.

[0042] As shown in Figure B of the accompanying drawings, when the ATP concentration is 80 μM, the relative luminescence unit ΔRLU value is the largest. That is, the optimal ATP concentration is 80 μM. Figure 2

[0043] 2.3 Determination of optimal substrate HPr protein concentration

[0044] The 50 μL reaction system contains 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 150 mM NaCl, 1 μM HPrK and 80 μM ATP, and different concentrations of HPr (3 replicates for each HPr concentration), and the HPr concentrations are 0, 10, 20, 40, 60, 80, 100, 120, 140, 160, 180, 200 μM, respectively. The mixed system is placed in a 37 °C incubator, and after 30 min, it is cooled to room temperature, and a commercial kinase activity detection reagent Reagent 50 μL is added to a chemiluminescence special 96-well plate for reaction for 10 min. The test group is added with the above system, and the control group is not added with HPrK, but added with an equal amount of distilled water. The luminescence value is measured in an enzyme marker, and the relationship between the relative luminescence unit difference ΔRLU of the test group and the control group and the HPr concentration is obtained.

[0045] As shown in Figure C of the accompanying drawings, when the ATP concentration is determined to be the optimal concentration of 80 μM, the relative luminescence unit ΔRLU value is the largest when the HPr concentration is 100 μM. That is, the optimal HPr concentration is 100 μM. Figure 2 ​​

[0046] 2.4 Determination of the optimal concentration of the kinase HPrK protein

[0047] The 50 μL reaction system contained 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 150 mM NaCl, 80 μM ATP, and 100 μM HPr, as well as different concentrations of HPrK (three replicates for each HPrK concentration). The HPrK concentrations were 0, 0.5, 1, 2, 4, 6, 8, 10, and 12 μM. The mixture was placed in a 37°C incubator for 30 min. After cooling to room temperature, commercially available... Add 50 μL of Reagent to a chemiluminescence-specific 96-well plate and react for 10 min. The experimental group received the same mixture, while the control group received no HPrK and an equal volume of distilled water. Measure the luminescence values ​​using a microplate reader to determine the relationship between the relative luminescence unit difference ΔRLU between the experimental and control groups and the HPrK concentration.

[0048] like Figure 2 As shown in Figure D, the relative luminescence unit ΔRLU value is maximized when the optimal ATP concentration is determined to be 80 μM, the optimal HPr concentration to be 100 μM, and the HPrK concentration to be 2 μM. That is, the optimal HPrK concentration is 2 μM.

[0049] 2.5 Determination of Optimal Reaction Time

[0050] A 50 μL reaction system containing 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 150 mM NaCl, 80 μM ATP, 100 μM HPr, and 2 μM HPrK was incubated at 37 °C for different times (three replicates per time point) with time gradients of 0 h, 0.1 h, 0.25 h, 0.5 h, 0.75 h, 1 h, 1.5 h, and 2 h. After cooling to room temperature, commercially available... 50 μL of Reagent was added to a 96-well chemiluminescence plate and reacted for 10 min. Different reaction time groups were set up, with each group serving as a control. Each group was further divided into an experimental group and a control group: the experimental group contained the optimal concentrations of ATP, HPr, and HPrK, while the control group contained only the optimal concentrations of ATP, HPr, and an equal volume of distilled water. The luminescence values ​​were measured using a microplate reader, and the relationship between the relative luminescence unit difference ΔRLU between the experimental and control groups and the reaction time was determined.

[0051] like Figure 2 As shown in Figure E, when the optimal concentrations of ATP (80 μM), HPr (100 μM), and HPrK (2 μM) are determined, the relative luminescence unit (ΔRLU) value is maximized after 1 hour of reaction. Therefore, the optimal reaction time is 1 hour.

[0052] Through the above experiments, it is shown that in the HPrK enzyme activity reaction system, the optimal ATP concentration is 80 μM, the optimal HPr protein concentration is 100 μM, the optimal HPrK protein concentration is 2 μM, and the optimal reaction time is 1 h.

[0053] 2.6 Calculation of Z-factor

[0054] 10 μL reaction system, set up control group and test group: test group respectively add 80 μM ATP and 100 μM HPr and 2 μM HPrK, control group add 80 μM ATP and 100 μM HPr and equal volume of distilled water, two groups each set 100 repeated experiments, 37℃ reaction 1 h, then each repeated measurement luminescence value, then calculate Z-factor.

[0055] Z factor = 1 - [(3 x SD N + 3 x SD P ) / (AVG N -AVG P )].

[0056] Wherein, AVG P represent the average of 100 luminescence values of the test group, AVG N represent the average of 100 luminescence values of the control group;

[0057] SD P represent the standard deviation between the 100 luminescence values of the test group, SD N represent the standard deviation between the 100 repeated values of the control group.

[0058] The value range of Z-factor is from -1 to 1, the closer the Z-factor is to 1, the better the repeatability of the experiment is, and the more obvious the effect is. The closer the Z-factor is to -1, the worse the repeatability of the experiment is, and the less obvious the effect is. Z-factor of 0 indicates that the repeatability of the experiment is general.

[0059] As shown in Figure 3 , the Z value is 0.82, which indicates that the repeatability of the experiment in this embodiment is good, and the effect is obvious.

[0060] 2.7 Comprehensive analysis

[0061] In summary, the determination of the optimal conditions, finally, the present application determines that the HPrK enzyme activity reaction system is in the mixed system of 80 μM ATP concentration, 100 μM HPr, 2 μM HPrK, and the reaction time is 1 h. The measured Z-factor is 0.82, and the present application meets the high-throughput screening method standard (0.5 < Z-factor < 1).

[0062] 2.8 Screening of target inhibitors

[0063] (1) Test group: 10 μL enzyme activity reaction solution was added in a black U-bottom 384-well plate, containing a mixture of NaCl at a final concentration of 150 mM, MgCl2 at 10 mM, Tris-HCl at 50 mM (pH 8.0), HPr at 100 μM, HPrK at 2 μM and ATP at 80 μM, and 0.5 mM inhibitor dissolved in dimethyl sulfoxide (DMSO); at the same time, a positive control of adding kinase and a negative control of not adding kinase were set. Each test was repeated 10 times.

[0064] (2) The above 384-well plate was incubated at 37°C for 1 h, then taken out and cooled at room temperature for 5 min, and 10 μL Reagent for kinase activity detection was added, and after 10 min of reaction, the luminescence value RLU was measured by an enzyme label instrument.

[0065] (3) The inhibition rate of the enzyme activity of the inhibitor was calculated by the following formula:

[0066] Inhibitor enzyme activity inhibition rate = (luminescence value of the tested inhibitor - average luminescence value of the positive group) / (average luminescence value of the negative group - average luminescence value of the positive group).

[0067] (4) According to the above steps, the kinase inhibitor drug library HY-L001 (1133 inhibitors as shown in A of Figure 4 ) of MedChem Express Company was screened, and an inhibitor CDK9-IN-2 with an HPrK enzyme activity inhibition rate of 99% was obtained. As shown in A and B of Figure 4 , the name of the compound is N2-(trans-4-aminocyclohexyl) 5-chloro-N6-(3-fluorobenzyl)-[2,4-pyridine]-2,6-diamine.

[0068] The purpose of the above steps is to establish a suitable enzyme activity reaction system, so that the enzyme reaction reaches a steady state, so that the inhibition efficiency of the kinase HPrK inhibitor on the kinase can be verified. The content of the bacterial kinase HPrK is not high, and if the kinase HPrK set in the above enzyme activity reaction system is too high, the inhibitor that can inhibit the bacteria may be ineffective due to the high HPrK in vitro, and is excluded.

[0069] Therefore, the enzyme activity reaction system used in the above step for inhibitor screening is an experiment based on the activity of a kinase (HPrK) in bacteria, which is taken as a drug action target, and inhibitors are screened through the target, and then experiments of inhibiting or killing bacteria are carried out on living bacteria. Based on the above enzyme activity reaction system, the kinase HPrK screened has an optimal inhibition rate of 99% for the inhibitor CDK9-IN-2 at 2 μM.

[0070] The class of compounds for responding to the kinase to be screened in the present step has been disclosed in patents CN102482218B and CN101568529A, and the above patents both propose that the class of compounds has the effect of regulating or inhibiting protein kinases.

[0071] 2.9 Determination of antibacterial activity of inhibitors

[0072] The minimum inhibitory concentration (MIC) and the minimum bactericidal concentration (MBC) of the inhibitor CDK9-IN-2 screened in the above experiment were determined for different bacteria. Test group: 100 μL of medium containing different concentrations of the inhibitor drug was mixed with 100 μL of different bacteria with a concentration of 1 × 10 6 CFU / mL in a 96-well plate, and incubated at 37°C for 18-20 hours. The concentration of the inhibitor was set to 1, 2, 4, 8, 16, 32, 64, and 128 μg / mL. Positive control group: 100 μL of different bacteria with a concentration of 1 × 10 6 CFU / mL was mixed with 100 μL of medium in a 96-well plate. Drug negative control group: 100 μL of different concentrations of the drug was mixed with 100 μL of medium in a 96-well plate. Blank control group: only 200 μL of medium was added to a 96-well plate.

[0073] From the 96-well plate, 50 μL of the drug and bacteria mixture that may reach the minimum inhibitory concentration (MIC) was taken and added to solid agar medium, and after incubation for 24 hours, the growth of bacteria on the solid medium was observed for the first time. When there is no bacterial growth at a certain concentration, it indicates that the drug concentration may have reached or exceeded the minimum bactericidal concentration (MBC). In order to accurately determine the MBC, this operation needs to be repeated at multiple concentrations close to the MIC, and the lowest sterile growth concentration is found. In the present test, the concentration of the bacterial suspension used for testing was 1 × 10 4 CCU for Mycoplasma hyosynoviae.

[0074] As shown in Figure 5 , the minimum inhibitory concentration (MIC) and the minimum bactericidal concentration (MBC) of the inhibitor CDK9-IN-2 for different bacteria were determined.

[0075] 2.10 Determination of the antibacterial activity of the inhibitors in vivo in G. mellonella

[0076] The method of infecting G. mellonella larvae with S. suis is as follows: 1 x 10 6 S. suis in log phase of growth was inoculated into the penultimate left abdominal segment of the larvae (10 per group), and 0, 8, 16 mg / kg·bw of CDK9-IN-2 was injected into the penultimate right abdominal segment (10 per group) respectively. The control group was injected with normal saline without S. suis infection (Mock). The survival rate of the larvae was recorded every 6 h, and the observation was continued for 78 h. As shown in Figure 2.10, panel A is the survival curve of the four groups of G. mellonella, and panel B is the survival status of G. mellonella after 24 h. Figure 6 Figure 2.10: Determination of the antibacterial activity of the inhibitors in vivo in G. mellonella

Claims

1. The application of CDK9-IN-2, a serine protein kinase inhibitor of Streptococcus suis (HPrK), in the preparation of antibacterial drugs, characterized in that, The structural formula of the inhibitor is as follows: ， The molecular formula of the inhibitor is C 23 H 25 ClFN5, with a molecular weight of 425.93, is an antibacterial drug used to inhibit the growth of Gram-positive bacteria, specifically Streptococcus suis.

2. The use according to claim 1, characterized in that, The drug exerts its antibacterial effect by inhibiting the activity of streptococcal serine protein kinase HPrK.

Images