Sorghum dwarf gene PCR (Polymerase Chain Reaction) detection primer and application thereof

Abstract

The invention discloses a sorghum dwarf gene PCR (Polymerase Chain Reaction) detection primer and application thereof, and belongs to the technical field of biology. The specific PCR primer is designed and compared with a wild sorghum sequence after being subjected to PCR amplification, so that whether a germplasm resource contains the dwarf gene or not can be determined, the mutation site and the mutation type of the dwarf gene can be determined, and a foundation is laid for quickly screening dwarf sorghum varieties, performing cross breeding in the next step and the like.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a sorghum dwarfing gene PCR detection primer and application thereof. Background Art

[0002] Sorghum (Sorghum bicolor (L.) Moench) is an important grain crop and brewing raw material in my country. At present, the sorghum industry urgently needs to use dwarfing genes to achieve lightweight and simple cultivation. Appropriately reducing plant height and enhancing plant lodging resistance and other traits that are conducive to mechanized operations have become important directions in sorghum breeding.

[0003] In the study of sorghum plant height traits, four unlinked independent loci dwarfing genes, Dw1, Dw2, Dw3 and Dw4, have been identified. These four loci regulate plant height by changing the length of the internodes, and tall stalks are partially dominant over short stalks. If the above four genes are homozygous recessive in sorghum, the purpose of reducing sorghum plant height can be achieved. Among them, Dw1, Dw2 and Dw3 have been successfully cloned and can be directly applied to sorghum breeding practice. These four loci that control plant height have been successfully located in the genetic map. From the perspective of gene function, Dw1 is a component of the brassinosteroid signaling pathway, interacts with BIN2 (BRASSINOSTEROID INSENSITIVE 2), a negative regulator of BR signaling, inhibits its nuclear localization, positively regulates the BR signaling pathway, regulates cell division, and affects plant height. The Dw2 gene encodes a protein kinase that is homologous to KIPK, a member of the AGCVIII subgroup of the AGC protein kinase family in Arabidopsis. The Dw3 gene encodes the ABCB1 auxin transporter, which, like the Pin family proteins, regulates plant height through auxin levels.

[0004] Currently, there is no systematic detection method for Dw1, Dw2 and Dw3 genes. Dw1 and Dw2 each have one allelic mutation, and Dw3 gene has seven allelic mutation types. It is particularly important to control the agronomic trait of sorghum plant height in breeding operations by simple operations to find out whether the germplasm resources contain dwarfing genes and to find out the mutation type of the dwarfing genes. Summary of the invention

[0005] The purpose of the present invention is to provide a sorghum dwarfing gene PCR detection primer and its application to solve the problems existing in the above-mentioned prior art. By designing specific primers, different dwarfing genes and their mutation sites and mutation types can be distinguished by using PCR amplification products, laying a foundation for the next step of sorghum hybrid breeding.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a sorghum dwarfing gene PCR detection primer, comprising any one pair of the following:

[0008] Primer pair for amplifying sorghum dwarfing gene Dw1:

[0009] Dw1F: 5'-TGGCGGTCCAACGTCTAAT-3', Dw1R: 5'-CCTGAAGTATGGCGTGTCG-3';

[0010] Primer pair for amplifying sorghum dwarfing gene Dw2:

[0011] Dw2F: 5'-CAGTTCAAATCAACGAGGAG-3', Dw2R: 5'-TCCGTCGTGAAATGAGAAT A-3';

[0012] Primer pair for amplifying sorghum dwarfing gene Dw3:

[0013] Dw3F: 5'-CCGTCATCGTCCAGAACTCG-3', Dw3R: 5'-CTTGAGCAGGTGCGAGTG CGA-3'.

[0014] The invention also provides a sorghum dwarfing gene detection kit, comprising the detection primers.

[0015] The present invention also provides the use of the detection primer or the detection kit in identifying different sorghum dwarfing genes.

[0016] The present invention also provides the use of the detection primer or the detection kit in screening sorghum dwarfing genes.

[0017] The present invention also provides application of the detection primer or the detection kit in breeding of dwarf sorghum varieties.

[0018] The present invention also provides a method for identifying different sorghum dwarfing genes, comprising the following steps:

[0019] The genomic DNA of the sorghum sample to be detected is used as a template, PCR amplification is performed using the detection primers, and the genotype of the sorghum dwarfing gene is determined according to the band type of the amplified product.

[0020] Optionally, the sorghum dwarfing genes include Dw1, Dw2 and Dw3,

[0021] The PCR program for the Dw1 gene was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 45 s, annealing at 56°C for 45 s, extension at 72°C for 60 s, 34 cycles; final extension at 72°C for 15 min;

[0022] The PCR program for the Dw2 gene was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 45 s, annealing at 58°C for 45 s, extension at 72°C for 60 s, 34 cycles; final extension at 72°C for 15 min;

[0023] The PCR program for the Dw3 gene was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 45 s, annealing at 58°C for 45 s, extension at 72°C for 90 s, 34 cycles; and final extension at 72°C for 15 min.

[0024] Optionally, the reaction system for PCR amplification is: 1 μL of DNA template, 1 μL of forward primer and 1 μL of reverse primer, 12.5 μL of 2×PCR premix and 9.5 μL of ddH2O.

[0025] Optionally, the judgment criteria are:

[0026] The sequence shown in SEQ ID NO.1 or a gene fragment containing the 1151-1577th position of the sequence is amplified using primers Dw1F and Dw1R. If the base at the 1350th position in the sequence is T, the genotype is dw1, and the phenotype is short-stalked sorghum; if the base at the 1350th position in the sequence is not T, the genotype is Dw1, and the phenotype is tall-stalked sorghum;

[0027] The sequence shown in SEQ ID NO.2 or a gene fragment containing the 485th to 1481th positions of the sequence is amplified using primers Dw2F and Dw2R. If the bases GA at positions 549 to 550 are missing in the sequence, the genotype is dw2, and the phenotype is short-stalked sorghum; if the bases GA at positions 549 to 550 in the sequence are GA, the genotype is Dw2, and the phenotype is tall-stalked sorghum.

[0028] The sequence shown in SEQ ID NO.3 or the gene fragment containing the 5297-7234th position of the sequence was amplified using primers Dw3F and Dw3R. Any of the following mutant phenotypes showed dwarf sorghum: (1) If the fragment shown in the 6204-7085th position was inserted into the sequence, the genotype was dw3; (2) If the base at the 5406th position in the sequence was C, the genotype was dw3; (3) If the base at the 5668th position in the sequence was G, the genotype was dw3; (4) If the bases CG at positions 5967-5968 in the sequence are missing, the genotype is dw3; (5) If the bases at positions 5485-5566 in the sequence are missing, the genotype is dw3; (6) If the bases at positions 5820-5825 in the sequence are repeated, the genotype is dw3; (7) If the bases at positions 5997-6011 in the sequence are missing, the genotype is dw3.

[0029] The present invention discloses the following technical effects:

[0030] The present invention uses three pairs of independently designed primers to perform PCR amplification on the Dw1, Dw2, and Dw3 genes respectively, and compares the amplified fragments with the gene fragments corresponding to the wild type of sorghum, so as to clarify whether the germplasm resources contain dwarfing genes, and clarify the gene mutation sites and mutation types. The present invention can realize sorghum dwarfing gene detection through simple amplification detection, wherein, the homozygous recessiveness of any one of the Dw1, Dw2, and Dw3 genes can show dwarfing characteristics. The present invention can quickly screen out sorghum varieties with dwarfing genes by determining the mutation sites and mutation types of dwarfing genes, and lay the foundation for efficient breeding work such as hybridization in the next step, which is convenient for quickly screening excellent target sorghum varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0032] Figure 1 The results of detecting Dw3 mutant genes in some sorghum varieties are shown in Figure 1. Lane 1 is a DNA standard molecule, and lanes 2-6 are DNA amplification products of five sorghum varieties, namely BTx623, 8R277, 8R262, 8R037, and 8R417.

[0033] Figure 2 These are the gene sequencing results of sorghum varieties 8R277, 8R262, 8R037, and 8R41Dw3. DETAILED DESCRIPTION

[0034] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0035] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0036] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0037] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0038] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0039] Example 1

[0040] 1. Genome extraction

[0041] About 5 g of fresh, young sorghum leaves were collected and ground thoroughly with liquid nitrogen; DNA was extracted using a high-efficiency plant genomic DNA extraction kit (DP350) produced by Tiangen Biochemical Technology Co., Ltd.

[0042] 2. PCR amplification

[0043] PCR reaction system: 1 μL DNA, 1 μL forward primer and 1 μL reverse primer, 12.5 μL 2×PCR premix, 9.5 μL ddH2O, total volume 25 μL; amplification was performed using BIORAD T100 TM PCR instrument, and the primer sequences are shown in Table 1.

[0044] Table 1 Primer sequences

[0045] Primer name Sequence number Primer sequence (5'-3') oeLh SEQ ID NO.4 TGGCGGTCCAACGTCTAAT oeLh SEQ ID NO.5 CCTGAAGTATGGCGTGTCG oeLh SEQ ID NO.6 CAGTTCAAATCAACGAGGAG oeLh SEQ ID NO.7 TCCGTCGTGAAATGAGAATA oeLh SEQ ID NO.8 CCGTCATCGTCCAGAACTCG oeLh SEQ ID NO.9 CTTGAGCAGGTGCGAGTGCGA

[0046] The PCR program for the Dw1 gene was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 45 s, annealing at 56°C for 45 s, extension at 72°C for 60 s, 34 cycles; and final extension at 72°C for 15 min.

[0047] The PCR program for the Dw2 gene was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 45 s, annealing at 58°C for 45 s, extension at 72°C for 60 s, 34 cycles; and final extension at 72°C for 15 min.

[0048] The PCR program for the Dw3 gene was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 45 s, annealing at 58°C for 45 s, extension at 72°C for 90 s, 34 cycles; and final extension at 72°C for 15 min.

[0049] 3. Test results

[0050] The fragment was amplified using primers Dw1F and Dw1R in Table 1, and the size of the amplified product was about 427 bp. Sanger sequencing was performed using primer Dw1, and the fragment was compared with the wild-type sorghum Dw1 gene fragment (gene number Sobic.009G229800 in the database, database website https: / / phytozome-next.jgi.doe.gov / ). If the base at position 1350 of the Dw1 gene sequence shown in SEQ ID NO.1 is T, the genotype is dw1, and the genotype is Dw1 otherwise.

[0051] The fragment was amplified using the primers Dw2F and Dw2R in Table 1, and the fragment size of the amplified product was about 997 bp. Sanger sequencing was performed using the Dw2 primer and compared with the wild-type sorghum Dw2 gene fragment (gene number Sobic.006G067700 in the database, database website https: / / phytozome-next.jgi.doe.gov / ). If the bases GA at positions 549 and 550 in the Dw2 gene sequence shown in SEQ ID NO.2 were missing, the genotype was dw2; if GA was present at positions 549 and 550 in the Dw2 gene sequence shown in SEQ ID NO.2, the genotype was Dw2.

[0052] The fragments amplified with the primers Dw3F and Dw3R in Table 1 were compared with the wild-type sorghum Dw3 gene fragment (gene number Sobic.007G163800 in the database, database website https: / / phytozome-next.jgi.doe.gov / ). In the following 7 cases, the genotype can be judged as dw3. When the mutation type is dw3-ref, the PCR product size is about 2165bp, and the size of the PCR product of the other 6 mutations is about 1280bp. Except for dw3-ref, all other dw3-ref mutations need to be sequenced with Dw3 primers for Sanger sequencing, and the alignment positions are shown in Table 2.

[0053] Table 2

[0054] Serial number serial number DNA mutation location 1 dw3-ref Insertion of 882 bp fragment from position 6204 to 7085 2 dw3a The 5406th position changes from A to C 3 dw3b The 5668th position changes from A to G 4 dw3c Two bases are missing at positions 5967-5968 5 dw3-sd3 Position 5485-5566, 82 bp missing 6 dw3-sd4 Position 5820-5825, 6 bp repeat 7 dw3-sd5 Position 5997-6011, 15 bp deletion

[0055] Note: The sites in the table are determined based on the Dw3 gene sequence shown in SEQ ID NO.3.

[0056] Example 2

[0057] The Dw3 mutant gene in sorghum varieties BTx623, 8R277, 8R262, 8R037 and 8R417 (these sorghum varieties have been published, refer to "Wang, P., Liang, B., Li, Z., Wang, C., Zhang, L., & Lu, X. (2024). Novel Allelic Mutations in Dw3 Gene That Affect the Height of Sorghum Plants. International Journal of Molecular Sciences, 25 (22), 12000." and can be obtained from Wang Ping, Institute of Plant Protection, Liaoning Academy of Agricultural Sciences) was detected, and genomic DNA was extracted from each, and then amplified using the Dw3F and Dw3R primers and reaction conditions of Example 1. The results are as follows: Figure 1 shown.

[0058] The results showed that the sorghum variety BTx623 had a fragment size of more than 2000 bp after PCR amplification, which determined that BTx623 contained the dw3-ref mutant gene. The other four varieties contained other mutant forms of the Dw3 gene. Further sequencing results were as follows Figure 2 As shown, the results showed that the 5406 position of 8R262 changed from A to C, so it was the second mutation form (dw3a). The 5967 and 5968 positions of 8R417 were missing, which was the fourth mutation form (dw3c). The other two varieties were wild-type.

[0059] Dw1 gene sequence (SEQ ID NO.1):

[0060]

[0061] Dw2 gene sequence (SEQ ID NO.2):

[0062] ATGCAGCAGCCGTTCTACGGCCGGCCTCCCACCCAGATGAAGGTGCAGCTCGTGGAACAGGAGGGCTCCAAGAGGATGGGCTCTTCCGGGTGCTCGGAGATCGTCGAACTGGTGGACGAGCCGAAGGATGCTCGTCCGGGTGGGCTTACCCACCTGAGGGTGAGGGTGAAGCCAGTGGGGCAGGAGCATGGGGCGCGGTCGTGCTCGGTGGAGGATGATCTTGACCAGCTCATCAGATCGATCAACGTGCGCACGTCGGCGAGGGCTTCTGGGCAGACGAGCACGGATCGGCGGCTTATTGCGCTCGGGAAGTCGCCGGTGTCGAGCTCGGAGATTGTGGAGTCTGTGAGCCTGAAGCAGGCCCTGAGGAAGATGTGCATCTCCCAGGCGTCGGAGATGGCAGCCATGAAGAGGCTTTCGAAGCCGACAGGGGTGTCCACCCCTTCTGATTCTGGGCCAATCAAGAAGCTATATGGCTCTGTTGCAGTTCAAATCAACGAGGAGCAAGATGACAAGAGTAAGGCGGGGAAAGTTTCTATGCTGCCTGAGAAATTGGCAGGAAGTTCAGTGGGTAAGCCAAGTGGAATCGGTAAGGGGCAGAGCAAGAGCTCGGCCAAGAAGAATTTGAGATCAGCATCTCCTACCACTGGCAAGGTTCATAAGACCAGAATCCAAGATGTGATCAGTAACAAGTCATCAGAGGGAGTTGAAGATATTTCTGTAGGAGCAACACTGCCAAAACAGAGGAAGGGAAAATCTGTGAAAACATCTAGCCCCCGGGCTGTTCCAGTAGGTGGCTCACGGCTGGTGAGGCCAATGTTTCGGAATAAAACCTCGACGAAAAAGAAGGTCAAACCTGAACCTGCTATAGTGCCCGCATCACACAAGCATTGTGAGACGAAAGGTCCTAAATCTCACACTAGTAAACAGCAG

[0063] GAGCCCTTTCAGGATGAACCCAGAACCCCAGCACCGACTAACAAGAAGGCTGCTGTCA

[0064] GCTCCACCACCGTTGATGGAGCTGATTTTGGCACCAAAGGATGTGTTGGTGTGATCCAT

[0065] GGCTCAAAGGTTGGTGAATTGTCGAGATCAAAGGAGAAGGGCGAATGCTCCCAAAGCT

[0066] CTAAGAGTAGCATTGGTGATTATAGCACCAGCACAAGTATCAGTGAGGACAGTTATGGC

[0067] AGCTTCAGTGCTAATGGAAGCAGGCCTCACATGTCAAAGGATGTGAGATGGGGAGCCAT

[0068] TAGGCGCATGGCTATCCAACAAGGGAGCTTGGGATTGAAGAACTTCAAGCTTATCAAAC

[0069] AACTTGGTTGTGGGGACATTGGCACTGTTTATTTGGCTGAGTTAGTGGGCTCAGACTGCA

[0070] TGTTTGCATTGAAGGTTATGGACATTGAGTACCTCATAAGCAGAAAGAAAATGCTCAGA

[0071] GCACAAACTGAGAGGGAGATACTGCAAATGCTCGACCATCCATTCCTTCCAACTCTTTAT

[0072] TCTCATTTCACGACGGACAACCTTTCTTGTCTGGTAATGGAGTTCTGCCCTGGTGGTGAC

[0073] CTACATGTCCTTAGGCAGAAACAACCTACCAAAACCTTTTCGGAAGCAGCTGCAAGGTA

[0074] TGAACTTATAGTCATGTTATCGATGTGCTATCATTATGCACTAATACACATGTATCTGTCAT

[0075] GATTGAGCTGCTTTACCAAGAACTAAAAACGGTGACTATATAACCTCGCTGTGTTTGGTA

[0076] CCAGATAGATGTTTTTTGTCCTGTGATAGTATATCCCGCTATTGTAATCCTCCTGTGATAGT

[0077] ATATCCCGCTATTGTAATCCAATATTTTACAATTTTTTTATATAGGTTGTATTTTGCTAGTGA

[0078] GTTATTGTAAATTAAGAGAATTTACATTTTATTTATATGTTTCATTTTAGTACTGAGCTATTG

[0079] TAACTCGAGAAATCTACATTTTGTAGGTTTTATGTCGCTGAAGTCCTCTTAGCCTTGGAGT

[0080] ATCTCCATATGTTGGGGGTCATATACCGTGATCTGAAGCCAGAGAACATACTTGTTCGTG

[0081] AAGATGGGCACATCATGCTCTCAGATTTTGATCTGTCTCTGAGGTGCTCAGTGAGCCCAA

[0082] TGCTTGTGAGAACATCATCAGTAGGCAGAGATGAGCCCAGTAGGCCTTCTGGTCCCTGT

[0083] GCACAAAGCTGCATTGATCCCCTGTGTATCCAGCCATCCTGGAGCAATTCGTCCTGCTTC

[0084] ACGCCCCGTTTGGTTTCGTCTACACCATCAAGGACACGGAGGCCTAGAGCTGAGCCCCT

[0085] GAAGAAACCATCACTTCCACAGCTCGTTGTTGAGCCCACGGAAGCAAGATCAAATTCAT

[0086] TTGTTGGGACCCATGAATATCTTGCCCCAGAGATCATTCGAGGAGATGGCCATGGTAGCT

[0087] CGGTGGATTGGTGGACTCTTGGAATCTTCCTTTACGAATTACTCTACGGTAAGACACCAT

[0088] TCAAGGGACCTGGCAATGAGGAAACACTCTCAAATGTGATCTCACAGGGCTTGAAGTTC

[0089] CCTGACAACCCAGCTGTAAGCTTCCACGCACGAGATCTTATCAGAGGGCTGCTTGTGAA

[0090] AGAGCCAGAGTGCCGGCTCGGCTCGTCGAGAGGAGCCGCTGAGATTAAACGGCATCCC

[0091] TTCTTCGAAGGCCTAAACTGGGCCTTGATCCGGTGGACTGCGCCACCAGAGACCCCGAA

[0092] GAACATTGATACTGCAGCAGCACTCGCGACACGCAAGAAAAAGGAAGGCAAATGTCTG

[0093] GAATTCCGGCTGAATGGCGACGACATCGAGTTCGAGCTCTTTTAG。

[0094] Dw3 gene sequence (SEQ ID NO.3):

[0095]

[0096] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A sorghum dwarfing gene PCR detection primer, characterized in that: Include any pair of the following: Primer pair for amplifying sorghum dwarfing gene Dw1: Dw1F: 5'-TGGCGGTCCAACGTCTAAT-3', Dw1R: 5'-CCTGAAGTATGGCGTGTCG-3'; Primer pair for amplifying sorghum dwarfing gene Dw2: Dw2F: 5'-CAGTTCAAATCAACGAGGAG-3', Dw2R: 5'-TCCGTCGTGAAATGAGAAT A-3'; Primer pair for amplifying sorghum dwarfing gene Dw3: Dw3F: 5'-CCGTCATCGTCCAGAACTCG-3', Dw3R: 5'-CTTGAGCAGGTGCGAGTG CGA-3'.

2. A sorghum dwarfing gene detection kit, characterized in that: Comprising the detection primer described in claim 1.

3. Use of the detection primer according to claim 1 or the detection kit according to claim 2 in identifying different sorghum dwarfing genes.

4. Use of the detection primer according to claim 1 or the detection kit according to claim 2 in screening sorghum dwarfing genes.

5. Use of the detection primer according to claim 1 or the detection kit according to claim 2 in the breeding of dwarf sorghum varieties.

6. A method for identifying different sorghum dwarfing genes, characterized in that: The following steps are involved: The genomic DNA of the sorghum sample to be detected is used as a template, PCR amplification is performed using the detection primers described in claim 1, and the genotype of the sorghum dwarfing gene is determined according to the band type of the amplified product.

7. The method according to claim 6, characterized in that The sorghum dwarfing genes include Dw1, Dw2 and Dw3, The PCR program for the Dw1 gene was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 45 s, annealing at 56°C for 45 s, extension at 72°C for 60 s, 34 cycles; final extension at 72°C for 15 min; The PCR program for the Dw2 gene was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 45 s, annealing at 58°C for 45 s, extension at 72°C for 60 s, 34 cycles; final extension at 72°C for 15 min; The PCR program for the Dw3 gene was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 45 s, annealing at 58°C for 45 s, extension at 72°C for 90 s, 34 cycles; and final extension at 72°C for 15 min.

8. The method according to claim 6, characterized in that The reaction system of the PCR amplification is: 1 μL of DNA template, 1 μL of forward primer and 1 μL of reverse primer, 12.5 μL of 2×PCR premix and 9.5 μL of ddH2O.

9. The method according to claim 6, characterized in that The criteria for judgment are: The sequence shown in SEQ ID NO.1 or a gene fragment containing the 1151-1577th position of the sequence is amplified using primers Dw1F and Dw1R. If the base at the 1350th position in the sequence is T, the genotype is dw1, and the phenotype is short-stalked sorghum; if the base at the 1350th position in the sequence is not T, the genotype is Dw1, and the phenotype is tall-stalked sorghum; The sequence shown in SEQ ID NO.2 or a gene fragment containing the 485th to 1481th positions of the sequence is amplified using primers Dw2F and Dw2R. If the bases GA at positions 549 to 550 are missing in the sequence, the genotype is dw2, and the phenotype is short-stalked sorghum; if the bases GA at positions 549 to 550 in the sequence are GA, the genotype is Dw2, and the phenotype is tall-stalked sorghum. The sequence shown in SEQ ID NO.3 or the gene fragment containing the 5297-7234th position of the sequence was amplified using primers Dw3F and Dw3R. Any of the following mutant phenotypes showed dwarf sorghum: (1) If the fragment shown in the 6204-7085th position was inserted into the sequence, the genotype was dw3; (2) If the base at the 5406th position in the sequence was C, the genotype was dw3; (3) If the base at the 5668th position in the sequence was G, the genotype was dw3; (4) If the bases CG at positions 5967-5968 in the sequence are missing, the genotype is dw3; (5) If the bases at positions 5485-5566 in the sequence are missing, the genotype is dw3; (6) If the bases at positions 5820-5825 in the sequence are repeated, the genotype is dw3; (7) If the bases at positions 5997-6011 in the sequence are missing, the genotype is dw3.

Images