Use of circular RNA CIRC8341 in leukemia
By targeting the circular RNA CIRC8341 and utilizing siRNA, shRNA, or sgRNA technologies, the proliferation of leukemia cells is inhibited and their differentiation is promoted, thus solving the problem of the lack of effective treatment methods in existing technologies and achieving effective treatment for leukemia.
Patent Information
- Application Number
- CN202510098687.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-22
- Publication Date
- 2026-06-09
- Estimated Expiration
- 2045-01-22
Smart Images

Figure CN119868396B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of circular RNA CIRC8341 in leukemia. Background Technology
[0002] Leukemia is a clonal stem cell cancer characterized by the arrest of proliferation and maturation of immature hematopoietic progenitor cells, leading to bone marrow failure, which in turn increases the risk of infection and bleeding, and reduces overall survival (OS), especially in the acute myeloid leukemia (AML) subgroup, where the 5-year survival rate is only 31.7% (95% CI, 31.0%–32.3%). Leukemia exhibits heterogeneous cellular genomic profiles, treatment sensitivity, and prognosis. With advancements in next-generation sequencing technologies and increased understanding of the molecular basis of leukemia, molecular data are increasingly being incorporated into diagnostic and treatment recommendations. For example, the AML genome contains 13 altered genes, five of which are recurrently altered, including FLT3, NPM1c, DNMT3A, IDH1, IDH2, TET2, RUNX, TP53, and NRAS. Since 2017, many drugs for the treatment of acute myeloid leukemia (AML) have received regulatory approval in molecularly defined subgroups (FLT3 [midotinib, quizartinib, and gilteritinib], IDH1 [ivosidenib and olutasidenib], IDH2 [enasidenib]) and unknown subgroups (glasdegib, CPX-351, oral azacitidine, and combinations of hypomethylating agents with venetoclax). However, treatment options remain lacking for numerous other leukemia types with unknown gene variants. Furthermore, the high relapse rate in the early stages of treatment for these types of leukemia poses a significant challenge to their management. Therefore, it is necessary to adopt new approaches to examine the biological characteristics of leukemia and to delve deeper into its pathogenesis in order to find new early diagnostic and treatment methods to effectively improve the survival rate of leukemia patients.
[0003] Circular RNAs (circRNAs) are a class of covalently closed endogenous ncRNAs. Most circRNAs are derived from exon or intron sequences through backsplicing of precursor RNA. Advanced high-throughput RNA sequencing and experimental techniques have enabled the identification and characterization of circRNAs, including novel biogenesis types, tissue-specific and cell-specific expression patterns, epigenetic regulation, translational potential, localization, and metabolism. Increasing research indicates that circRNAs participate in various cellular processes, and their dysregulation is involved in the pathogenesis of various diseases, particularly cancer. Due to their high stability, circRNAs have the potential to serve as excellent cancer-specific therapeutic targets, and significant progress has been made in the treatment of breast cancer, liver cancer, colon cancer, and lung cancer. However, research on the important regulatory role and applications of circRNAs in leukemia is relatively limited. Summary of the Invention
[0004] To overcome the shortcomings of the prior art, the present invention provides the application of circular RNA CIRC8341 as a therapeutic target for acute myeloid leukemia in the preparation of drugs for treating leukemia.
[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0006] The first aspect of this invention discloses the use of a reagent that inhibits or reduces the expression of circular RNA CIRC8341 as shown in SEQ ID NO:1 in any of the following aspects 1) to 4):
[0007] 1) To prepare products for the treatment of leukemia;
[0008] 2) To prepare products that inhibit the progression of leukemia;
[0009] 3) Prepare products that inhibit the proliferation of leukemia cells;
[0010] 4) Prepare products that promote the differentiation of leukemia cells.
[0011] This invention discovers a circular RNA, CIRC8341, that is highly expressed in leukemia. The gene locus of CIRC8341 is on the positive DNA strand of human chromosome 5, and its gene covers a range from 70,516,308 bp to 70,522,188 bp. It can be trans-spliced to produce a 448 nt circRNA, the nucleotide sequence of which is shown in SEQ ID NO:1.
[0012] Preferably, the primers specifically amplifying the back-splicing junction site (BSJ) comprise an upstream primer and a downstream primer, the sequences of which are shown in SEQ ID NO:2-3.
[0013] Preferably, the leukemia is acute myeloid leukemia.
[0014] This invention demonstrates that knocking down CIRC8341 using siRNA technology weakens the proliferation and increases apoptosis in leukemia cell lines. It also reveals that knocking down CIRC8341 in leukemia cell lines significantly alters cell proliferation and differentiation, confirming the important role of CIRC8341 in malignant hematological malignancies. Furthermore, NOD-SCID mouse model experiments show that leukemia cells with CIRC8341 knocked down by shRNA have an inhibitory effect on tumor growth, indicating that inhibiting CIRC8341 expression can suppress the growth of leukemia cells and corresponding tumors.
[0015] Preferably, the leukemia cells include NOMO1, RS411, K562, Jurkat, Kasum1, THP-1, HL60, NB4, and MOLM13.
[0016] Preferably, the inhibition of leukemia pathogenesis involves reducing rRNA expression, thereby reducing protein translation levels.
[0017] More preferably, the reduction of rRNA expression refers to the ability of the key enzyme PolI to bind to rDNA.
[0018] This invention reveals that CIRC8341 directly affects the expression of ribosomal rRNA and the cellular translation level in leukemia. Through related molecular biology experiments, it was confirmed that CIRC8341 inhibits the translation process of oncoproteins by regulating rRNA expression. This demonstrates that the expression level of the circular RNA CIRC8341 can be regulated through genetic engineering, thereby directly inhibiting the translation process of ribosomal rRNA and proteins, which has significant value for targeted precision treatment of leukemia.
[0019] Preferably, the reagents for inhibiting or reducing the expression of circular RNA CIRC8341 include siRNA, shRNA, or sgRNA that knock down or eliminate circular RNA CIRC8341.
[0020] More preferably, the siRNA is selected from one or more of siRNA-1 or siRNA-2, the siRNA-1 sequence is shown in SEQ ID NO:8-9, and the siRNA-2 sequence is shown in SEQ ID NO:10-11.
[0021] More preferably, the sequence of the shRNA is shown in SEQ ID NO:12-13.
[0022] More preferably, the sgRNA is selected from sg CIRC8341 as shown in SEQ ID NO: 6-7.
[0023] Preferably, the product includes, but is not limited to, a drug.
[0024] A second aspect of the present invention discloses a medicament for treating leukemia, the medicament comprising a reagent that inhibits or reduces the expression of circular RNA CIRC8341 as shown in SEQ ID NO:1.
[0025] Preferably, the drug further includes pharmaceutically acceptable excipients.
[0026] More preferably, the excipients are functional pharmaceutical excipients available in the pharmaceutical field, including (but not limited to) surfactants, suspending agents, emulsifiers, and some novel pharmaceutical polymers, such as cyclodextrin, chitosan, polylactic acid (PLA), polyglycolic acid-polylactic acid copolymer (PLGA), hyaluronic acid, etc.
[0027] Preferably, the dosage form of the drug includes injection, powder, granules, capsules, and tablets.
[0028] Preferably, the method of administration of the drug includes injection or oral administration.
[0029] Compared with the prior art, the beneficial effects of the present invention are:
[0030] This invention is the first to demonstrate the important role of circular RNA CIRC8341 in leukemia. Firstly, RNase R experiments revealed the stable presence of CIRC8341 in leukemia cells, and qRT-PCR experiments confirmed its widespread high expression in leukemia cell lines. Then, knocking down CIRC8341 using siRNA technology showed decreased cell proliferation and increased apoptosis in leukemia cell lines. Further experiments in a mouse leukemia model showed that knocking down CIRC8341 expression significantly inhibited leukemia survival and significantly prolonged the lifespan of model mice, indicating that CIRC8341 can function as a therapeutic target in leukemia. Furthermore, this invention elucidates that CIRC8341 affects the pathogenesis of leukemia by regulating rRNA expression and protein translation. Its mechanism of action involves directly binding to Pol I to regulate rRNA expression, thereby regulating protein translation. Therefore, this invention provides a new theoretical basis for drug targets in leukemia and has broad application prospects in the field of medical research. Attached Figure Description
[0031] Figure 1The target knockdown effect of CIRC8341 was demonstrated. (A) RNase R assay was used to detect the stability of the circular RNA CIRC8341, with the linear transcript GUSBP15 as a negative control; GUSBP15 was significantly digested by RNase R. (B) First-generation sequencing analysis determined the trans-splicing site and length of CIRC8341. (C) qRT-PCR was used to detect the expression level of CIRC8341 in various cell lines; the above figure shows the statistical values. (D) CIRC8341 sgRNA was designed, and the knockdown effect of CIRC8341 using Cas13d was demonstrated. (E) siRNA was designed, and the knockdown effect of CIRC8341 was demonstrated. All figures use the mean ± standard deviation of three replicates. An asterisk indicates that the difference between the two groups was statistically significant (ns, no significant difference, **, p < 0.01; ***, p < 0.001).
[0032] Figure 2 CIRC8341 regulates the cellular function of leukemia cells. Specifically, (A) CCK-8 assay showed a significant decrease in the proliferation level of leukemia cell lines when CIRC8341 was knocked down; (B) flow cytometry showed a significant increase in the apoptosis level of leukemia cell lines when CIRC8341 was knocked down, with Annexin V-FITC and PI used to label apoptosis; (C) flow cytometry showed enhanced cell differentiation in leukemia cell lines when CIRC8341 was knocked down, with CD11b and CD14 serving as cell differentiation markers; and (D) Giemsa staining showed significant differentiation in leukemia cells when CIRC8341 was knocked down. All figures in this graph use the mean ± standard deviation of three replicates. An asterisk indicates that the difference between the two groups was statistically significant (***P<0.001) when compared using a t-test.
[0033] Figure 3 This study established an animal model of leukemia regulated by CIRC8341. (A) Flow cytometry was used to detect the infiltration of leukemia cells. Under CIRC8341 knockdown, infiltration was significantly reduced. CD45 is a human cell antigen, indicating leukemia cells. (B) Survival curves were used to statistically analyze the effect of CIRC8341 knockdown on the survival time of mice using MOLM-13. All figures in this study use the mean ± standard deviation of three replicates. An asterisk indicates that the difference between the two groups was statistically significant using a t-test (*, p < 0.05; **, p < 0.01; ***, p < 0.001).
[0034] Figure 4CIRC8341 regulates rRNA expression and protein translation. (A) After knocking down CIRC8341 using the CAS13d system, qRT-PCR showed a significant decrease in rRNA levels (45S, 28S, 18S, 5.8S). (B) The SUnSET assay was used to investigate the effect of CIRC8341 on protein translation, showing that knocking down CIRC8341 significantly reduced protein translation levels as detected by Western blot. Puromycin directly binds to peptide chain elongation during translation, indicating the amount of protein translated. All figures use the mean ± standard deviation of three replicates. An asterisk indicates a statistically significant difference between the two groups compared using a t-test (**, p < 0.01; ***, p < 0.001).
[0035] Figure 5 CIRC8341 binds to Pol I to regulate rRNA expression; (A) the tRSA pull-down experiment was used to verify that Pol I, the key enzyme for CIRC8341 to bind to rRNA expression, was used; (B) ChIP-qPCR was used to detect that knocking down CIRC8341 reduced the ability of Pol I to bind to rDNA. Detailed Implementation
[0036] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.
[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the experimental materials used in the following examples are all commercially available. All primer sequences used were synthesized by Beijing Ruiboxingke Biotechnology Co., Ltd.
[0038] Example 1: Expression analysis of circular RNA CIRC8341
[0039] This invention discovers a circular RNA, CIRC8341, that is specifically highly expressed in leukemia. The gene locus of CIRC8341 is located on the positive strand of human chromosome 5, covering a range from 70,516,308 bp to 70,522,188 bp. It can be trans-spliced to produce a 448 nt circRNA, the nucleotide sequence of which is shown below:
[0040] CIRC8341 gene sequence (448bp, SEQ ID NO:1):
[0041] >CIRC8341 Chr5:70516308-70522188
[0042] CTGGTGAAACCCTACAAGCGTTTCCACTCCATACGCGCTCTGAATAATGGGATTGTGATGTCTTACACCAATTCTCAAACTGGGCGGCCAGCTGCAGCCGAATCAACTCCAGGTGCCCGTAGTTGCGATACCAAGAGTAGTAGCTGTTCACACGGATCACATCCACATACAGAGCCCCCTTGTCTGCTGCGTAGGTGGAGTTGGTCCCAAAGGTCACAGGCTGG GAGGGGTCCAAGGCTTTGGTGTGAGCAATCACCATCCTCCCACGAGTACAGGTAGGCGGGGTGTTCGTGCATCAGGTACGGCCACCAGAGGTTGGCACCCAGCACCTTCAGCTGGCCCTGGGTCCCAGCCTGGTTGTCCACGACTTTGTTGTCTGATTTCAAAAGACACACTTCCAACTTGAACTGGTTACTGCACTTGACGGAGATATGGTAATTCACCAGCC.
[0043] First, to confirm the authenticity of CIRC8341, the stability of the circular RNA CIRC8341 was tested using an RNase R assay. RNase R can digest linear RNA but not circular RNA. In this embodiment, the linear transcript of the parent gene of CIRC8341, GUSBP15 (GUSB pseudogene 15; NR_034021.1), was used as a control. RNA was extracted using MOLM-13, and the stability of CIRC8341 was detected using qRT-PCR technology, followed by first-generation sequencing analysis. The experimental results showed that the circular RNA CIRC8341 was stably present in leukemia cells. Figure 1 (AB) The qRT-PCR primer sequences used in this process are as follows:
[0044] The forward primer sequence of CIRC8341 is: 5'-CAGCCTGGTTGTCCACGAC-3' (SEQ ID NO: 2);
[0045] The reverse primer sequence of CIRC8341 is: 5'-GCTCTGTATGTGGATGTGATCCGT-3' (SEQ ID NO: 3);
[0046] The forward primer sequence of GUSBP15 is: 5'-AGCATGCTGTGTCTAGCTCAAGATTTTC-3' (SEQ ID NO: 4);
[0047] The reverse primer sequence for GUSBP15 is: 5'-TGCAGGCCATCATGACTGCTCTCGACAAT-3' (SEQ ID NO: 5).
[0048] To further determine the expression specificity of CIRC8341 in leukemia, a batch of cancer cell samples were collected (see...). Figure 1 C) Detection and analysis were performed. qRT-PCR experiments revealed that CIRC8341 was generally highly expressed in leukemia cell lines compared to other cell samples (p<0.01). Figure 1 C), which suggests that CIRC8341 may play an important role in leukemia and could be a potential target for leukemia treatment. Furthermore, two methods for knocking down CIRC8341 were designed: designing CIRC8341sgRNA and using Cas13d to knock down CIRC8341 (C). Figure 1 D), and simultaneously design siRNA ( Figure 1 E); The results showed that knocking down CIRC8341 was effective (the siRNA sequence is shown in SEQ ID NO: 8-9 below). The sgRNA sequence is shown below:
[0049] Forward sequence of sg CIRC8341:
[0050] 5'-AAACGGTAATTCACCAGCCCTGGTGAAGCCTTAC-3' (SEQ ID NO: 6);
[0051] The reverse sequence of sg CIRC8341:
[0052] 5'-AAAAGTAAGGCTTCACCAGGGCTGGTGAATTACC-3' (SEQ ID NO: 7).
[0053] Example 2: Functional identification of CIRC8341 in leukemia
[0054] To address the core question of CIRC8341's role in leukemia regulation, this study aims to further investigate the function of CIRC8341 in leukemia. The MOLM-13 leukemia cell line was selected as the research subject. Using siRNA interference technology, two different siRNA sequences were designed for CIRC8341, as shown below:
[0055] Forward sequence of siRNA-1: 5'-CAGCCCUGGUGAAGCCUUA dTdT-3' (SEQ ID NO: 8);
[0056] The reverse sequence of siRNA-1: 5'-UAAGGCUUCACCAGGGCUG dTd-3' (SEQ ID NO: 9);
[0057] Forward sequence of siRNA-2: 5'-CCAGCCCUGGUGAAGCCUU dTdT-3' (SEQ ID NO: 10);
[0058] The reverse sequence of siRNA-2: 5'-AAGGCUUCACCAGGGCUGG TdTd-3' (SEQ ID NO: 11).
[0059] In the aforementioned leukemia cell lines, CIRC8341 was knocked out using siRNA-1 and siRNA-2, respectively, and cell proliferation was then assessed using the CCK-8 assay. The experimental results are as follows: Figure 2 As shown in Figure A, knockdown of CIRC8341 significantly reduced the proliferation of leukemia cells. This indicates that CIRC8341 plays an important role in maintaining leukemia cell proliferation. Simultaneously, CIRC8341 was knocked down using siRNA interference technology, and the effect of CIRC8341 on cell differentiation (CD11b and CD14 are cell differentiation markers) was detected by flow cytometry. The experimental results are as follows... Figure 2 As shown in Figure B, knockdown of CIRC8341 significantly promoted the differentiation of leukemia cells. Further studies revealed that the apoptosis rate of leukemia cells with CIRC8341 knockdown was significantly increased. Figure 2 C). Giemsa staining assays showed that leukemia cells significantly differentiated when CIRC8341 was knocked down. Figure 2 D). Therefore, based on the above cell proliferation, apoptosis and differentiation experiments, it is speculated that CIRC8341 has a potential regulatory role in the occurrence and development of leukemia.
[0060] Next, we will further verify the regulatory role of CIRC8341 in leukemia at the adult level. Using the same siRNA sequence described above, we designed the following shRNA sequence targeting CIRC8341:
[0061] The forward sequence of shRNA:
[0062] 5'-GATCCCAGCCCTGGTGAAGCCTTACTTCCTGTCAGATAAGGCTTCACCAGGGCTG TTTTTG-3' (SEQ ID NO: 12);
[0063] The reverse sequence of shRNA:
[0064] 5'-AATTCAAAAACAGCCCTGGTGAAGCCTTATCTGACAGGAAGTAAGGCTTCACCA GGGCTGG-3' (SEQ ID NO: 13).
[0065] Using the expression vector pGreenPuro from System Biosciences TM A stable CIRC8341 knockout cell line was constructed using the shRNA Cloning and Expression Vector lentiviral expression system, and the MOLM-13CIRC8341 knockout cell line was obtained through puromycin selection. Subsequently, the validated stable MOLM-13CIRC8341 cell line was expanded and cultured, and then injected into 5-week-old NOD-SCID mice via tail vein injection: 21 mice per group, 3 groups in total (sh-NC, sh-CIRC8341, PBS); 150 μL of cells per mouse, with a cell injection volume of 1 × 10⁻⁶ cells. 6 Each one was tested. Finally, the human marker CD45 was detected using flow cytometry. The results are as follows: Figure 3 As shown in Figure A, in mice inoculated with sh-CIRC8341, the growth of leukemia cells in various organs was significantly slower than in the control group, suggesting that CIRC8341 may be a potential target for treating this type of leukemia. Further analysis using Log-rank (Mantel-Cox) test survival curves revealed that the survival rate of mice with CIRC8341 knockdown was higher than that of the control group. Figure 3 B) This suggests that specifically targeting the highly expressed CIRC8341 may be a potential strategy for treating leukemia.
[0066] Example 3: CIRC8341 regulates rRNA transcription and protein translation
[0067] Both at the cellular level and in vitro mouse experiments, CIRC8341 significantly affected the function of leukemia cells. So, how does CIRC8341 directly regulate this type of disease? To this end, qRT-PCR was used to further verify the effect of CIRC8341 on rRNA. The results showed that knocking down CIRC8341 with sgRNA significantly reduced rRNA levels. Figure 4 A); The effect of CIRC8341 on protein translation was detected using the SUnSET assay. The results showed that knocking down CIRC8341 with shRNA-1 and shRNA-2 significantly reduced protein translation levels. Figure 4B). These results indicate that CIRC8341 influences the pathogenesis of leukemia by regulating rRNA expression and protein translation. Furthermore, to investigate the mechanism by which CIRC8341 regulates rRNA, a TRSA system was constructed. The results showed that, compared to the control group, CIRC8341 directly binds to Pol I, a key enzyme in rRNA expression. Figure 5 A) After knocking down CIRC8341 with sgRNA, the ability of Pol I to bind to rDNA was weakened. Figure 5 B). These results indicate that CIRC8341 regulates rRNA expression by directly binding to Pol I, thereby regulating protein translation and ultimately affecting the pathogenesis of leukemia.
[0068] The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.
Claims
1. The use of a reagent that inhibits or reduces the expression of circular RNA CIRC8341 as shown in SEQ ID NO:1 in the preparation of a medicament for treating leukemia, characterized in that, The reagent used to inhibit or reduce the expression of circular RNA CIRC8341 as shown in SEQ ID NO:1 is selected from at least one of siRNA-1 shown in SEQ ID NO:8-9, siRNA-2 shown in SEQ ID NO:10-11, shRNA shown in SEQ ID NO:12-13, and sgRNA shown in SEQ ID NO:6-7.
2. The application according to claim 1, characterized in that, The drug inhibits the pathogenesis of leukemia and / or inhibits the proliferation of leukemia cells and / or promotes the differentiation of leukemia cells.
3. The application according to claim 1, characterized in that, The leukemia mentioned is acute myeloid leukemia.
4. The application according to claim 1, characterized in that, The leukemia cells include NOMO1, RS411, K562, Jurkat, Kasum1, THP-1, HL60, NB4, and MOLM13.
5. The application according to claim 1, characterized in that, The process of inhibiting leukemia development involves reducing rRNA expression, which in turn reduces protein translation levels.
6. The application according to claim 5, characterized in that, The reduction in rRNA expression refers to the ability of the key enzyme PolI to bind to rDNA.
7. A drug for treating leukemia, characterized in that, The drug comprises a reagent that inhibits or reduces the expression of circular RNA CIRC8341 as shown in SEQ ID NO:1, wherein the reagent is selected from at least one of siRNA-1 shown in SEQ ID NO:8-9, siRNA-2 shown in SEQ ID NO:10-11, shRNA shown in SEQ ID NO:12-13, and sgRNA shown in SEQ ID NO:6-7.
Citation Information
Patent Citations
siRNA for inhibiting expression of circ_0005050 and application thereof
CN109825503A
Application of circSATB1 inhibitor in preparation of medicine for treating acute myeloid leukemia
CN113633776A