An engineered bacterium with high yield of beta-alanine based on a type i crisperi screening system and a method

By knocking out a specific gene and overexpressing the NCgl0580 gene in Escherichia coli EcN, a type I CRISPRi screening system was constructed. This optimized carbon flux and byproduct pathways, solving the problems of high energy consumption, numerous byproducts, and carbon loss in β-alanine production, and achieving efficient and safe β-alanine production and screening.

CN119875979BActive Publication Date: 2026-06-05ZHEJIANG UNIV OF TECH
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ZHEJIANG UNIV OF TECH
Filing Date
2025-01-20
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing technologies for producing β-alanine using Escherichia coli (EcN) suffer from problems such as high energy consumption, numerous byproducts, high raw material costs, and severe carbon loss. Furthermore, the lack of effective gene screening tools makes it difficult to increase yield.

Method used

By knocking out the lacI, pckA, nadB, ldhA, and poxB genes in E. coli EcN and overexpressing the NCgl0580 gene, a type I CRISPRi screening system was constructed. Carbon flux and byproduct pathways were optimized, and a high-throughput screening system was established to screen for target genes affecting β-alanine production.

Benefits of technology

It significantly increased the yield of β-alanine, reduced carbon loss and costs during fermentation, improved screening efficiency and accuracy, and achieved efficient and safe β-alanine production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005250244910000051
    Figure BDA0005250244910000051
  • Figure BDA0005250244910000061
    Figure BDA0005250244910000061
  • Figure BDA0005250244910000062
    Figure BDA0005250244910000062
Patent Text Reader

Abstract

The application discloses a high-yield beta-alanine engineering bacterium and method based on a type I CRISPRi screening system, wherein by knocking out a pckA gene encoding oxaloacetate to phosphoenolpyruvate and a nadB gene encoding L-aspartate to oxaloacetate, a countercurrent pathway for synthesizing beta-alanine is blocked, and carbon flow loss is reduced; by knocking out an ldhA gene and a poxB gene, the content of synthesized pyruvate is increased; by overexpressing an NCgl0580 gene, the tolerance of EcN to products is improved; by knocking out a lacI gene in a genome, the adding cost of an inducing agent in a fermentation process is reduced; by optimizing a type I CRISPRi system for high-throughput screening of target genes affecting the yield of beta-alanine in the engineering bacterium, the screening efficiency and accuracy are significantly improved, an aspartate tRNA ligase gene aspS capable of improving the yield of beta-alanine is obtained, by overexpressing the aspS, the PanD enzyme activity is increased, and the yield of beta-alanine is further improved.
Need to check novelty before this filing date? Find Prior Art

Description

(I) Technical Field

[0001] This invention relates to a high-yield β-alanine engineered bacterium and method constructed based on the type I CRISPRi screening system. (II) Background Technology

[0002] Escherichia coli Nissle 1917 (EcN) is a Gram-negative probiotic, free of enterotoxins or cytotoxins associated with other pathogenic E. coli strains. It is a recognized safe strain that can prevent pathogen infection by strengthening the intestinal mucosal barrier and stimulating the immune system, and can be used for the prevention and treatment of gastrointestinal dysfunction and immune diseases. Furthermore, EcN's rapid growth makes it an ideal platform for producing metabolites, suitable for industrial fermentation.

[0003] The CRISPR-Cas system is a natural defense mechanism used by prokaryotes to resist the invasion of foreign genetic elements, and it is also widely used as a tool for gene editing and regulation. Currently, six types of CRISPR-Cas systems are known, with type II standing out due to its wide range of applications. In this system, the Cas9 protein, guided by specific guide RNAs (sgRNAs), can recognize and cleave target DNA sequences. These sequences are complementary to the sgRNA and adjacent to specific PAM sequences. The inactivated mutant dCas9 loses its ability to cleave DNA but can still locate specific DNA sequences. By positioning dCas9 in the promoter region of a gene or its non-coding strand, transcriptional activity can be inhibited, achieving a gene silencing effect. In the type I system, mature crRNA and CasA-D proteins assemble into the Cascade complex, which can recognize and bind to specific sites on the target DNA, recruiting Cas3 proteins for DNA cleavage in the process. When Cas3 function is lost, the crRNA and Cascade complex can still locate the target site, inhibiting gene transcription through physical obstruction. Although type I CRISPR-Cas systems have been found in a variety of bacteria, there is relatively little research on developing gene screening tools based on this system.

[0004] β-Alanine, also known as 3-aminopropionic acid, is a non-essential amino acid with the molecular formula C3H7O2N and a relative molecular mass of 89.09. It has wide applications in the pharmaceutical, chemical, food, and feed industries. In the pharmaceutical field, it serves as a precursor for treating gastroenteritis, tumors, and other diseases. In the chemical industry, it is used as an electroplating corrosion inhibitor and flocculant, effectively treating wastewater and preventing material corrosion. In the food industry, it is used as an additive to enhance the taste and antioxidant capacity of food, extending its shelf life. Adding β-alanine to feed can increase the carnosine content in animals, enhance their antioxidant and anti-fatigue capabilities, and improve meat quality. The synthesis methods for β-alanine include chemical synthesis, enzymatic catalysis, and fermentation. Chemical synthesis methods are diverse, but they suffer from high energy consumption, numerous byproducts, and environmental pollution. Enzymatic catalysis offers advantages such as environmental friendliness and high efficiency, but its raw material costs are relatively high. Fermentation, using glucose as a raw material, is low-cost, highly efficient, and aligns with environmental protection and sustainable development, showing promising industrial application prospects. Research on the development of *Escherichia coli* (EcN) as a chassis cell is relatively limited. The metabolic pathway for β-alanine production in EcN differs from that of other chassis strains, increasing the difficulty of research. However, as a probiotic, EcN has the advantage of not producing virulence factors, allowing engineered strains to be directly used as nutritional additives in livestock feed. Preliminary experiments have shown that EcN has a relatively fast growth rate and a high OD... 600 The value is higher than other E. coli strains, and it shows extremely high tolerance to β-alanine, which further highlights the development value of EcN as a chassis cell. (III) Summary of the Invention

[0005] The purpose of this invention is to provide a high-yield β-alanine engineered bacterium and method based on the type I CRISPRi screening system. First, the lacI gene, which regulates the lactose operon, is knocked out in the EcN genome to obtain an engineered strain that does not require IPTG induction. Second, to increase the carbon flux for β-alanine synthesis, the backflushing pathway is blocked by deleting pckA (OAA to phosphoenolpyruvate, PEP) and nadB (L-ASP to OAA). Third, by expressing the β-alanine efflux gene NCgl0580 from Corynebacterium glutamicum, the tolerance of EcN to β-alanine is improved, and the yield of β-alanine is increased. Subsequently, to further increase the carbon flux for β-alanine synthesis, the byproduct pathway is blocked by deleting ldhA (pyruvate to lactate) and poxB (pyruvate to acetic acid). The constructed engineered bacterium, using glucose as a carbon source, achieves a β-alanine yield of 1.45 g / L. Finally, based on this strain, the present invention constructed a high-throughput screening system based on the type I CRISPRi screening system, and used it to screen metabolic genes that affect β-alanine production. By overexpressing the gene on the plasmid, the β-alanine production was further improved.

[0006] The technical solution adopted in this invention is:

[0007] This invention provides an engineered bacterium that produces high levels of β-alanine, wherein the engineered bacterium is E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk / pGLO-P J23100 -panD K43Y -aspB / pSU19-P J23100 -ppC-aspA is a fungus (disclosed in patent application CN115927142A) constructed by knocking out one or more of the lacI, pckA, nadB, ldhA, and poxB genes in its genome, and overexpressing one or more of the NCgl0580 gene and the aspartate tRNA ligase gene aspS; the NCgl0580 gene is a β-alanine efflux gene derived from Corynebacterium glutamicum.

[0008] Preferably, the aspartic acid tRNA ligase gene aspS nucleotide sequence is shown in SEQ ID NO.15.

[0009] Preferably, the nucleotide sequence of the NCgl0580 gene is shown in SEQ ID NO.9.

[0010] Preferably, the NCgl0580 gene and the aspartate tRNA ligase gene aspS are overexpressed using the plasmid pGLO.

[0011] Preferably, the ppC and aspA promoters P are expressed in the chassis bacteria. J23100 Replace with promoter P tac The promoter P tac The nucleotide sequence is shown in SEQ ID NO.8.

[0012] Preferably, the engineered bacteria is one of the following: (1) knocking out the lacI gene in the genome of *Bacillus subtilis* to construct engineered bacteria ECN-7. (2) knocking out the pckA gene in the genome of engineered bacteria ECN-7, and simultaneously removing the promoter P of *Bacillus subtilis* expressing ppC-aspA. J23100 Replace with P tac (3) Knock out the nadB gene in the genome of engineered ECN-8 to construct engineered ECN-9. (4) Engineered ECN-9 was constructed using plasmid pGLO and promoter P. J23100 (5) Overexpress the NCgl0580 gene, i.e., engineered bacteria ECN-10. (6) Knock out the ldhA gene in the genome of engineered bacteria ECN-10, i.e., engineered bacteria ECN-11. (7) Knock out the poxB gene in the genome of engineered bacteria ECN-11, i.e., engineered bacteria ECN-12. (8) Engineered bacteria ECN-12, using PJ23100 The aspartate tRNA ligase gene aspS was overexpressed in the promoter and pGLO plasmid to construct the engineered strain ECN-24.

[0013] The preferred engineered bacterium ECN-24 for high β-alanine production in this invention is constructed by the following method:

[0014] (1) The panD gene and J23100 promoter from Bacillus subtilis were ligated into the pGLO vector using a one-step cloning method to obtain pGLO-P. J23100 -panD;

[0015] (2) The 43rd amino acid encoded by the panD gene derived from Bacillus subtilis on the plasmid vector was mutated by PCR to obtain the plasmid pGLO-P, which can express L-aspartate-α-decarboxylase with high enzyme activity. J23100 -panD K43Y ;

[0016] (3) Using the λ-RED recombination system, the cycA gene in the genome of E. coli Nissle 1917 was knocked out to obtain E. coli Nissle 1917ΔcycA with enhanced tolerance to intracellular β-alanine concentration;

[0017] (4) Using the λ-RED recombination system, the fumB1, aspC and pyk genes in the E. coli Nissle 1917ΔcycA gene were knocked out to obtain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk;

[0018] (5) The aspA gene and J23100 promoter from E. coli were ligated into the pSU19 vector using a one-step cloning method to obtain pSU19-P. J23100 -aspA;

[0019] (6) The fragment obtained by PCR from the ppC gene of Corynebacterium glutamicum genome was combined with pSU19-P J23100 -aspA is linked using a one-step cloning method to obtain pSU19-P J23100 -aspA-ppC;

[0020] (7) The aspB gene fragment obtained by PCR from the Corynebacterium glutamicum genome was combined with the vector pGLO-P J23100 -panD K43YpGLO-P was obtained by ligation using a one-step cloning method. J23100 -panD K43Y -aspB;

[0021] (8) Plasmid pSU19-P J23100 The J23100 promoter on -aspA-ppC was replaced with P using PCR technology and a one-step cloning method. tac Promoter, resulting in pSU19-P tac -aspA-ppC;

[0022] (9) The NCgl0590 gene from the Corynebacterium glutamicum genome and P J23100 The promoter was ligated to the pGLO vector using a one-step cloning method to obtain pGLO-P. J23100 -panD K43Y -aspB-NCgl0580;

[0023] (10) Using the λ-RED recombination system, the la cI gene, pckA gene, nadB gene, ldhA gene and poxB gene in the genome of E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk were knocked out in sequence to obtain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB;

[0024] (11) The aspS gene and P from the genome of E. coli Nissle 1917 were used to... J23100 The promoter was ligated to the pGLO vector using a one-step cloning method to obtain pGLO-P. J23100 -panD K43Y -aspB-aspS-NCgl0580;

[0025] (12) Plasmid pGLO-P J23100 -panD K43Y -aspB-NCgl0580-aspS and plasmid pSU19-P tac -aspA-ppC is transferred into competent cells of Ni issle1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB to obtain the engineered bacterium Ni ssle1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB / pGLO-P J23100 -panD K43Y-aspB-NCgl0580-aspS / pSU19-P tac -aspA-ppC, which refers to the engineered bacteria that produces high levels of β-alanine.

[0026] This invention provides a method for constructing engineered bacteria that produce high levels of β-alanine based on the type I CRISPRi screening system, the method comprising:

[0027] (1) The type I CRISPRi system includes the Cascade protein and crRNA; the Cascade protein is generated by the strict promoter P. J23100 -araC-P ara Induced expression; the crRNA is produced by P J23100 Promoter expression; the crRNA structure is repeat1-spacer-repeat2, repeat1 is 8 bp in length; repeat2 is 21 bp in length; the spacer is a randomly mutated N base and is 32 bp in length;

[0028] (2) The endogenous plasmid pMUT1 of the engineered bacteria was knocked out by CRISPR / Cas9 gene editing and transferred into the type I CRISPRi system of step (1). The target gene affecting β-alanine production was screened using the β-alanine dual fluorescence detection method.

[0029] (3) Overexpress the target gene in engineered bacteria and screen for engineered bacteria that produce high levels of β-alanine.

[0030] Preferably, the repeat1 nucleotide sequence is: ATAAACCG. The repeat2 nucleotide sequence is: GAGTTCCCCGCGCC AGCGGGG.

[0031] Preferably, the knockout of the endogenous plasmid pMUT1 is performed by replacing it with plasmid pTargetF.

[0032] This invention also provides an application of the engineered bacteria with high β-alanine production in the fermentation of β-alanine. The application involves inoculating the engineered bacteria into a fermentation medium and fermenting it in a shake flask at 37°C and 200–220 rpm for more than 12 hours. After fermentation, a fermentation broth containing β-alanine is obtained. The fermentation medium consists of: K2HPO4·3H2O 14 g / L, KH2PO4 5.2 g / L, (NH4)2SO4 2 g / L, MgSO4 0.3 g / L, tryptone 1 g / L, ddH2O as the solvent, pH 7.0, and water as the solvent. Preferably, the fermentation is carried out in a fermenter. After fermentation for 10 hours at 37°C, pH 6-8, and dissolved oxygen level maintained at 20%-50%, a feeding medium is added at a rate of 40-60 mL / min until fermentation is completed, yielding a fermentation broth containing β-alanine. The fermenter culture medium consists of: 50 g / L glucose, 28 g / L K2HPO4·3H2O, 10.4 g / L KH2PO4, 4 g / L NH4Cl, 0.6 g / L MgSO4, 2 g / L tryptone, 4 g / L yeast extract, 1 mL 10× metal ions, and 1 mL / L silicone defoamer, with water as the solvent.

[0033] The fed-batch culture medium consists of: 50 g / L glucose, 28 g / L K₂HPO₄·3H₂O, 10.4 g / L KH₂PO₄, 4 g / L NH₄Cl, 0.6 g / L MgSO₄, 2 g / L tryptone, 4 g / L yeast extract, 1 mL 10× metal ions, and 1 mL / L silicone defoamer, with water as the solvent. The amount of the fed-batch culture medium is added to maintain a residual glucose concentration of 2-4 g / L in the fermentation broth.

[0034] Preferably, the engineered bacteria are first activated by slant culture and then cultured in seed culture before fermentation. The seed culture is then inoculated into the fermentation medium at a volume concentration of 1-2%, as follows:

[0035] (1) Inoculate the engineered bacteria onto LB plates and incubate overnight at 37°C. LB plate medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 2 g / L agar, water as solvent, pH value natural. (2) Pick a single colony from step (1) and inoculate it into LB liquid medium. Incubate overnight at 37°C at 200 rpm to obtain seed culture. LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, water as solvent, pH value natural. (3) Inoculate the seed culture from step (2) into basic salt M9 medium at a volume concentration of 1-5%. Incubate for 24 hours at 37°C at 200 rpm to obtain fermentation broth containing β-alanine. Basic salt M9 medium composition: 14 g / L K2HPO4·3H2O, KH2PO4 5.2 g / L, (NH4)2SO4 2 g / L, MgSO4 0.3 g / L, tryptone 1 g / L, solvent ddH2O, pH 7.0, solvent water.

[0036] In this invention, to reduce carbon loss, the pckA gene encoding oxaloacetate to phosphoenolpyruvate and the nadB gene encoding L-aspartate to oxaloacetate were knocked out, thus blocking the retrograde pathway for β-alanine synthesis. To increase the pyruvate content, the ldhA and poxB genes, which synthesize byproducts such as lactic acid and acetic acid in the fermentation broth, were knocked out. Finally, to reduce fermentation costs and eliminate the need for induction agents, an engineered strain that does not require IPTG induction was obtained by knocking out the lacI gene on the Nissle 1917 genome.

[0037] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in: (1) The present invention reduces the cost of adding induction agent (IPTG) in the fermentation process by knocking out the lacI gene in the genome; by knocking out the pckA gene encoding oxaloacetate to phosphoenolpyruvate and the nadB gene encoding L-aspartic acid to oxaloacetate, the countercurrent pathway of β-alanine synthesis is blocked, reducing carbon loss; by overexpressing the NCgl0580 gene, the tolerance of EcN to the product is improved; by knocking out the ldhA gene and poxB gene, the content of synthesized pyruvate is increased; and a small-scale fermentation production process of β-alanine producing bacteria is established.

[0038] (2) This invention optimizes the Type I CRISPRi system for high-throughput screening of target genes affecting β-alanine production in sclerotium bacteria. The optimized system solves the quality problem of screening mutant libraries and significantly improves screening efficiency and accuracy.

[0039] (3) By overexpressing the aspartic acid tRNA ligase gene aspS, the activity of panD enzyme was increased, which further improved the yield of β-alanine.

[0040] (4) The present invention uses engineered bacteria to ferment and produce β-alanine. The fermentation process is safe and pollution-free. The fermentation liquid can not only be used to prepare industrial and food-grade β-alanine chemical raw materials, but also can be directly used to feed livestock. (iv) Description of the attached drawings

[0041] Figure 1 This is a diagram showing the biosynthesis and metabolism of β-alanine in Escherichia coli Nissle 1917.

[0042] Figure 2 The images show electrophoresis diagrams, biomass, and β-alanine production during the construction of engineered strain EcN-7 in Example 1; A represents the electrophoresis diagram of PCR of the chassis strain EcN-6 with the lacI gene knocked out, lane 1 represents the 5K Marker, lane 2 represents chassis strain EcN-6, and lanes 3 and 4 represent lacI gene knockout strains; B represents the biomass and β-alanine production of engineered strains EcN-6 and EcN-7.

[0043] Figure 3 The images show electrophoresis diagrams, biomass, and β-alanine production during the construction of engineered strain EcN-8 in Example 2; A represents the electrophoresis diagram of E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacI colony PCR with pckA gene knockout, lane 1 represents the 5K Marker, lanes 2-12 represent pckA gene knockout strains, and lane 13 represents the chassis strain EcN-6; B represents the electrophoresis diagram of colony PCR after eliminating resistance, lane 1 represents the 5K Marker, lanes 2-8 represent pckA gene knockout strains, and lane 9 represents the chassis strain EcN-6; C represents the biomass and β-alanine production of engineered strains EcN-7 and EcN-8.

[0044] Figure 4The images show electrophoresis diagrams, biomass, and β-alanine production figures for the construction of engineered strain EcN-9 in Example 3. A represents the colony PCR verification gel image of *E. coli* Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckA with the nadB gene knocked out. Lane 1 represents the 5K Marker, lane 8 represents engineered strain EcN-6, and lanes 2-7 represent the elimination of Kan resistance in the nadB knockout strain genome. B represents the colony PCR electrophoresis image after eliminating the Kan resistance gene in the EcN genome; lane 1 represents the 5K Marker, lane 2 represents engineered strain EcN-6, and lanes 3-10 represent the elimination of Kan resistance in the nadB knockout strain genome. C represents the biomass and β-alanine production figures for engineered strains EcN-8 and EcN-9.

[0045] Figure 5 This is a graph showing the sequencing results, biomass, and β-alanine yield of the recombinant plasmid in the engineered bacterium EcN-10 from Example 4; A represents the recombinant plasmid pGLO-P. J23100 -panD K43Y -aspB-NCgl0580 sequencing results; B represents the biomass of EcN-9 and EcN-10 and the β-alanine yield.

[0046] Figure 6 The images show electrophoresis diagrams, biomass, and β-alanine production during the construction of engineered strain EcN-11 in Example 5. A represents the colony PCR verification gel image of E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadB with the ldhA gene knocked out; lane 1 represents the 5K Marker, and lanes 2-11 represent ldhA gene knockout strains. B represents the colony PCR electrophoresis diagram after eliminating the Kan resistance gene in the EcN genome; lane 1 represents the 5K Marker, lane 2 represents the chassis strain EcN-6, and lanes 3-6 represent the elimination of Kan resistance in the ldhA knockout strain genome.

[0047] Figure 7The images show electrophoresis diagrams, biomass, and β-alanine production figures of the engineered strain EcN-12 in Example 6. A represents the colony PCR verification gel image of *E. coli* Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhA with the poxB gene knocked out; lane 1 represents the 5K Marker, and lanes 2-7 represent the poxB gene knockout strains. B represents the colony PCR verification gel image for eliminating the Kan resistance gene in the EcN genome; lane 1 represents the 5K Marker, lane 2 represents engineered strain EcN-6, and lanes 3-6 represent the elimination of Kan resistance in the poxB knockout strain genome. C represents the biomass and β-alanine production figures of engineered strains EcN-11 and EcN-12.

[0048] Figure 8 This is a diagram showing the production of β-alanine by the engineered bacteria EcN-12 in a feed-feed fermenter in Example 8.

[0049] Figure 9 This describes the experimental process in Example 9 of constructing a type I CRISPRi high-throughput screening system using engineered bacteria EcN-12 as the chassis bacteria and using it to screen for β-alanine metabolism genes.

[0050] Figure 10 The diagram shows the construction and sequencing results of the random library and the β-alanine yield in Example 9. A represents the plate colony count after the plasmid library was electroporated into the high-throughput screening chassis strain; B shows the result of Sanger sequencing of randomly selected single colonies; C shows the biomass and β-alanine yield of the random mutant strains detected by dual fluorescence method.

[0051] Figure 11 The results show the biomass and β-alanine production of the mutant strain in Example 10.

[0052] Figure 12 The image shows the results of the activity assay of the panD gene-encoded enzyme in Example 11.

[0053] Figure 13 The results show the biomass and β-alanine production of EcN-12 and EcN-24 in Example 12. (V) Detailed Implementation

[0054] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0055] Unless otherwise specified, the experimental methods used in these examples are conventional methods. Unless otherwise specified, the experimental materials used in these examples are conventional biochemical reagents.

[0056] The E. coli Nissle 1917 strain used in this invention was purchased from Hangzhou Fenghai Biotechnology Co., Ltd., and the strain was identified by Zhejiang Tianke High-tech Development Co., Ltd.

[0057] Chassis bacteria E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk / pGLO-P J23100 -panD K43Y -aspB / pSU19-P J23100 -ppC-aspA has been disclosed in patent application CN115927142A, designated as EcN-6.

[0058] LB medium composition: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, ddH2O, natural pH.

[0059] LB plate medium is made by adding agar to LB liquid medium to a final concentration of 2 g / L.

[0060] The basic salt M9 medium consists of: K2HPO4·3H2O 14 g / L, KH2PO4 5.2 g / L, (NH4)2SO4 2 g / L, MgSO4 0.3 g / L, and tryptone 1 g / L. The solvent is ddH2O, the pH is 7.0, and the solvent is water.

[0061] Example 1: Knockout of the lacI gene in EcN-6, a type of spore-forming bacteria

[0062] To reduce the cost of adding inducing agents during fermentation, the basal strain *E. coli* Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk / pGLO-P was knocked out using the λ-RED recombination system. J23100 -panD K43Y -aspB / pSU19-P J23100 The lactose operon in strain -ppC-aspA encodes the repressor protein gene lacI (gene accession number 945007). An economically viable β-alanine-producing engineered strain, EcN-7, was constructed using the following steps:

[0063] (1) Using the genome of E. coli Nissle 1917 as a template, PCR amplification was performed using primers lacI-UP-F / lacI-UP-R and primers lacI-down-F / lacI-down-R to obtain fragments of the upstream and downstream homologous arms of the target gene lacI. The upstream nucleotide sequence is shown in SEQ ID NO.1 and the downstream nucleotide sequence is shown in SEQ ID NO.2. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 15 s, 57℃ for 15 s, 72℃ for 3 min, repeated for 30 cycles; extension was performed at 72℃ for 10 min.

[0064] (2) Amplification of the resistance fragment: Using the pKD4 plasmid (gifted by Kirill A. Datsenko & Barry L. Wanner) as a template, the kanamycin resistance fragment with the FRT site on the pKD4 plasmid was amplified by PCR using primers lac-Kan-F and lacI-Kan-R in Table 1. The nucleotide sequence is shown in SEQ ID NO.3, where the nucleotide sequence of the FRT site is 1-48bp and 1393-1427bp in SEQ ID NO.3; the nucleotide sequence of the Kan resistance is 49-1392bp in SEQ ID NO.3.

[0065] The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 15 s, 57℃ for 15 s, 72℃ for 4 min, repeated for 30 cycles; extension at 72℃ for 10 min.

[0066] (3) Donor DNA preparation: The kanamycin resistance fragment with FRT site in step (2) and the upstream and downstream homologous arms in step (1) are ligated using primers lacI-UP-F and lacI-down-R to obtain the kanamycin resistance gene fragment containing upstream and downstream homologous arms, which is the Donor DNA.

[0067] (4) Competent cells: The pKD46 plasmid (gifted by Kirill A. Datsenko & Barry L. Wanner) was transformed into E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk strain by electroporation to obtain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpyk strain containing the pKD46 plasmid. These cells were then inoculated into LB medium containing 0.1 mg / mL ampicillin and 30 mM arabinose and cultured at 30°C and 200 rpm until OD600. 600 Once the pH reaches 0.6, the bacterial culture is centrifuged at 9000 rpm for 5 min, and the precipitate is washed four times with sterile distilled water to obtain competent cells.

[0068] (5) Strains with knockout of the target gene: The Donor DNA gene fragment from step (3) was electroporated into competent cells from step (4) at 1.8KV. The electroporated bacterial solution was incubated at 30℃ for 2h. After centrifuging 1mL of bacterial solution at 9000rpm for 1min and discarding 900μL of supernatant, 50μL of the precipitate was spread onto LB plates containing 0.05mg / mL kanamycin and 0.1mg / mL ampicillin resistance, and cultured overnight at 30℃. Single colonies were picked as templates and PCR was performed using primers lacI-detect-F and Kan-R-detect. Under the same conditions, the serogroup EcN-6 was used as a control, and agarose gel electrophoresis analysis was performed. The results are shown in A in 2. It was observed that the knockout strain had a DNA band in 1.0% agarose gel, while the serogroup EcN-6 had no band, confirming the deletion of the lacI gene. Strains with knockout of cycA, fumB1, aspC, pyk, and lacI were obtained by screening.

[0069] (6) Elimination of pKD46 plasmid: The strain from step (5) was inoculated into LB liquid medium containing 0.05 mg / mL kanamycin resistance and cultured at 37°C for 12 h to eliminate pKD46. Then, it was inoculated into LB plates containing 0.05 mg / mL kanamycin resistance and LB plates containing both 0.1 mg / mL ampicillin and 0.05 mg / mL kanamycin resistance, and cultured at 37°C for 12 h. Knockout strains with eliminated pKD46 plasmid were screened. Competent cells were prepared using the method in step (4).

[0070] (7) Elimination of resistance: The pCP20 plasmid (purchased from Kirill A. Datsenko & Barry L. Wanner) was introduced into competent cells from step (6) using electroporation. The cells were then cultured at 30°C for 12 h on LB plates containing 0.025 mg / mL chloramphenicol resistance. Transformants were then screened. These transformants were cultured in LB liquid medium containing 0.025 mg / mL chloramphenicol resistance at 42°C for 12 h to eliminate kanamycin resistance in the genome. The cultured bacterial solution was diluted 10 times with LB liquid medium. 4 The culture was then plated onto LB agar plates containing 0.025 mg / mL chloramphenicol resistance and incubated at 30°C for 12 h. Single colonies were streaked onto LB agar plates containing both 0.05 mg / mL kanamycin and 0.025 mg / mL chloramphenicol resistance, and incubated at 37°C for 12 h. Then, single colonies from the double-antibody plate were streaked again onto LB agar plates containing 0.025 mg / mL chloramphenicol resistance and incubated at 30°C for 12 h. Colonies that did not grow on the double-antibody plate but grew on the single-antibody plate were those with eliminated kanamycin resistance in their genome.

[0071] (8) Elimination of pCP20 plasmid: Colonies that did not grow on the double antibiotics but grew on the single antibiotics in step (7) were inoculated into LB plates containing 0.025 mg / mL chloramphenicol resistance and LB plates without 0.025 mg / mL chloramphenicol resistance, respectively. They were cultured at 37℃ for 12 h. Knockout strains that did not grow on LB plates containing 0.025 mg / mL chloramphenicol resistance but grew on LB plates without chloramphenicol resistance were selected. These were E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacI strains. Competent cells were prepared from the knockout strains, and the recombinant plasmid pGLO-P was converted by electroporation. J23100 -panD K43Y With pSU19-P J23100 The -ppC-aspA was introduced into the knockout strain to obtain the engineered E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacI / pGLO-P J23100 -pan D K43Y / pSU19-P J23100 -ppC-aspA, denoted as engineered bacteria EcN-7.

[0072] (9) Biomass and β-alanine production determination

[0073] EcN-6 and EcN-7 were streaked onto LB agar plates and incubated overnight at 37°C. A single colony was picked and inoculated into 5 mL of LB liquid medium, and incubated overnight at 37°C at 200 rpm to obtain a seed culture. 1 mL of the seed culture was inoculated into a 250 mL shake flask containing 50 mL of basic salt M9 medium, along with 0 or 100 g / L of IPTG inducer. The shake flask was then incubated at 37°C at 200 rpm for 24 h. 1 mL of the liquid was taken from the shake flask to determine the OD (octane rating). 600 The result is as follows Figure 2 As shown in B.

[0074] Simultaneously, 1 mL of liquid was taken from the shake flask, centrifuged at 9000 rpm for 1 min, the supernatant was collected, and derivatized. After filtration through an organic membrane with a pore size of 45 μm, the filtrate was analyzed by HPLC to determine the β-alanine content in the fermentation broth. The results are shown in [Figure number missing]. Figure 2 As shown in Figure B. The results indicate that knocking out the lacI gene in the EcN-6 genome can further increase the production of β-alanine, regardless of whether IPTG is induced or not. Under non-induction conditions, the production of β-alanine can reach 1.22 g / L, which is 1.0 times the original amount. Under induced conditions, the production can reach 1.32 g / L, which is 1.1 times the original amount.

[0075] HPLC detection conditions: Wanyi high performance liquid chromatograph; chromatographic column: XB-C18 column (250mm×4.6nm); mobile phase: methanol: 0.05mol / L acetate-sodium acetate buffer solution (55:45, V / V); flow rate: 1.0mL / min; column temperature: room temperature.

[0076] Derivatization of the sample: Take 100 μL of sample, add 100 μL of 0.5 mol / L NaHCO3 aqueous solution and 0.1 mL of acetonitrile solution containing 1% 2,4-dinitrofluorobenzene by volume, react at 60 °C in the dark for 30 min, and then add 700 μL of 0.2 mol / L phosphate buffer with pH 7.

[0077] Table 1: Primer sequences

[0078]

[0079]

[0080] Example 2: Knockout of the pckA gene in the EcN-7 genome and replacement of the ppC-aspA promoter with P tac

[0081] To divert more oxaloacetate to L-aspartic acid, E. coli Nissle1917ΔcycAΔfumB1ΔaspCΔpykΔlacI / pGLO-P was knocked out using the λ-RED recombination system. J23100 -panD K43Y -aspB / pSU19-P J23100 The oxaloacetate-assisted PEP gene pckA (gene accession number 75060023) in strain -ppC-aspA was used to enhance the phosphoenolpyruvate to oxaloacetate metabolic pathway. An engineered strain EcN-8, which enhances the phosphoenolpyruvate to oxaloacetate pathway, was constructed, and PEP was synthesized via primers. tac The promoter (nucleotide sequence as shown in SEQ ID NO. 8) needs to be replaced. The specific steps are as follows:

[0082] (1) Using the genome of E. coli Nissle 1917 as a template, PCR amplification was performed using primers pckA-up-F / pckA-up-R and pckA-down-F / pckA-down-R to obtain fragments of the upstream and downstream homologous arms of the target gene pckA. The upstream nucleotide sequence is shown in SEQ ID NO.4 and the downstream nucleotide sequence is shown in SEQ ID NO.5. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 4 min, repeated for 30 cycles; extension was performed at 72℃ for 10 min.

[0083] P tac Promoter sequence: TTGACAATTAATCATCGGCTCGTATAATG (SEQ ID NO.8)

[0084] (2) Amplification of the resistance fragment: Same as in Example 1, using primers pckA-Kan-F and pckA-Kan-R in Table 2, the kanamycin resistance fragment with the FRT site on the pKD4 plasmid was amplified by PCR. The nucleotide sequence is shown in SEQ ID NO.3.

[0085] (3) Donor DNA preparation: The kana resistance fragment containing the FRT site and the upstream and downstream homologous arms were ligated using primers pckA-UP-F and pckA-down-R to obtain the kana resistance gene fragment containing the upstream and downstream homologous arms, which is the Donor DNA.

[0086] (4) Competent cells: E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacI were prepared as competent cells in the same manner as in Example 1.

[0087] (5) Strains with the target gene knocked out: Following the method in Example 1, the Donor DNA fragment from step (3) was electroporated into competent cells from step (4) at 1.8 KV, and PCR was performed using primers pckA-detect-F and Kan-R-detect. Under the same conditions, using *EcN-6* as a control, 1.0% agarose gel electrophoresis was performed, and the results are shown in Figure 3A. DNA bands were observed in the knockout strains, while no bands were observed in *EcN-6*, confirming the deletion of the pckA gene. Strains with knockouts of cycA, fumB1, aspC, pyk, lacI, and pckA were obtained through screening.

[0088] (6) Plasmid removal: Same as in Example 1.

[0089] (7) Elimination of resistance: Same as in Example 1, using primers pckA-UP-F and pckA-down-R for colony PCR. Under the same conditions, with the basal bacteria as a control, 1.0% agarose gel electrophoresis analysis was performed, and the results are as follows. Figure 3 As shown in Figure B, the DNA band observed in the knockout strain was exactly the same size as the band of the basal bacteria lacking the target gene pckA, indicating the elimination of kanamycin resistance in the Nissle 1917 genome.

[0090] (8) Elimination of pCP20 plasmid: The strains selected in step (7) were subjected to pCP20 plasmid elimination according to the method in Example 1. The resulting antibiotic-free knockout strain, E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckA, was screened and introduced into the recombinant plasmid pGLO-P. J23100 -panD K43Y -aspB and pSU19-P tac -aspA-ppC, obtained engineered E. coli Nissle 1917ΔcycAΔfumB1Δa spCΔpykΔlacIΔpckA / pGLO-P J23100 -panD K43Y -aspB / pSU19-P tac -aspA-ppC, denoted as engineered bacteria EcN-8.

[0091] plasmid pSU19-P tac -aspA-ppC is constructed as follows: using pSU19-P J23100 Using pSU-tac-F and pSU-tac-R as a template, PCR amplification was performed using primers pSU-tac-F and pSU-tac-R from Table 2. PCR products were detected by 1.0% agarose gel electrophoresis and template was eliminated with DpnI. The PCR product fragments were purified to obtain the linearized vector pSU19-P. tac -aspA-ppC.

[0092] PCR reaction conditions: pre-denaturation at 95℃ for 5 min, 95℃ for 30 s, 57℃ for 30 s, 72℃ for 4 min, for a total of 30 cycles, and a final extension at 72℃ for 10 min.

[0093] (9) Biomass and β-alanine production determination

[0094] The biomass and β-alanine production of engineered strain EcN-8 after induction culture were determined using the method described in Example 1, with EcN-7 as a control. The results are as follows: Figure 3 As shown in Figure C. The results indicate that blocking oxaloacetic acid supplementation with PEP can increase the yield of β-alanine. Compared with strain EcN-7, the yield reached 1.28 g / L, which is 0.9 times that of the control strain.

[0095] Table 2: Primer sequences

[0096]

[0097]

[0098] Example 3: Knocking out the nadB gene in engineered bacteria EcN-8

[0099] To reduce the loss of L-aspartic acid, a precursor metabolite of β-alanine, the λ-RED recombination system was used to reconstitute E. coli Nissle1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckA / pGLO-P J23100 -panD K43Y -aspB / pSU19-P tac The L-aspartate oxidase gene nadB (gene accession number 947049) in the AspC countercurrent pathway of strain -ppC-aspA was knocked out to construct an economically viable β-alanine-producing engineered strain, EcN-9. The specific steps are as follows:

[0100] (1) Using the E. coli Nissle 1917 genome as a template, PCR amplification was performed using primers nadB-up-F / nadB-up-R and nadB-down-F / nadB-down-R in Table 3 to obtain fragments of the upstream and downstream homologous arms of the target gene nadB. The upstream nucleotide sequence is shown in SEQ ID NO.6 and the downstream nucleotide sequence is shown in SEQ ID NO.7.

[0101] The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 4 min, repeated for 30 cycles; extension at 72℃ for 10 min.

[0102] (2) Kanamycin resistance fragment with FRT site: Using the method in Example 1, pKD4 plasmid was used as template and nadB-Kan-F and nadB-Kan-R primers were used for PCR amplification to obtain the kanamycin resistance fragment with FRT site. The nucleotide sequence is shown in SEQ ID NO.3.

[0103] (3) Donor DNA preparation: The Kan resistance gene fragment containing the FRT site and the upstream and downstream homologous arms were ligated using primers nadB-up-F and nadB-down-R to obtain the Kan resistance gene fragment containing the upstream and downstream homologous arms, i.e., Donor DNA.

[0104] (4) Competent cells: Using the method in Example 1, plasmid pKD46 was transformed into E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckA, and competent cells were prepared.

[0105] (5) Strains with the target gene knocked out: Using the method in Example 1, the Donor DNA gene fragment from step (3) was electroporated into competent cells from step (4) at 1.8 KV, and PCR was performed using primers nadB-detect-F and Kan-R-. Under the same conditions, using *Trichoderma* as a control, 1.0% agarose gel electrophoresis was performed, and the results are shown in Figure 4A. A DNA band was observed in the knockout strain, while no band was observed in *Trichoderma*, confirming the deletion of the nadB gene. Strains with knockouts of cycA, fumB1, aspC, pyk, lacI, pckA, and nadB were obtained through screening.

[0106] (6) Plasmid removal: Same as in Example 1.

[0107] (7) Elimination of resistance: As in Example 1, the pCP20 plasmid was introduced into the competent cells of step (6), and colony PCR was performed using primers nadB-up-F and nadB-down-R. Under the same conditions, with *Chaetomium* as a control, 1.0% agarose gel electrophoresis was performed, and the results are shown in Figure 4B. It was observed that the DNA band of the knockout strain was exactly the size of the band lacking the target gene nadB compared to that of *Chaetomium*, which indicates the elimination of kanamycin resistance in the *Chaetomium* genome.

[0108] (8) Elimination of pCP20 plasmid: Same as in Example 1, remove the recombinant plasmid pGLO-P J23100 -panD K43Y and pSU19-P tac The -aspA-p pC was introduced into the knockout strain to obtain the engineered E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadB / pGLO-P J23100 -panD K43Y / pSU19-P tac -aspA-ppC, denoted as engineered bacteria EcN-9.

[0109] (9) Biomass and β-alanine production determination

[0110] The biomass and β-alanine production of engineered bacteria EcN-9 were determined using the method described in Example 1. The results are as follows: Figure 4 As shown in Figure C. The results indicate that knocking out the L-aspartate oxidase gene nadB, reducing the loss of the β-alanine precursor metabolite L-aspartate, can increase the yield of β-alanine. Compared with the EcN-8 strain, the yield reached 1.36 g / L, which is 1.1 times that of the control strain.

[0111] Table 3: Primer sequences

[0112] nadB-up-F CCAGTATCCCGCTATCGTC nadB-up-R GCTCCAGCCTACACAATCGCTAAACACGGTTTGGTCAGC nadB-down-F TCCCATGTCAGCCGTTAAGTTGGCCCACGAATGACTAAG nadB-down-R CGCAGAACCGAGTACATCAC nadB-detect-F GAGCGATGGCAGAGAATCAA nadB-Kan-F GCTGACCAAACCGTGTTTAGCGATTGTGTAGGCTGGAGC nadB-Kan-R CTTAGTCATTCGTGGGCCAACTTAACGGCTGACATGGGA

[0113] Example 4: Overexpression of the NCgl0580 gene in engineered bacteria EcN-9

[0114] (1) Recombinant plasmid pGLO-P J23100 -panD K43Y -aspB-NCgl0580

[0115] Using the *Corynebacterium glutamicum* genome (gifted by Zhang Bo) as a template, PCR amplification was performed using primer fragments DBC-PD-F and DBC-PD-R listed in Table 4 to obtain the NCgl0580 gene amplification product (nucleotide sequence shown in SEQ ID NO. 9). The PCR product was detected by 1.0% agarose gel electrophoresis and the template was eliminated with DpnI. PCR reaction conditions: pre-denaturation at 95℃ for 5 min, 95℃ for 30 s, 57℃ for 30 s, 72℃ for 3 min, for a total of 30 cycles, with a final extension at 72℃ for 10 min.

[0116] pGLO-P J23100 -panD K43Y Using the -aspB vector as a template, PCR amplification was performed using primers DBC-ZT-F and DBC-ZT-R to obtain pGLO-P. J23100 -panD K43Y -aspB linearized carrier.

[0117] A one-step cloning kit was used to clone pGLO-P in one step. J23100 -panD K43Y The -aspB linearized vector was ligated with the purified PCR product fragment of the NCgl0580 gene to obtain the cloning recombinant plasmid pGLO-P. J23100 -panD K43Y -aspB-NCgl0580 (see sequence) Figure 5 (A). All the above recombinant plasmids were verified to be correct through sequencing.

[0118] (2) Recombinant bacteria: The recombinant plasmid pGLO-P J23100 -panD K43Y -aspB-NCgl0580 and pSU19-P tac The strain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadB was obtained by importing -aspA-ppC into E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadB / pGLO-P. J23100-panD K43Y -aspB-NCgl0580 / pSU19-P tac -aspA-ppC, denoted as engineered bacteria EcN-10.

[0119] (3) Biomass and β-alanine yield determination

[0120] The biomass and β-alanine production of engineered bacteria EcN-9 and EcN-10 were determined using the method described in Example 1. The results are shown in [Figure 1]. Figure 5 Figure B indicates that overexpression of the NCgl0580 gene from Corynebacterium glutamicum resulted in a slight increase in β-alanine production compared to the EcN-9 strain, with the increase being 1.14 times that of the control strain. This demonstrates that the β-alanine efflux system from Corynebacterium glutamicum functions in EcN.

[0121] Table 4: Primer Sequences

[0122] DBC-PD-F GTAAGCCTGCACGTTAACTAG DBC-PD-R GGCAATAATCAAGGGCATG

[0123] Example 5: Knockout of the ldhA gene in engineered bacteria EcN-10

[0124] To reduce the loss of L-aspartic acid, a precursor metabolite of β-alanine, the λ-RED recombination system was used to reconstitute E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadB / pGLO-P J23100 -panD K43Y -aspB-NCgl0580 / pSU19-P tac Knocking out the lactate dehydrogenase gene ldhA (gene accession number 3939) encoding lactate in strain -ppC-aspA alleviates the problem of low pH in the fermentation broth. The specific steps are as follows:

[0125] (1) Using the E. coli Nissle 1917 genome as a template, PCR amplification was performed using primers ldhA-up-F / ldhA-UP-R and ldhA-down-F / ldhA-down-R in Table 5 to obtain fragments of the upstream and downstream homologous arms of the target gene ldhA. The upstream homologous arm is shown in nucleotide sequence SEQ ID NO.10, and the downstream homologous arm is shown in nucleotide sequence SEQ ID NO.11.

[0126] The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 15 s, 57℃ for 15 s, 72℃ for 4 min, repeated for 30 cycles; extension at 72℃ for 10 min.

[0127] (2) Kanamycin resistance fragment with FRT site: Using the method in Example 1, pKD4 plasmid was used as template and ldhA-Kan-F and primer ldhA-Kan-R primers were used for PCR amplification to obtain the kanamycin resistance fragment with FRT site. The nucleotide sequence is shown in SEQ ID NO.3.

[0128] (3) Donor DNA preparation: The Kan resistance fragment and upstream and downstream homologous arms were ligated using primers ldhA-UP-F and ldhA-down-R to obtain the Kan resistance gene fragment containing upstream and downstream homologous arms, i.e., Donor DNA.

[0129] (4) Competent cells: Using the method in Example 1, plasmid pKD46 was transformed into E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadB, and competent cells were prepared.

[0130] (5) Strains with knockout target genes: The Donor DNA gene fragment from step (3) was electroporated into competent cells from step (4) at 1.8 KV, and PCR was performed using primers ldhA-detect-F and ldhA-R-detect. Under the same conditions, using *Dendrocalamus* as a control, 1.0% agarose gel electrophoresis was performed, and the results are shown in A of 6. DNA bands were observed in the knockout strains. Strains with knockouts of cycA, fumB1, aspC, pyk, lacI, pckA, nadB, and ldhA were obtained through screening.

[0131] (6) Plasmid removal: Same as in Example 1.

[0132] (7) Elimination of resistance: As in Example 1, the pCP20 plasmid was introduced into the competent cells of step (6), and colony PCR was performed using primers ldhA-up-F and ldhA-down-R. Under the same conditions, with the basal bacteria as a control, 1.0% agarose gel electrophoresis was performed, and the results are as follows. Figure 6 As shown in Figure B, the DNA band observed in the knockout strain was exactly the same size as the band of the *Dendrocalamus* strain lacking the target gene ldhA, indicating the elimination of kanamycin resistance in the *Dendrocalamus* genome.

[0133] (8) Elimination of pCP20 plasmid: The strains selected in step (7) were subjected to pCP20 plasmid elimination according to the method in Example 1. The resulting antibiotic-free knockout strain, E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhA, was screened. The recombinant plasmid pGLO-P was then introduced. J23100 -panD K43Y-aspB-NCgl0580 and pSU19-P tac -aspA-ppC, obtained strain E.coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhA / pGLO-P J23100 -panD K43Y -aspB-NCgl0580 / pSU 19-P tac -aspA-ppC, denoted as engineered bacteria EcN-11.

[0134] Table 5: Primer Sequences

[0135]

[0136]

[0137] Example 6: Knockout of the poxB gene in engineered bacteria EcN-11

[0138] To alleviate the inhibitory effect of byproducts in the fermentation broth on cell growth, the λ-RED recombination system was used to recombinant E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhA / pGLO-P J23100 -panD K43Y -aspB-NCgl0580 / pSU 19-P tac Knocking out the pyruvate dehydrogenase gene poxB (gene accession number 946132) encoding acetic acid in strain -ppC-aspA reduces carbon loss and further alleviates the problem of low pH in the fermentation broth. The specific steps are as follows:

[0139] (1) Using the E. coli Nissle 1917 genome as a template, PCR amplification was performed using primers poxB-up-F / poxB-up-R and poxB-down-F / poxB-down-R in Table 6 to obtain fragments of the upstream and downstream homologous arms of the target gene poxB. The upstream nucleotide sequence is shown in SEQ ID NO.12 and the downstream nucleotide sequence is shown in SEQ ID NO.13.

[0140] The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 4 min, repeated for 30 cycles; extension at 72℃ for 10 min.

[0141] (2) Kanamycin resistance fragment with FRT site: Using the method in Example 1, pKD4 plasmid was used as template and poxB-Kan-F and poxB-Kan-R primers were used for PCR amplification to obtain the kanamycin resistance fragment with FRT site. The nucleotide sequence is shown in SEQ ID NO.3.

[0142] (3) Donor DNA preparation: The Kan resistance gene fragment with FRT site and the upstream and downstream homologous arms were ligated using primers poxB-up-F and poxB-down-R to obtain the Kan resistance gene fragment containing the upstream and downstream homologous arms, i.e., Donor DNA.

[0143] (4) Competent cells: Using the method in Example 1, plasmid pKD46 was transformed into E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhA, and competent cells were prepared.

[0144] (5) Strains with the target gene knocked out: Using the method in Example 1, the Donor DNA gene fragment from step (3) was electroporated into competent cells from step (4) at 1.8 KV, and PCR was performed using primers poxB-detect-F and poxB-R-detect. Under the same conditions, using *Trichoderma* as a control, 1.0% agarose gel electrophoresis was performed, and the results are as follows. Figure 7 As shown in Figure A, DNA bands were observed in the knockout strains. Strains with knockouts of cycA, fumB1, aspC, pyk, lacI, pckA, nadB, ldhA, and poxB were obtained through screening.

[0145] (6) Plasmid removal: The method in Example 1 was used.

[0146] (7) Elimination of resistance: Colony PCR was performed using primers ldhA-up-F and ldhA-down-R, following the method described in Example 1. Under the same conditions, with *Dichroa febrifuga* as a control, 1.0% agarose gel electrophoresis was performed, and the results are as follows. Figure 7 As shown in Figure B, the DNA band observed in the knockout strain was exactly the same size as the band lacking the target gene poxB, indicating the elimination of kanamycin resistance in the Chagas microbiota genome.

[0147] (8) Elimination of pCP20 plasmid: The strains selected in step (7) were subjected to pCP20 plasmid elimination according to the method in Example 1. The resulting antibiotic-free knockout strain, E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpox B, was introduced into the recombinant plasmid pGLO-P. J23100-panD K43Y -aspB-NCgl0580 and pSU19-P tac -aspA-ppC, to obtain the engineered strain E. coli Nissle 1917ΔcycAΔfumB1 aspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB / pGLO-P J23100 -panD K43Y -aspB-NCgl0580 / pSU19-P tac -aspA-ppC, denoted as engineered bacteria EcN-12.

[0148] (9) Biomass and β-alanine production determination

[0149] The biomass and β-alanine production of engineered bacteria EcN-9, EcN-10, EcN-11, and EcN-12 were determined using the method described in Example 1. The results are as follows: Figure 7 As shown in C. When the poxB gene was further knocked out on top of the deletion of ldhA, the yield of EcN-12 was slightly increased, reaching 1.45 g / L, which is 1.2 times that of the acid-producing strain without deletion. Moreover, the pH value was found to be higher than that of EcN-11.

[0150] Table 6: Primer Sequences

[0151] poxB-up-F CAGATGCTGACCAATGTAGC poxB-up-R GCTCCAGCCTACACAATCGCCGTCATAATAAGGACATGCC poxB-down-F TCCCATGTCAGCCGTTAAGTCCATCTCCTGAATGTGATGAC poxB-down-R ACGATTTCCCTGATTTGCC poxB-detect-F ATTTGATTCACCACCTGCC poxB-Kan-F GGCATGTCCTTATTATGACGGCGATTGTGTAGGCTGGAGC poxB-Kan-R GTCATCACATTCAGGAGATGGACTTAACGGCTGACATGGGA

[0152] Example 8: Fermentation culture of engineered bacteria EcN-12 in a 5L fermenter using a fed-batch method.

[0153] (1) Activation culture:

[0154] E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔld hAΔpoxB / pGLO-P stored in glycerol at -80℃ J23100 -panD K43Y -aspB-NCgl0580 / pSU19-P tac The -aspA-ppC strain was streaked onto LB agar plates and incubated overnight at 37°C to obtain activated bacteria. LB agar medium consisted of 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, and 2 g / L agar, with water as the solvent and natural pH.

[0155] (2) Seed culture: Select fresh activated bacteria from step (1) and inoculate them into LB liquid medium test tubes. Incubate overnight at 37°C and 220 r / min on a shaker. Then, transfer the culture solution at a volume concentration of 1% to a 250 mL Erlenmeyer flask containing 50 mL of LB liquid medium. Incubate overnight at 37°C and 220 r / min on a shaker to obtain the seed culture. LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, water as solvent, natural pH.

[0156] (3) Fed-batch fermentation culture:

[0157] The seed culture from step (2) was inoculated into a 5L fermenter containing 2L of fermenter medium at an inoculation rate of 5% (v / v). The culture temperature was 37℃, pH 7.0, and dissolved oxygen was maintained at 20%. After 10 hours of fermentation, fed culture medium was added at a rate of 50 mL / min to maintain a residual glucose concentration of 3-4 g / L in the fermenter until fermentation was complete. The total fermentation time was 60 hours, and a total of 1L of fed culture medium was consumed. During the feeding process, cell growth OD was measured every 3 hours. 600 The residual glucose content (using a residual glucose analyzer) and the β-alanine concentration (same as in Example 1, HPLC). Figure 8 As shown, around 60 hours later, OD 600 The concentration was 11, the residual glucose content was 4.8 g / L, and the yield of β-alanine reached 24.5 g / L.

[0158] Fermentation tank culture medium: 50 g / L glucose, 28 g / L K2HPO4·3H2O, 10.4 g / L KH2PO4, 4 g / L NH4Cl, 0.6 g / L MgSO4, 2 g / L tryptone, 4 g / L yeast extract, 1 mL 10× metal ions, 1 mL / L silicone defoamer, with water as the solvent.

[0159] 10× Metal Ion Formula: Weigh 10g CaCl2, 10g FeSO4·7H2O, 1g ZnSO4·7H2O, 0.2g CuSO4 and 0.02g NiCl2·7H2O and dissolve them in 100mL ddH2O.

[0160] The fed culture medium consisted of: glucose 250 g / L, glycerol 250 g / L, yeast extract 4 g / L, KH2PO4 14 g / L, NH4Cl 10 g / L, MgSO4 0.3 g / L, and defoamer 1 mL / L (organic silica gel defoamer, water as solvent).

[0161] Example 9: Screening of genes affecting β-alanine production in strain EcN-12 using the type I CRSPRi high-throughput screening system (reference) Figure 9 Try it following these steps:

[0162] (1) Constructing an experimental strain capable of expressing Cascade protein: The recombinant plasmid pSU19-P J23100 -araC-P ara - cascade (same as Example 1 in patent application CN117210436A) transformed engineered E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB into electrocompetent states to obtain strain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB / pSU19-P J23100 -araC-P ara -cascade, denoted as engineered bacteria EcN-13.

[0163] (2) Constructing a negative strain without inhibitory function: The recombinant plasmid pGLO-P J23100 -panD-aspB (Hu S, et al. Appl Microbiol Biotechnol. 2023, 107(7-8)) was transformed into the engineered strain EcN-13 electrocompetent cells to obtain strain E. coli Nissl e 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB / pSU19-P J23100 -araC-P ara -cas cade / pGLO-P J23100 -panD-aspB, denoted as engineered bacteria EcN-14.

[0164] (3) Constructing a positive strain expressing highly efficient ptsG targeting: The recombinant plasmid pGLO-P J23100 The plasmid Z16 from patent application CN117210436A (-panD-aspB-crRNAptsG) was transformed into the electrocompetent cells of engineered strain EcN-13 to obtain strain E. col i Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB / pSU19-P J23100 -araC-P ara -cascade / pGLO-P J23100-panD-aspB-crRNAptsG, denoted as engineered bacteria EcN-15.

[0165] The nucleotide sequence of crRNA targeting ptsG is as follows: ATAAACCG AATGCATTTGCTAACCTGCAAAAGGTCGGTAA GAGTTCCCCGCGCCAGCGGGGATAAACCG 1-8bp is repeat1, 9-40bp is spacer, and 41-69bp is repeat2.

[0166] (4) Construction of randomized libraries

[0167] pGLO-P J23100 Using the PanD-aspB-crRNAptsG plasmid as a template, reverse PCR amplification was performed using primers crispri-sx-F and crispri-sx-R (Table 7). The 32bp spacer sequence in the crRNA was randomly mutated to N (N represents A / C / G / T). The linear product was then transformed into DH5α and plated on LB agar plates containing 0.05 mg / mL ampicillin resistance. The plates were incubated at 37°C for 12 h. All resulting single clones were inoculated into 5 ml LB tubes containing 0.05 mg / ml ampicillin resistance and incubated at 37°C for 12 h. Plasmid extraction and sequencing confirmed the random mutation as shown in the template plasmid. Figure 10 As shown in Figure B. The randomly mutated plasmid was then transformed into EcN-13 electrocompetent cells and plated on LB agar plates containing 0.1 mg / ml ampicillin and 0.025 mg / ml chloramphenicol. The plates were incubated at 37°C for 12 h, yielding the corresponding single-clonal transformants.

[0168] Culture of the test strain: Place the single clonal transformant in an LB tube and incubate overnight at 37°C.

[0169] (5) Determination of β-alanine production in random mutant strains

[0170] After culturing, 1 mL of bacterial culture was taken and the OD of each group of bacteria was measured. 600 Values ​​and β-alanine production, results as follows Figure 10 As shown in C. The β-alanine dual-fluorescence detection method (Mingyue Fei, et al. Acta Biochim Biophys Sin, 2020, 52(00), 1–7) was used to detect each monoclonal transformant (library capacity 4). 32 Initial screening was conducted, using engineered strain EcN-14 as a negative control and engineered strain EcN-15 as a positive control. After initial screening, hundreds of strains were obtained, and the results are as follows... Figure 10As shown in Figure A, these strains all showed significant differences in β-alanine production compared to EcN-14 or EcN-15.

[0171] Further screening of these hundreds of transformed strains (OD detection) 600 Transformed strains with stable traits were obtained by analyzing the β-alanine content and yield. Subsequently, Sanger sequencing was performed on the selected target strains using the detection primers spacer-JC-F (Table 7) to obtain the gene sequences of their spacer regions. In SnapGene software, these sequences were compared and matched with the gene map of E. coli Nissle1917 to identify the targeted genes and screen for OD... 600 Genes that have a significant impact on β-alanine production.

[0172] Table 7: Primer Sequences

[0173]

[0174] Example 10: Optimization of the Type I CRISPRi high-throughput screening system in EcN-12 strain

[0175] (1) Constructing the plasmid pTargetF targeting pMUT1:

[0176] Using plasmid pTargetF (Li Shuai. Construction and capsular polysaccharide analysis of E. coli K5△pta strain [D]. Zhejiang University of Technology, 2018) as a template, the plasmid was linearized and transformed into DH5α using primers pF(pMYT1)F and pF(pMYT1)R in Table 8 to obtain plasmid pTargetF targeting pMUT1.

[0177] (2) Knockout of EcN endogenous plasmid pMUT1 using CRISPR / Cas9 gene editing:

[0178] The plasmid pTargetF was transformed into the electrocompetent state of engineered bacteria EcN-12, and the strain was designated as engineered bacteria EcN-16. The plasmid pCas9 (Jiang Y et al. Applied and environmental microbiology, 2015, 81(7):2506-2514) was transformed into the electrocompetent state of engineered bacteria EcN-16, and the strain was designated as engineered bacteria EcN-17. The engineered strain EcN-17 was inoculated into 5 ml LB tubes containing 20 mM isopropyl-β-D-thiogalactopyranoside (IPTG) and 0.05 mg / mL kanamycin resistance. The tubes were incubated overnight at 30°C. The bacterial suspension was then diluted and spread onto dual-resistance plates containing 0.05 mg / mL kanamycin and 0.05 mg / mL spectinomycin, as well as a single-resistance plate containing 0.05 mg / mL kanamycin. Transformants that did not grow on the dual-resistance plates but grew on the single-resistance plates were identified as strains containing pCas9 but lacking pTargetF, and were designated as engineered strain EcN-18. The engineered strain EcN-18 was inoculated into 5 ml LB tubes and cultured overnight at 42°C. The bacterial suspension was diluted and spread separately on LB plates containing 0.05 mg / ml kanamycin resistance and LB plates without resistance. Transformants that did not grow on the resistance plates but grew on the LB plates were taken. These were the strains with the temperature-sensitive plasmid pCas9 removed and were designated as engineered strain EcN-19.

[0179] (3) Plasmid pMUT1-P J23100 Build -panD-aspB:

[0180] pMUT1, an endogenous plasmid of E. coli Nissle 1917, has a higher copy number in E. coli Nissle 1917. Therefore, using pMUT1 to overexpress panD and aspB not only does not impose an additional metabolic burden on the engineered bacteria, but can also further increase the β-alanine production of the engineered bacteria. Using the pMUT1 plasmid as a template, reverse PCR was performed on the plasmid using primers pMUT1-ZT-F and pMUT1-ZT-R (Table 8) to obtain the pMUT1 vector fragment, which was then processed using pGLO-P... J23100 Using the panD-aspB plasmid as a template, PCR was performed on the plasmid using the primers panD-PD-F and panD-PD-R listed in Table 8 to obtain P J23100 The -panD-aspB fragment was ligated into the vector and the fragment using a one-step cloning kit, and then transformed into DH5α to obtain the recombinant plasmid pMUT1-P. J23100 -panD-aspB.

[0181] (4) Plasmid pUC-P J23119 Construction of -crptsG(3'repeat 21bp):

[0182] Considering that the repeat regions at both ends of crRNA have the same base sequence, random mutation of the spacer region of crRNA using primers can easily lead to self-recombination in the repeat region, resulting in the loss of the spacer region. Therefore, the 3' repeat region of crRNA is truncated to 21 bp to reduce the spacer region loss rate. Using pUC-P J23119 Using the -crRNAX plasmid (as described in Example 4 of patent application CN117210436A) as a template, reverse PCR was performed on the plasmid using primers repeat-back-F-21 and repeat-back-R-21 from Table 8 to obtain a linear product. This product was then transformed into DH5α to obtain the plasmid pUC-P. J23119 -crP70 (3'repeat21bp). Using pUC-P J23119 Using the plasmid -crP70 (3' repeat 21bp) as a template, reverse PCR was performed on the plasmid using primers ptsG-spacer-F and ptsG-spacer-R (listed in Table 8) to obtain a linear product. This product was then transformed into DH5α to obtain the plasmid pUC-P. J23119 -crptsG(3'repeat 21bp), the nucleotide sequence of crptsG is shown in SEQ ID NO.14, 1-8bp represents repeat1, 9-40bp represents spacer, and 41-61bp represents repeat2.

[0183] (5) Construct an optimized negative strain with no inhibitory function.

[0184] plasmid pMUT1-P J23100 -panD-aspB was transformed into electrocompetent cells of engineered strain EcN-19, yielding strain E. coli Nis sle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB / pSU19-P J23100 -araC-P ara -C ascade / pMUT1-P J23100 -panD-aspB, denoted as engineered bacteria EcN-20.

[0185] (6) Constructing optimized positive strains that highly target ptsG:

[0186] plasmid pUC-P J23119-crptsG was transformed into electrocompetent cells of engineered strain EcN-20 to obtain strain E. coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB / pSU19-P J23100 -araC-P ara -cascade / pM UT1-P J23100 -panD-aspB / pUC-P J23119 -crptsG, denoted as engineered bacteria EcN-21.

[0187] (7) Construction of the optimized random library

[0188] pUC-P J23119 Using the -crptsG (3' repeat 21bp) plasmid as a template, reverse PCR was performed on the plasmid using primers crispri-sx-F and crispri-sx-R (Table 7). The 32bp spacer sequence in the crRNA was randomly mutated to N. The linear product was then transformed into DH5α and plated on LB agar plates containing 0.05 mg / mL kanamycin resistance. The plates were incubated at 37°C for 12 h. All resulting monoclonal transformants were inoculated into 5 ml LB tubes containing 0.05 mg / ml amikacin resistance and incubated at 37°C for 12 h. The plasmid was extracted, and sequencing confirmed the random mutation. The randomly mutated plasmid was then transformed into EcN-20 electroporation competent cells and plated on LB agar plates containing both 0.1 mg / ml ampicillin and 0.05 mg / ml kanamycin resistance. The plates were incubated at 37°C for 12 h, yielding the corresponding monoclonal transformants on the dual-resistance plates.

[0189] Culture of the test strain: Place the single clonal transformant in an LB tube and incubate overnight at 37°C.

[0190] (8) Determination of β-alanine production in random mutant strains

[0191] After culturing, 1 mL of bacterial culture was taken from each group of bacteria to determine the OD value. 600 Values ​​and β-alanine production. β-alanine dual-fluorescence detection method (Mingyue Fei, et al. Acta Biochim Biophys Sin, 2020, 52(00), 1–7) was used to detect β-alanine in each monoclonal transformant (library capacity 4). 32 Initial screening was conducted, using engineered strain EcN-20 as a negative control and engineered strain EcN-21 as a positive control. After initial screening, hundreds of strains were obtained, which differed in β-alanine production or cell OD. 600In terms of values, they showed significant differences compared to both negative and positive controls.

[0192] Further screening of these hundreds of transformed strains yielded strains that showed significant differences compared to the negative control group, as shown in the following results. Figure 11 As shown in the figure. Subsequently, Sanger sequencing was performed on the screened target strains using the detection primer spacer-F to obtain the gene sequences of their spacer regions. In SnapGene software, we compared these sequences with the gene map of E. coli Nissle 1917 to determine the targeted genes.

[0193] Screening and comparison revealed that the aspartate tRNA ligase gene aspS has a significant impact on the production of β-alanine.

[0194] Table 8: Primer Sequences

[0195]

[0196] Example 11: Verification of the effect of aspartate tRNA ligase AspS on β-alanine production

[0197] (1) Prediction of the effect of aspartate tRNA ligase AspS on β-alanine production

[0198] The aspartate tRNA ligase AspS is responsible for precisely linking aspartic amino acids to their corresponding tRNAs. Based on this function, it is hypothesized that the aspS gene may influence the biosynthesis of β-alanine by regulating the activity of the enzyme encoded by the panD gene, thereby increasing its yield.

[0199] (2) pGLO-P ara Construction of the -panD-GFP-aspS plasmid

[0200] With plasmid pGLO-P ara Using panD-GFP (Fei M, Acta Biochimica et Biophysica Sinica, 2020, 52(12): 1420-1426) as a template, reverse PCR was performed on the plasmid using primers pGLO-ara-ZT-F and pGLO-ara-ZT-R in Table 9 to obtain a linear vector. Using the E. coli Nissle 1917 genome as a template, PCR was performed using primers aspS-F and aspS-R in Table 9 to obtain the aspS fragment. The nucleotide sequence is shown in SEQ ID NO. 15. The vector and fragment were ligated using a one-step cloning kit and transformed into DH5α to obtain the recombinant plasmid pGLO-P. ara -panD-GFP-aspS.

[0201] (3) Constructing a control group strain

[0202] plasmid pGLO-P ara -panD-GFP-aspS was transformed into electrocompetent cells of MG1655ΔpanD (Fei M, Acta Biochimica et Biophysica Sinica, 2020, 52(12): 1420-1426) to obtain strain MG1655ΔpanD / pGLO-P ara -panD-GFP, denoted as engineered bacteria EcN-22.

[0203] (4) Constructing experimental strains overexpressing aspS

[0204] plasmid pGLO-P ara -panD-GFP-aspS was transformed into MG1655ΔpanD electrocompetent cells to obtain strain MG1655ΔpanD / pGLO-P ara -panD-GFP-aspS is denoted as engineered bacteria EcN-23.

[0205] (5) The activity of the enzyme encoded by the panD gene was determined using a whole-cell catalysis method.

[0206] Using a multichannel pipette, 200 μL of basic salt M9 medium was added to each well of a 96-well plate. Single colonies of engineered bacteria 22 and 23 were inoculated into the wells, with 24 colonies of each strain inoculated. The 96-well plates were incubated at 37°C for 12 hours, and the OD was measured using a microplate reader. 600 When OD 600 When the OD value is around 1.0, it is used as the seed culture. Using a multichannel pipette, 180 μL of basic salt M9 medium containing 30 mM arabinose inducer and 20 μL of the corresponding seed culture are added to each well of a new 96-well plate. Expression is induced at 37°C for 12 h, and OD is measured using a microplate reader. 600 Then, 100 μL of fermentation broth was placed in the wells of a new 96-well black ELISA plate, and the GFP fluorescence value was measured using an ELISA reader (excitation wavelength 395 nm, emission wavelength 509 nm), and recorded as F1.

[0207] Take 50 μL of fermentation broth into a new 96-well white plate. Incubate the 96-well white plate at -80℃ for 30 min, then immediately place it at 37℃ for 30 min. Repeat this step at least 3 times to lyse the cells. After lysing, add 125 μL of 40 g / L L-Asp aqueous solution to each well of the lysate, mix well, and incubate at 37℃ for 2 h to obtain the transformation solution. Using a multichannel pipette, add 2.5 μL of transformation solution and 155 μL of fluorescent agent mixture (250 μL of 5.7 mg / mL mercaptoethanol ethanol solution, 250 μL of 10 mg / mL o-diacetylphenyl methanol solution, and 15 mL of 0.2 mol / L sodium borate buffer solution (pH = 9.5)) to each well of a new 96-well black ELISA plate. Measure the fluorescence value using an ELISA reader (excitation wavelength 355 nm, emission wavelength 445 nm) and record it as F2. The relative enzyme activity of PanD protein is F1 / F2.

[0208] The results are as follows Figure 12 As shown, the results indicate that the relative enzyme activity of PanD protein in the experimental strain (engineered strain EcN-23) is higher than that in the control strain (engineered strain EcN-22), suggesting that the aspartic acid tRNA ligase AspS can enhance the activity of PanD protein and thus increase the yield of β-alanine.

[0209] Table 9: Primer Sequences

[0210] pGLO-ara-ZT-F TTCAGCCTGATACAGATTAAATC pGLO-ara-ZT-R TCTCCTTCTTAAAGTTAAACAAAAATCTTCTCTCATCCGCCA aspS-F TGTTTAACTTTAAGAAGGAGAAATTAGTGGACGATTTGACCG aspS-R GATTTAATCTGTATCAGGCTGAATTACAGAAGAGGCTTAAGTTGA

[0211] Example 12: Overexpression of the aspS gene in engineered bacteria EcN-12 and verification of β-alanine production

[0212] (1) Recombinant plasmid pGLO-P J23100 -panD K43Y -aspB-NCgl0580-aspS

[0213] Using the genome of *Escherichia coli* Nissle 1917 (obtained from the National Standard Material Resource Platform) as a template, PCR amplification was performed using primer fragments saspS-PD-F and aspS-PD-R listed in Table 10 to obtain the aspS gene amplification product (nucleotide sequence shown in SEQ ID NO. 15). The PCR product was detected by 1.0% agarose gel electrophoresis and the template was eliminated with DpnI. PCR reaction conditions: pre-denaturation at 95℃ for 5 min, 95℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min, for a total of 30 cycles, followed by a final extension at 72℃ for 10 min.

[0214] pGLO-P J23100 -panD K43YUsing the -aspB-NCgl0580 vector as a template, PCR amplification was performed using primers pGLO-ZT-F and pGLO-Z TR to obtain pGLO-P J23100 -panD K43Y -aspB-NCgl0580 vector. A one-step cloning kit was used to clone pGLO-P... J23100 -panD K43Y The -aspB-NCgl0580 vector was ligated with the purified PCR product fragment of the aspS gene to obtain the cloning recombinant plasmid pGLO-P. J23100 -panD K43Y -aspB-NCgl0580-aspS.

[0215] (2) Recombinant bacteria: The recombinant plasmid pGLO-P J23100 -panD K43Y -aspB-NCgl0580-aspS and pSU19-P tac -aspA-ppC was introduced into E.coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB to obtain the strain E.coli Nissle 1917ΔcycAΔfumB1ΔaspCΔpykΔlacIΔpckAΔnadBΔldhAΔpoxB / pGLO-P J 23100 -panD K43Y -aspB-NCgl0580-aspS / pSU19-P tac -aspA-ppC, denoted as engineered bacteria EcN-24.

[0216] (3) Biomass and β-alanine yield determination

[0217] The biomass and β-alanine production of engineered bacteria EcN-12 and EcN-24 were determined using the method described in Example 1. The results are as follows: Figure 13 As shown, overexpression of the aspS gene from *E. coli* Nissle 1917 slightly increased β-alanine production by 0.25 g compared to the *EcN-12* strain. This demonstrates that the aspS gene obtained through high-throughput screening using the type I CRISPRi system can increase β-alanine production.

[0218] Table 10: Primer Sequences

[0219] aspS-PD F TCATTGGCAGCTTGAAAAAGAGTGGACGATTTGACCGCA aspS-PD R GATCAACGTCTCATTTTCGCTTACAGAAGAGGCTTAAGTTGA pGLO-panD-R TCTTTTTCAAGCTGCCAATGA pGLO-panD-F GCGAAAATGAGACGTTGATC

Claims

1. An engineered bacterium that produces high levels of β-alanine, characterized in that, The engineered bacteria are... E. coli Nissle 1917 Δ cycA ΔfumB 1 ΔaspC Δpyk / pGLO-P J23100 - panD K43Y -aspB / pSU19-P J23100 - ppC - aspA For chassis bacteria, knock out the genome lacI Gene, pckA Gene, nadB Gene, ldhA Gene, poxB Genes, overexpression NCgl 0580 gene, aspartate tRNA ligase gene aspS The aspartate tRNA ligase gene obtained through construction. aspS The nucleotide sequence is shown in SEQ ID NO.

15.

2. The engineered bacteria as described in claim 1, characterized in that, NCgl The nucleotide sequence of the 0580 gene is shown in SEQ ID NO.

9.

3. The engineered bacteria as described in claim 1, characterized in that, The NCgl 0580 gene and aspartate tRNA ligase gene aspS Overexpression was performed using the pGLO plasmid.

4. The engineered bacteria as described in claim 1, characterized in that, The expression in the chassis bacteria ppC and aspA promoter P J23100 Replace with promoter P tac The promoter P tac The nucleotide sequence is shown in SEQ ID NO.

8.

5. A method for screening and constructing engineered bacteria with high β-alanine production as described in claim 1 based on the type I CRISPRi system, characterized in that, The method includes: (1) The type I CRISPRi system includes the Cascade protein and crRNA; the Cascade protein is generated by the strict promoter P J23100- araC-P ara Induced expression; the crRNA is produced by P J23100 Promoter expression; the crRNA structure is repeat1-spacer-repeat2, where repeat1 is 8 bp in length; repeat2 is 21 bp in length; the spacer is a randomly mutated N base and is 32 bp in length; (2) The endogenous plasmid pMUT1 of the engineered bacteria was knocked out by CRISPR / Cas9 gene editing and transferred into the type I CRISPRi system of step (1). The target gene affecting the yield of β-alanine was screened by the dual fluorescence detection method of β-alanine. (3) Overexpress the target gene in engineered bacteria and screen for engineered bacteria that produce high levels of β-alanine.

6. The method as described in claim 5, characterized in that, The nucleotide sequence of repeat1 is: ATAAACCG, and the nucleotide sequence of repeat2 is: GAGTTCCCCGCGCCAGCGGGG.

7. The application of the engineered strain with high β-alanine production as described in claim 1 in the fermentation production of β-alanine, characterized in that, The application is as follows: the engineered bacteria are inoculated into a fermentation medium and cultured in a shake flask at 37℃ and 200-220 rpm for more than 12 h. After fermentation, a fermentation broth containing β-alanine is obtained. The fermentation medium consists of: K2HPO4·3H2O 14 g / L, KH2PO4 5.2 g / L, (NH4)2SO4 2 g / L, MgSO4 0.3 g / L, tryptone 1 g / L, ddH2O as the solvent, pH 7.0, and water as the solvent.

8. The application of the engineered strain with high β-alanine production as described in claim 1 in the fermentation production of β-alanine, characterized in that, The application is as follows: the engineered bacteria are inoculated into the culture medium of a fermenter, and fermented for 10 h at 37℃, pH 6-8, and dissolved oxygen value maintained at 20%-50%. Then, the culture medium is fed at a rate of 40-60 mL / min to maintain the glucose residual sugar concentration in the fermentation broth at 2-4 g / L until the fermentation is completed, and a fermentation broth containing β-alanine is obtained. The fermenter culture medium consisted of: 50 g / L glucose, 28 g / L K₂HPO₄·3H₂O, 10.4 g / L KH₂PO₄, 4 g / L NH₄Cl, 0.6 g / L MgSO₄, 2 g / L tryptone, 4 g / L yeast extract, 1 mL 10 × metal ions, and 1 mL / L silicone defoamer, with water as the solvent. The feed culture medium consists of: 50 g / L glucose, 28 g / L K2HPO4·3H2O, 10.4 g / L KH2PO4, 4 g / L NH4Cl, 0.6 g / L MgSO4, 2 g / L tryptone, 4 g / L yeast extract, 1 mL 10× metal ions, and 1 mL / L silicone defoamer, with water as the solvent.

Citation Information

Patent Citations

  • CN115927142A

  • CN117210436A

  • CN117247880A