Compositions and methods for treating primary ciliary dyskinesia

Abstract

The present invention relates to a method for treating primary ciliary dyskinesia (PCD) using a splicing modulator, such as an antisense oligonucleotide, capable of inducing skipping of exon 3 of a Coil Spiral Domain Protein 40 (CCDC40) precursor mRNA. Also provided is a composition comprising the splicing modifier and uses thereof.

Description

[0001] References to Electronic Sequence Listings

[0002] The contents of the electronic sequence listing (SKIP-P-001-PCT ST26.xml; size: 32,229 bytes; creation date: June 14, 2023) are incorporated herein by reference in their entirety.

[0003] CROSS-REFERENCE TO RELATED APPLICATIONS

[0004] This application claims priority to U.S. Provisional Patent Application No. 63 / 358,951, filed on July 7, 2022, entitled “COMPOSITIONS AND METHODS FORTREATING PRIMARY CILIARY DYSKINESIA,” the entire contents of which are incorporated herein by reference. Technical Field

[0005] The present invention belongs to the field of antisense oligonucleotides and therapeutic uses of the antisense oligonucleotides. Background Art

[0006] Primary ciliary dyskinesia (PCD) is an autosomal recessive disorder of ciliary structure, function, and biogenesis that results in chronic infections of the respiratory tract, fertility problems, and organ lateralization disorders. PCD can be caused by mutations in multiple genes. Specifically, mutations in the coiled-coil domain-containing proteins 39 and 40 (CCDC39 and CCDC40) genes have been shown to be the main cause of PCD. The CCDC39 and CCDC40 genes encode structurally related coiled-coil domain-containing proteins that play an important role in cilia formation. Cilia are microtubule-based, hair-like organelles that extend from the surface of multiple cell types in the human body and are involved in both motility and sensory functions. There are two main types of cilia: non-motile and motile. Non-motile cilia act as sensory organelles, while motile cilia provide movement, such as in sperm, lungs, and trachea of ​​the respiratory tract. CCDC39 and CCDC40 are essential for the proper function of motile cilia.

[0007] Recently, functional restoration of gene function in genetic diseases has been achieved by regulating the splicing of mutant genes using antisense oligonucleotides (ASOs). ASOs are single-stranded, chemically modified nucleic acids that bind to the pre-mRNA of the target gene and alter splicing in a way that can restore gene functionality. For example, nonsense mutations that lead to early truncation of the protein can be rescued by using ASOs to induce the exclusion of the mutated exon (also known as exon skipping), thereby preventing early termination of the protein. This will result in the formation of a shorter protein than the native protein, but it may still have full or partial function. In addition, nonsense mutations often trigger RNA degradation through the nonsense-mediated decay (NMD) pathway and thus result in a non-functional protein for the mutant allele. Therefore, the skipped protein replaces the situation where there is no protein at all. Using this strategy, ASOs targeting exon 23 in CFTR have shown encouraging in vitro results in treating nonsense mutations in cystic fibrosis. Similarly, frameshift mutations can be corrected by inducing the exclusion of exons of the correct length to restore the start reading frame upstream and downstream of the mutation. For example, multiple ASO therapies have been approved for the treatment of Duchenne muscular dystrophy that target exons, restoring the start reading frame for some mutations.

[0008] There remains a great need for ASOs that specifically induce exon 3 skipping of CCDC40 pre-mRNA, and methods of using the same, such as for treating or ameliorating PCD. Summary of the invention

[0009] According to one aspect, a method for treating primary ciliary dyskinesia (PCD) in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective amount of at least one synthetic antisense oligonucleotide (ASO), wherein the ASO induces exon 3 skipping of coiled-coil domain-containing protein 40 (CCDC40) pre-mRNA, thereby treating PCD in the subject.

[0010] According to another aspect, a composition comprising an ASO comprising 14 to 25 bases having at least 80% complementarity with CCDC40 pre-mRNA and characterized by inducing splicing activity of exon 3 of CCDC40 pre-mRNA is provided.

[0011] In some embodiments, the ASO comprises a backbone selected from the group consisting of a phosphate-ribose backbone, a phosphate-deoxyribose backbone, a phosphorothioate-deoxyribose backbone, a 2'-O-methyl-phosphorothioate backbone, a phosphorodiamidate morpholinyl backbone, a peptide nucleic acid backbone, a 2-methoxyethyl phosphorothioate backbone, an alternating locked nucleic acid backbone, a phosphorothioate backbone, an N3'-P5' phosphoamide, a 2'-deoxy-2'-fluoro-β-d-arabinoic acid, a cyclohexene nucleic acid backbone nucleic acid, a tricyclic DNA (tcDNA) nucleic acid backbone, and combinations thereof.

[0012] In some embodiments, the ASO comprises 14 to 25 bases.

[0013] In some embodiments, the ASO has at least 75% complementarity with an equal length portion of a nucleic acid sequence derived from the following polynucleotide sequence:

[0014] GTGTCACCACCAGAGAAGGATGATGGCCAGAAAGGTGAAGAAGCTGTCGGTAGCA

[0015] CAGAGCATCCTGAGGAAGTCACAACCCAAGCGGAAGCTGCAATTGAAGAGGGGGA

[0016] GGTGGAGACAGAAGGGGAAGCAGCAGTGGAAGGGGAAGAGGAGGCTGTGTCCTA

[0017] TGGAGATGCTGAAAGCGAAGAGGAATATTACTATACAGAAACTTCATCCCCGGAAG

[0018] GGCAAATCAGTGCTGCAGATACGACTTACCCGTATTTCAGTCCTCCTCAGGAACTGC

[0019] CTGGAGAGGAGGCATACGATAGTGTTAGCGGGGAGGCTGGTCTCCAAGGCTTCCAG

[0020] CAAGAGGCCACCGGTCCACCAGAATCCAGAGAAAGGAGGGTCACCTCCCCAGAGC

[0021] CATCCCACGGAGTCTAGGCCCGTCGGAGCAAATGGGCCAGGTCACCTCTGGGCCAGCAGTGGGCAGATTG (SEQ ID NO: 1).

[0022] In some embodiments, the ASO has at least 75% complementarity to any of: TGTCACCACCAGAGAAGGATGATGGCCAG (SEQ ID NO: 2); AGGATGATGGCCAGAAAGGTGAAGAAGC (SEQ ID NO: 3); and AAGGTGAAGAAGCTGTCGGTAGCACAGA (SEQ ID NO: 4).

[0023] In some embodiments, the ASO comprises a nucleic acid sequence listed in SED ID Nos. 5-7, 23-26, and 28-35.

[0024] In some embodiments, the ASO comprises a nucleic acid sequence listed in SED ID Nos. 5, 6, 23, 25, 26, and 30-33.

[0025] In some embodiments, the ASO comprises a nucleic acid sequence listed in SED ID Nos. 5, 23, 25, 26, 30, and 32.

[0026] In some embodiments, the subject comprises at least one nonsense and / or frameshift mutation in exon 3 of CCDC40.

[0027] In some embodiments, at least one mutation is c.248delC.

[0028] In some embodiments, the ASO comprises the following nucleic acid sequence: CATCATCCTTCTCTGGTGGT (SEQ ID NO: 5); CTTCACCTTTCTGGCCATCA (SEQ ID NO: 6); or TGCTACCGACAGCTTCTTCA (SEQ ID NO: 7).

[0029] In some embodiments, the ASO comprises a chemically modified backbone.

[0030] In some embodiments, the chemically modified backbone includes: a phosphate-ribose backbone, a phosphate-deoxyribose backbone, a thiophosphate-deoxyribose backbone, a 2'-O-methylthiophosphate backbone, a phosphodiamidate morpholino backbone, a peptide nucleic acid backbone, a 2-methoxyethylthiophosphate backbone, an alternating locked nucleic acid backbone, a thiophosphate backbone, an N3'-P5' phosphoramide, a 2'-deoxy-2'-fluoro-β-d-arabinoic acid, a cyclohexene nucleic acid backbone nucleic acid, a tricyclic-DNA (tcDNA) nucleic acid backbone, and combinations thereof.

[0031] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0032] In some embodiments, the composition is used to induce skipping of exon 3 of CCDC40 pre-mRNA in a subject in need thereof or in a cell of the subject.

[0033] In some embodiments, the subject suffers from PCD.

[0034] In some embodiments, the composition is an inhalation composition.

[0035] In some embodiments, the composition is used to treat PCD in a subject in need thereof.

[0036] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the present invention belongs. Although methods and materials similar or equivalent to those described herein may be used in the practice or testing of embodiments of the present invention, exemplary methods and / or materials are described below. In the event of a conflict, the patent specification (including definitions) shall prevail. In addition, materials, methods and examples are illustrative only and are not intended to be limiting.

[0037] Further embodiments and the full scope of applicability of the present invention will become apparent from the detailed description given below. However, it should be understood that while indicating the preferred embodiments of the present invention, the detailed description and specific examples are given by way of illustration only, because from this detailed description, various changes and modifications within the spirit and scope of the present invention will be clear to those skilled in the art. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figures 1A-1F Included are non-limiting schemes, micrographs, and vertical bar graphs demonstrating antisense oligonucleotide microscreening for exon 3 skipping in CCDC40. (1A) CCDC40 plasmid: CCDC40 wild type (CCDC40 WT ) and exon 3 skipping CCDC40 (CCDC40 ex3skp ) design. (1B) Transfection of CCDC40 WT and CCDC40 ex3skp Western blot analysis of protein expression in HEK293 cells 48 hours after plasmid transfection. NT - not transfected. GAPDH is a housekeeping protein used to normalize total protein in lysates. (1C) Densitometric quantification of western blots in (1B). (1D) Oligonucleotide screen including 30 splice switching antisense oligonucleotides (first screen: ASO 1-16 left, and second screen: ASO 17-30 right) to induce skipping (exclusion) of CCDC40 exon 3 in A549 lung epithelial cells. Since ASO2 was identified as a promising and effective ASO, a second screen (ASO 17-30) was further designed to target sequences near the ASO2 binding region with higher resolution. Ctrl - antisense control. GAPDH is a housekeeping gene used for normalization. (1E) Lowest band in (1D) (CCDC40 ex3skp (1F) Snapshot image from UCSC browser showing the genomic location of ASO 1-30 in (1D), spanning the region of exon 3 of CCDC40.

[0039] Figure 2 Includes display CCDC40 ex3skp Fluorescence micrographs of colocalization with microtubules. After transient transfection of plasmids (48 hours), CCDC40 WT and CCDC40 ex3skp Immunofluorescence analysis of colocalization with microtubules in HeLa cells. CCDC40 protein was tagged with Flag at its C-terminus and detected with anti-Flag antibody. Microtubules were detected using an anti-tubulin specific antibody. Nuclei were stained with Hoechst 33342.

[0040] Figures 3A-3D Includes micrographs, vertical bar graphs, and non-restrictive design schemes showing the CCDC40 ex3skp Protein interaction with CCDC39 is similar to that of CCDC40 WT , and ASO-mediated exon 3 skipping can partially restore CCDC40 c.248delC This interaction is lost in the mutant. (3A) Western blot analysis of co-immunoprecipitation of CCDC40 and CCDC39 in HEK293 cells 48 hours after transfection. Samples (transfection) included:

[0041] (1) CCDC39-HA; (2) CCDC40 WT -Flag; (3) CCDC39-HA+CCDC40 WT -Flag; (4)

[0042] CCDC39-HA+CCDC40 SKP -Flag; and (5) CCDC39-HA+LDLR-Flag. CCDC40 protein was tagged with Flag at its C-terminus and detected with anti-Flag antibody. CCDC39 protein was tagged with HA at its C-terminus and detected with anti-HA antibody. Flag-tagged LDLR was used as a negative control (because it is not known to bind to CCDC39). Input - refers to the total cell lysate before immunoprecipitation experiment. Co-IP - refers to the protein fraction eluted from the HA magnetic beads after incubation with the lysate. Unbound - refers to the protein fraction that did not bind to the HA magnetic beads after incubation with the lysate. (3B) Densitometric quantification of the protein blot in (3A). (3C) Flag-tagged CCDC40 plasmid with intron: CCDC40 wild type (CCDC40 WT ) and CCDC40 with c.248delC mutation (CCDC40 c.248delC) non-restrictive design. (3D) Western blot analysis of co-immunoprecipitation of CCDC40 and CCDC39 in HEK293 cells 48 hours after transfection and ASO treatment. Samples (transfection) included: (1) CCDC39-HA+CCDC40 WT -Flag;

[0043] (2) CCDC39-HA+CCDC40 c.248delC -Flag+ASO-ctrl 500nM;

[0044] (3) CCDC39-HA+CCDC40 c.248delC -Flag+ASO-2 500nM; and

[0045] (4) CCDC39-HA+CCDC40 c.248delC -Flag+ASO-2 100nM.

[0046] Figure 4A-4B Including display of CCDC40 ex3skp Fluorescence micrographs of colocalization with CCDC39. (4A) 48 hours after transient transfection of each plasmid in different HeLa cell cultures, CCDC39, CCDC40 WT 、CCDC40 ex3skp Immunofluorescence analysis was performed on CCDC40 and Granulin (GRN was used as a negative control because it is not known to interact with CCDC39). WT 、CCDC40 ex3skp and granulin were tagged with Flag at their C-termini and detected with anti-Flag antibody. CCDC39 was tagged with HA at its C-terminus and detected with anti-HA antibody. Cell nuclei were stained with Hoechst 33342. (4B) 48 hours after transient co-transfection, CCDC39, CCDC40 WT 、CCDC40 ex3skp Immunofluorescence analysis was performed on GRN and granulin (GRN was used as a negative control because it is not known to interact with CCDC39). DETAILED DESCRIPTION

[0047] Treatment

[0048] According to some embodiments, a method for treating primary ciliary dyskinesia (PCD) in a subject is provided. In some embodiments, the method comprises administering to the subject a therapeutically effective amount of a splicing regulator, wherein the splicing regulator induces exon 3 skipping of a coiled-coil domain-containing protein 40 (CCDC40) pre-mRNA, thereby treating PCD in the subject.

[0049] In some embodiments, the method comprises administering a splicing modulator that is at least one synthetic antisense oligonucleotide (ASO).

[0050] In some embodiments, the ASO is an RNA ASO. In some embodiments, the ASO comprises an RNA nucleobase.

[0051] In the context of the ASOs of the present invention, in some embodiments, the nucleic acid sequences provided herein include RNA nucleic acid sequences. In the context of the ASOs provided herein, as known to those skilled in the art, thymine is replaced by uracil, and it is a base that is considered complementary to adenine.

[0052] In some embodiments, the ASO is chemically modified. In some embodiments, the chemical modification is a modification of the ASO backbone. In some embodiments, the chemical modification is a modification of the ASO sugar. In some embodiments, the chemical modification is a modification of the ASO nucleobase. In some embodiments, the chemical modification increases the stability of the ASO in cells. In some embodiments, the chemical modification increases the stability of the ASO in vivo. In some embodiments, the chemical modification increases the ability of the ASO to regulate splicing. In some embodiments, the chemical modification increases the ability of the ASO to induce exon 3 skipping of the CCDC40 pre-mRNA. In some embodiments, the chemical modification increases the half-life of the ASO. In some embodiments, the chemical modification inhibits polymerase extension at the 3' end of the ASO. In some embodiments, the chemical modification inhibits polymerase recognition of the ASO. In some embodiments, the chemical modification inhibits double-stranded degradation. In some embodiments, the chemically modified ASO does not induce nucleic acid double-stranded degradation when binding to the CCDC40 pre-mRNA. In some embodiments, the chemical modification inhibits RISC-mediated degradation. In some embodiments, the chemical modification inhibits RISC-mediated degradation or any parallel nucleic acid degradation pathway.

[0053] In some embodiments, the ASO does not contain a labeling portion. In some embodiments, the ASO is not labeled. In some embodiments, the ASO does not emit a detectable signal or does not include a portion that can be identified to achieve nucleic acid detection (e.g., digoxigenin and fluorescently labeled anti-DIG antibodies). In some embodiments, the detectable signal includes a dye or an emission energy that provides detection of a compound (e.g., a polynucleotide) in vivo or in vitro. In some embodiments, the detectable signal includes: a fluorescent signal, a color signal, or a radioactive signal.

[0054] In some embodiments, the ASO does not contain a radionucleobase; digoxigenin, streptavidin, biotin, a fluorophore, a hapten label, a CLICK label, an amine label, or a thiol label.

[0055] In some embodiments, the chemical modification is selected from: phosphate-ribose backbone, phosphate-deoxyribose backbone, thiophosphate-deoxyribose backbone, 2'-O-methylphosphorothioate backbone, phosphorodiamidate morpholinyl backbone, peptide nucleic acid backbone, 2-methoxyethylphosphorothioate backbone, alternating locked nucleic acid backbone, thiophosphate backbone, N3'-P5' phosphoramide, 2'-deoxy-2'-fluoro-β-d-arabinoic acid, cyclohexene nucleic acid backbone nucleic acid, tricyclic DNA (tcDNA) nucleic acid backbone or any combination thereof.

[0056] In some embodiments, the ASO comprises at least 14 bases, at least 15 bases, at least 16 bases, at least 17 bases, at least 18 bases, at least 19 bases, at least 20 bases, at least 21 bases, at least 22 bases, at least 23 bases, at least 24 bases, or at least 25 bases, or any value and range therebetween. Each possibility represents a separate embodiment of the invention.

[0057] In some embodiments, the ASO comprises 14 to 30 bases, 14 to 28 bases, 14 to 26 bases, 14 to 24 bases, 14 to 21 bases, 14 to 19 bases, 14 to 18 bases, or 14 to 17 bases. Each possibility represents a separate embodiment of the invention. In some embodiments, the ASO comprises 17 to 22 bases.

[0058] In some embodiments, the ASO is complementary to exon 3 of CDDC40 pre-mRNA. In some embodiments, exon 3 of CCDC40 pre-mRNA comprises the following sequence: GTGTCACCACCAGAGAAGGATGATGGCCAGAAAGGTGAAGAAGCTGTCGGTAGCACAGAGCATCCTGAGGAAGTCACAACCCAAGCGGAAGCTGCAATTGAAGAGGGGGAGGTGGAGACAGAAGGGGAAGCAGCAGTGGAAGGGGAAGAGGCTGTGTCCTATGGAGATGCTGAAAGCGAAGAGGAATATTACTATACAGAAACTTCATCCCC GGAAGGGCAAATCAGTGCTGCAGATACGACTTACCCGTATTTCAGTCCTCCTCAGGAACTGCCTGGAGAGGAGGCATACGATAGTGTTAGCGGGGAGGCTGGTCTCCAAGGCTTCCAGCAAGAG GCCACCGGTCCACCAGAATCCAGAGAAAGGAGGGTCACCTCCCCAGAGCCATCCCACGGAGTCTAGGCCCGTCGGAGCAAATGGGCCAGGTCACCTCTGGGCCAGCAGTGGGCAGATTG(SEQ ID NO:1).

[0059] In some embodiments, the ASO is complementary to an equal length portion of a nucleic acid sequence derived from a polynucleotide sequence comprising or consisting of:

[0060] GTGTCACCACCAGAGAAGGATGATGGCCAGAAAGGTGAAGAAGCTGTCGGTAGCA

[0061] CAGAGCATCCTGAGGAAGTCACAACCCAAGCGGAAGCTGCAATTGAAGAGGGGGA

[0062] GGTGGAGACAGAAGGGGAAGCAGCAGTGGAAGGGGAAGAGGAGGCTGTGTCCTA

[0063] TGGAGATGCTGAAAGCGAAGAGGAATATTACTATACAGAAACTTCATCCCCGGAAG

[0064] GGCAAATCAGTGCTGCAGATACGACTTACCCGTATTTCAGTCCTCCTCAGGAACTGC

[0065] CTGGAGAGGAGGCATACGATAGTGTTAGCGGGGAGGCTGGTCTCCAAGGCTTCCAG

[0066] CAAGAGGCCACCGGTCCACCAGAATCCAGAGAAAGGAGGGTCACCTCCCCAGAGC

[0067] CATCCCACGGGAGTCTTAGGCCCGTCGGAGCAAATGGGCCAGGTCACCTCTGGGCCAGCAGTGGGCAGATTG (SEQ ID NO: 1).

[0068] In some embodiments, the ASO is complementary to an equal length portion of a nucleic acid sequence derived from a polynucleotide sequence comprising or consisting of:

[0069] ACCACCAGAGAAGGATGATGGCCAGAAAGGTGAAGAAGCTGTCGGTAGC (SEQ ID NO: 8).

[0070] In some embodiments, the ASO is complementary to any of the following:

[0071] TGTCACCACCAGAGAAGGATGATGGCCAG (SEQ ID NO: 2); AGGATGATGGCCAGAAAGGTGAAGAAGC (SEQ ID NO: 3); and AAGGTGAAGAAGCTGTCGGTAGCACAGA (SEQ ID NO: 4).

[0072] In some embodiments, the ASO is complementary to an equal length portion of a nucleic acid sequence derived from a polynucleotide sequence comprising or consisting of any one of SEQ ID Nos: 1-4.

[0073] In some embodiments, the ASO has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% complementarity with SEQ ID No: 1-4, any value and range therebetween. Each possibility represents a separate embodiment of the invention. In some embodiments, the ASO has 70-80%, 75-85%, 80-90%, 85-95%, 90-99% or 95-100% complementarity with SEQ ID NO: 1-4. Each possibility represents a separate embodiment of the invention.

[0074] The term "complementary" refers to the ability of polynucleotides to form base pairs with each other. Base pairs are usually formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide chains. Complementary polynucleotide chains can be base-paired in a Watson-Crick manner (e.g., A and T, A and U, C and G) or in any other manner that allows the formation of a double strand. As known to those skilled in the art, when RNA is used instead of DNA, uracil instead of thymine is considered to be a base complementary to adenine. However, when U is represented in the context of the present invention, unless otherwise indicated, the ability to replace T is implied.

[0075] In some embodiments, the ASO comprises or consists of the following nucleic acid sequence: CATCATCCTTCTCTGGTGGT (SEQ ID NO: 5); CTTCACCTTTCTGGCCATCA (SEQ ID NO: 6); or TGCTACCGACAGCTTCTTCA (SEQ ID NO: 7).

[0076] In some embodiments, the ASO comprises or consists of a nucleic acid sequence selected from the group consisting of GTGGTGACACCTGTAAAGGT (SEQ ID NO: 9); CCTCAGGATGCTCTGTGCTA (SEQ ID NO: 10); CTTGGGTTGTGACTTCCTCA (SEQ ID NO: 11); CAATTGCAGCTTCCGCTTGG (SEQ ID NO: 12); CCACCTCCCCCTCTTCAATT (SEQ ID NO: 13); CCCTTCTGTCTCCACCTCCC (SEQ ID NO: 14); CTTCCCCTTCTGTCTCCACC (SEQ ID NO: 15); CCCTTCCACTGCTGCTTCCC (SEQ ID NO: 16); CCCCTTCCACTGCTGCTTCC (SEQ ID NO: 17); ACACAGCCTCCTCTTCCCCT (SEQ ID NO: 18); ACTGATTTGCCCTTCCGGGG (SEQ ID NO: 19); CCTCCTCTCCAGGCAGTTCC (SEQ ID NO: 20). NO:20); GGCTACTCACCATCTGCCC (SEQ ID NO:21); CTCTGGTGGTGACACCTGTA (SEQ ID NO:22); CTTCTCTGGTGGTGACACCT (SEQ ID NO:23); ATCCTTCTCTGGTGGTGACA (SEQ ID NO:24); ATCATCCTTCTCTGGTGGTG (SEQ ID NO:25); GCCATCATCCTTCTCTGGTG (SEQ ID NO: 26); CTGGCCATCATCCTTTCTCTG (SEQ ID NO: 27); TTTCTGGCCATCATCCTTCT (SEQ ID NO: 28); ACCTTTCTGGCCATCCT (SEQ ID NO: 29); NO:32); GACAGCTTCTTCACCTTTCT (SEQ ID NO:33); ACCGACAGCTTCTTCACCTT (SEQ ID NO:34); or GCTACCGACAGCTTCTTCAC (SEQ ID NO:35).

[0077] In some embodiments, the ASO comprises or consists of a nucleic acid sequence selected from the group consisting of SED ID NOs: 5-7, 23-26, and 28-35.

[0078] In some embodiments, the ASO comprises or consists of a nucleic acid sequence selected from the group consisting of SED ID NOs: 5, 6, 23, 25, 26, and 30-33.

[0079] In some embodiments, the ASO comprises or consists of a nucleic acid sequence selected from the group consisting of SED ID NOs: 5, 23, 25, 26, 30, and 32.

[0080] Table 1. Internal references to the ASO numbers of the present invention and their respective SEQ ID NOs.

[0081]

[0082]

[0083] In some embodiments, the pre-mRNA is a wild-type pre-mRNA. In some embodiments, the pre-mRNA is a mutant pre-mRNA. In some embodiments, the CCDC40 pre-mRNA includes any one of SEQ ID No: 1-4. In some embodiments, the ASO is complementary to a nucleic acid sequence including any one of SEQ ID NO: 1-4.

[0084] In some embodiments, the ASO comprises an active fragment of any one of SEQ ID NOs: 5-7.

[0085] As used herein, the term "active fragment" refers to a fragment that is 100% identical to a continuous portion of the full nucleotide sequence of an ASO, provided that at least 30%, 40%, 50%, 60%, 70%, 80% or 90% of the activity of the original ASO nucleotide sequence is retained, or any value and range therebetween. Each possibility represents a separate embodiment of the present invention.

[0086] In some embodiments, the ASO is specific for CCDC40 pre-mRNA.

[0087] As used herein, the term "specific" refers to both base pair specificity and gene specificity. In some embodiments, the ASO is specific to the CCDC40 gene. In some embodiments, the ASO is specific to the splicing silencing motif in CCDC40. In some embodiments, the ASO is specific to the splicing silencing region of CCDC40. In some embodiments, the splicing silencing is the splicing silencing of CCDC40 exon 3.

[0088] In some embodiments, the ASO binds to CCDC40 pre-mRNA in a completely complementary manner. In some embodiments, in addition to binding to CCDC40 in a completely complementary manner, the ASO does not bind to any gene or its pre-mRNA product. In some embodiments, in addition to binding to CCDC40 with a complementarity greater than 70, 75, 80, 85, 90, 95, 97, 99 or 100%, the ASO does not bind to any gene or its pre-mRNA product. Each possibility represents a separate embodiment of the present invention. In some embodiments, in addition to binding to CCDC40 with a complementarity greater than 90%, the ASO does not bind to any gene or its pre-mRNA product. In some embodiments, the ASO binds to any one of SEQ ID NO: 1-4 in a completely complementary manner. In some embodiments, in addition to binding to SEQ ID No: 1-4 with a complementarity greater than 70, 75, 80, 85, 90, 95, 97, 99 or 100%, the ASO does not bind to any sequence. Each possibility represents a separate embodiment of the present invention. In some embodiments, in addition to binding to SEQ ID No: 1-4 with a complementarity greater than 90%, the ASO does not bind to any sequence. In some embodiments, the ASO does not bind to any place in the genome or transcriptome (including precursor transcriptomes, for example, transcriptomes including or consisting of precursor mRNA) of cells outside CCDC40 in a completely complementary manner. In some embodiments, the ASO does not bind to any place in the genome or transcriptome (including precursor transcriptomes, for example, transcriptomes including or consisting of precursor mRNA) of cells outside CCDC40 with a complementarity greater than 70, 75, 80, 85, 90, 95, 97, 99 or 100%. Each possibility represents a separate embodiment of the present invention. In some embodiments, the cell is a mammalian cell. In some embodiments, the mammal is a human.

[0089] In some embodiments, the ASO regulates the expression of CCDC40. In some embodiments, the ASO regulates the splicing of CCDC40. In some embodiments, the ASO regulates the splicing of CCDC40 exon 3. In some embodiments, the ASO does not cause off-target effects. In some embodiments, the off-target is a target other than CCDC40. In some embodiments, the off-target is a target other than CCDC40 exon 3 splicing. In some embodiments, the ASO does not substantially or significantly regulate the expression of genes other than CCDC40. In some embodiments, the ASO does not substantially or significantly regulate the splicing of genes other than CCDC40. In some embodiments, the ASO does not substantially or significantly regulate the splicing of exons other than exon 3 of CCDC40. In some embodiments, the substantial regulation of expression is an expression change of at least 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50%. Each possibility represents a separate embodiment of the present invention. In some embodiments, the substantial regulation of expression is an expression change of at least 20%.

[0090] In some embodiments, the ASO is complementary to an exon-intron junction. In some embodiments, the exon is exon 3 of CCDC40 pre-mRNA. In some embodiments, the ASO is complementary to the exon 3-intron 2 junction (or intron 2-exon 3) of CCDC40 pre-mRNA. In some embodiments, the ASO is complementary to the exon 3-intron 3 junction of CCDC40 pre-mRNA.

[0091] As used herein, an exon-intron junction region includes part or all of exon 3, or may be referred to as an exon 3-intron junction region. In some embodiments, the exon 3-intron junction region includes the 5' primer end of exon 3. In some embodiments, the exon 3-intron junction region includes the 3' primer end of exon 3. In some embodiments, the exon 3-intron junction region includes the complete sequence of exon 3. In some embodiments, the exon 3-intron junction region includes the 3' primer end of intron 2. In some embodiments, the exon 3-intron junction region includes the 5' primer end of intron 3.

[0092] In some embodiments, the ASO is at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or 100% complementary to the exon 3-intron junction of the CCDC40 pre-mRNA, or any value and range therebetween. Each possibility represents a separate embodiment of the present invention. In some embodiments, the ASO is 70-85%, 80-90%, 85-95%, 90-99% or 95-100% complementary to the exon 3-intron junction of the CCDC40 pre-mRNA. Each possibility represents a separate embodiment of the present invention.

[0093] In some embodiments, the ASO disclosed herein targets, complements, induces exon 3 skipping of CCDC40 pre-mRNA transcribed from a mutant allele of a CCDC40 gene, or any combination thereof. In some embodiments, the ASO disclosed herein does not target, complement, induce exon 3 skipping of CCDC40 pre-mRNA transcribed from a wild-type allele of a CCDC40 gene, or any combination thereof.

[0094] In some embodiments, the subject comprises or is characterized by having a genome comprising at least one mutation in exon 3 of CCDC40, resulting in a partially or completely non-functional CFTR protein.

[0095] In some embodiments, the mutations are nonsense and / or frameshift.

[0096] In some embodiments, at least one mutation is c.248delC.

[0097] In some embodiments, "mutation" as used herein refers to a nucleotide substitution or modification that induces or results in a "primary ciliary dyskinesia phenotype" in a subject carrying or comprising the mutation.

[0098] In some embodiments, the modification comprises an insertion, a deletion, an inversion, or a combination thereof, so long as the modification results in the primary ciliary dyskinesia phenotype in a subject carrying or comprising the modification.

[0099] As used herein, the term "primary ciliary dyskinesia phenotype" encompasses any symptom or manifestation associated with PCD. Methods for diagnosing PCD and / or symptoms associated therewith are common and apparent to one of ordinary skill in the art.

[0100] In some embodiments, the method relates to improving at least one clinical parameter of PCD in a subject.

[0101] As used herein, the term "treatment" or "treating" a disease, disorder, or condition includes alleviating at least one symptom thereof, reducing its severity, or inhibiting its progression. Treatment does not necessarily mean that the disease, disorder, or condition is completely cured. In order to be an effective treatment method, the useful compositions herein need only reduce the severity of the disease, disorder, or condition, reduce the severity of the symptoms associated therewith, or improve the quality of life of the patient or subject.

[0102] As used herein, the term "condition" includes anatomical and physiological deviations from the normal condition which constitute a disruption of the normal state of a living animal or a part thereof, which interrupts or alters the performance of bodily functions.

[0103] As used herein, the term "subject" or "individual" or "animal" or "patient" or "mammal" refers to any subject for which treatment is desired, particularly a mammalian subject (eg, a human).

[0104] In some embodiments, a method for treating primary ciliary dyskinesia (PCD) in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective amount of a synthetic antisense oligonucleotide (ASO), wherein the ASO induces exon 3 skipping of CCDC40 pre-mRNA, thereby treating PCD in the subject.

[0105] Composition

[0106] According to some embodiments, a composition is provided comprising an ASO comprising 14 to 30 bases having at least 80% complementarity with CCDC40 pre-mRNA and characterized by inducing splicing activity of exon 3 of CCDC40 pre-mRNA.

[0107] In some embodiments, the composition includes a plurality of ASOs characterized by inducing splicing activity of different target pre-mRNAs.

[0108] As used herein, the term "plurality" refers to any integer equal to or greater than two.

[0109] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0110] The term "pharmaceutically acceptable carrier" as used herein refers to any standard pharmaceutical carrier known in the art, such as sterile solutions, tablets, coated tablets and capsules. Typically, such carriers contain excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acid or its salts, magnesium stearate or calcium stearate, talc, vegetable fats or oils, gums, ethylene glycol or other known excipients. Such carriers may also include flavor and color additives or other ingredients. Examples of pharmaceutically acceptable carriers include, but are not limited to, the following substances: water, saline, buffer, inert substances, non-toxic solids (e.g., mannitol, talc). Compositions including such carriers are formulated by well-known conventional methods. Depending on the intended mode of administration and intended use, the composition may be in the form of a solid, semisolid or liquid dosage form, such as, for example, powders, granules, crystals, liquids, suspensions, liposomes, nanoparticles, nanoemulsions, pastes, creams, ointments, etc., or may be unit dosage forms suitable for relatively precise dosing.

[0111] In some embodiments, the pharmaceutical composition is formulated for oral administration. In some embodiments, the pharmaceutical composition is formulated for nasal administration. In some embodiments, the pharmaceutical composition is formulated for administration by inhalation. In some embodiments, the pharmaceutical composition is formulated for abdominal administration. In some embodiments, the pharmaceutical composition is formulated for subcutaneous administration. In some embodiments, the pharmaceutical composition is formulated for intraperitoneal administration. In some embodiments, the pharmaceutical composition is formulated for intravenous administration.

[0112] In some embodiments, the pharmaceutical composition is formulated for systemic administration. In some embodiments, the pharmaceutical composition is formulated for administration to a subject. In some embodiments, the subject is a human subject. It will be understood by those skilled in the art that the pharmaceutical composition intended to be administered to the subject should not have off-target effects, for example, effects other than the intended therapeutic effect. In some embodiments, the pharmaceutical composition has no substantial effect on genes other than CCDC40. In some embodiments, the pharmaceutical composition has no substantial effect on exon splicing other than exon 3 of CCDC40. In some embodiments, the substantial effect is an effect with a phenotypic consequence. In some embodiments, the substantial effect is a harmful effect. In some embodiments, harmful is relative to the health and / or well-being of the subject.

[0113] In some embodiments, the composition is administered by inhalation. In some embodiments, the composition is an inhaled composition. In some embodiments, the ASO or a pharmaceutical composition comprising the same as disclosed and described above is used to modulate the splicing of CCDC40 pre-mRNA transcribed from a CCDC40 gene having a mutant exon 3.

[0114] As used herein, the phrase "modulation of splicing" refers to changes in the levels of any RNA or mRNA variant that affect the production of CCDC40 native, mutant, or both pre-mRNA.

[0115] In certain embodiments, the use is for reducing the level of an mRNA molecule comprising a mutant exon 3.

[0116] In some embodiments, the ASO or pharmaceutical composition comprising the same as disclosed and described above is used in a method of improving at least one clinical parameter of PCD. In some embodiments, the ASO or pharmaceutical composition comprising the same as disclosed and described above is used to treat PCD.

[0117] Production method

[0118] According to some embodiments, a method for producing a compound useful for treating PCD is provided.

[0119] In some embodiments, the method includes obtaining a compound that binds to CCDC40 pre-mRNA exon 3. In some embodiments, the method includes measuring the skipping of exon 3 of CCDC40 pre-mRNA in the presence of the obtained compound. In some embodiments, the method includes selecting at least one compound that induces the exclusion of exon 3 from CCDC40 pre-mRNA.

[0120] In some embodiments, the method includes obtaining a compound that binds to exon 3 of CCDC40 pre-mRNA, and measuring the skipping of exon 3 of CCDC40 pre-mRNA in the presence of the obtained compound, and selecting at least one compound that induces the exclusion of exon 3 from CCDC40 pre-mRNA, thereby producing a compound suitable for treating PCD.

[0121] In some embodiments, the method includes obtaining a compound that binds to SEQ ID NO:1.

[0122] In some embodiments, the compound is an ASO. In some embodiments, the ASO is an ASO as disclosed and described herein.

[0123] Methods for determining exon skipping are common. Non-limiting examples of such methods include, but are not limited to, PCR, qPCR, gene sequencing, northern blot, dot blot, in situ hybridization, or other methods known to those of ordinary skill in the art.

[0124] General Description

[0125] If a range of values ​​is provided, it is understood that each intervening value between the upper and lower limits of the range and any other specified or intervening value in the range, to one-tenth of the unit of the lower limit, is included in the present invention unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also included in the present invention, subject to any specifically excluded limits in the stated range. Where the stated range includes one or both limits, the present invention also includes ranges excluding one or both of these included limits.

[0126] As used herein, the term "about" in conjunction with a value refers to plus or minus 10% (±10%) of the reference value. For example, a length of about 1000 nanometers (nm) refers to a length of 1000 nm±100 nm.

[0127] It should be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a polynucleotide" includes a plurality of such polynucleotides and reference to "the polypeptide" includes reference to one or more polypeptides and equivalents thereof known to those skilled in the art, and so forth. It should be further noted that the claims may be drafted to exclude any optional elements. Therefore, this statement is intended to serve as a reference basis for use of exclusive terminology such as "solely," "only," and the like when reciting claim elements or using a "negative" limitation.

[0128] Where a convention similar to "at least one of A, B, and C, etc." is used, generally, such interpretation is in the sense in which a person skilled in the art would understand the convention (e.g., "a system having at least one of A, B, and C" would include, but is not limited to, systems having only A, only B, only C, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). Those skilled in the art would further understand that, whether in the specification, claims, or drawings, substantially any antonymous conjunction and / or phrase presenting two or more optional terms should be understood to contemplate the possibility of including one of the terms, either of the terms, or both of the terms. For example, the phrase "A or B" would be understood to include the possibility of "A" or "B" or "A and B."

[0129] It should be understood that certain features of the invention described in the context of separate embodiments for clarity may also be provided in combination in a single embodiment. Conversely, various features of the invention described in the context of a single embodiment for brevity may also be provided separately or in any suitable subcombination. All combinations of embodiments related to the invention are specifically contemplated by the invention and are disclosed herein, as if each combination were individually and expressly disclosed. In addition, all subcombinations of various embodiments and elements thereof are specifically contemplated by the invention and are disclosed herein, as if each such subcombination were individually and expressly disclosed herein.

[0130] By studying the following examples, those skilled in the art will be aware of additional objects, advantages and novel features of the present invention, which are not intended to be limiting. In addition, each of the various embodiments and aspects of the present invention described above and claimed in the appended claims is experimentally supported in the following examples.

[0131] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the appended claims section find experimental support in the following examples.

[0132] Unless otherwise specified, all scientific and technical terms used herein have the meanings commonly used in the art. The definitions provided herein are for ease of understanding of certain terms frequently used herein and are not meant to limit the scope of the present disclosure.

[0133] Before describing the specific aspects and embodiments of the present invention in detail, it should be understood that the present invention is not limited to the specific methods and experimental conditions described, because these methods and conditions can vary. It should also be understood that the terms used herein are only used to describe specific embodiments and are not intended to be limiting, because the scope of the present invention will only be limited by the appended claims.

[0134] In the discussion, unless otherwise stated, adjectives such as "substantially" and "about" that modify conditions or relationship characteristics of one or more features of embodiments of the present invention should be understood to mean that the condition or feature is defined within an acceptable tolerance range for the operation of the embodiment for its intended application. Unless otherwise stated, the word "or" in the specification and claims is considered to be an inclusive "or", not an exclusive "or", and means at least one or any combination of the items it connects.

[0135] It should be understood that the terms "a" and "an" used above and elsewhere herein refer to "one or more" of the listed components. It will be clear to those of ordinary skill in the art that the use of the singular includes the plural unless otherwise specifically stated. Therefore, the terms "a", "an" and "at least one" can be used interchangeably in this application.

[0136] For a better understanding of the present teachings, and without limiting the scope of the teachings in any way, all numbers expressing quantities, percentages or ratios and other numerical values ​​used in the specification and claims, unless otherwise indicated, should be understood to be modified by the word "about" in all cases. Therefore, unless otherwise indicated, the numerical parameters set forth in the following specification and the appended claims are approximate values ​​and may vary depending upon the desired properties sought. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0137] In the specification and claims of this application, each verb "comprise", "include" and "have" and their cognates are used to indicate that one or more objects of the verb are not necessarily a complete list of components, elements or parts of the one or more subjects of the verb.

[0138] Other terms used herein are meant to be defined by their commonly known meanings in the art.

[0139] Unless otherwise specified or obvious from the context, the word "or" as used herein should be understood to be inclusive.

[0140] In this specification and claims, the word "comprise" or variations such as "comprises" or "comprising" means the inclusion of any stated integer or group of integers but not the exclusion of any other integer or group of integers.

[0141] As used herein, the term "consists essentially of," or variations such as "consist essentially of," used throughout the specification and claims, means the inclusion of any recited integer or group of integers, and the optional inclusion of any recited integer or group of integers that does not materially change the basic or novel characteristics of a specified method, structure, or composition.

[0142] As used herein, the terms "comprises", "comprising", "containing", "having", etc. may mean "includes", "including", etc.; "consisting essentially of" or "consists essentially of" also have the meanings specified in U.S. patent law, and the term is open-ended, allowing more than the content described, as long as the basic or novel features of the content are not changed by the more than the content described, but does not include prior art implementations. In one embodiment, the terms "comprises", "comprising", "having" can be interchangeable with "consisting".

[0143] Although the present invention has been described in detail, it will be appreciated by those skilled in the art that many changes and modifications may be made. Therefore, the present invention should not be interpreted as being limited to the specifically described embodiments, and the scope and concept of the present invention will be more easily understood by referring to the claims.

[0144] Example

[0145] Generally, the nomenclature used herein and the laboratory procedures used in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are fully explained in the literature. For example, see "Molecular Cloning: A laboratory Manual" (1989) by Sambrook et al. "Current Protocols in Molecular Biology", Ausubel, RM edited, Vol. 1 to Vol. 3 (1994); Ausubel et al. "Current Protocols in Molecular Biology", John Wiley & Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al. "Recombinant DNA", Scientific American Books, New York; Birren et al. (ed.) "Genome Analysis: A Laboratory Manual Series", Vol. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methods such as those listed in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Vols. 1-3, Cellis, JE ed. (1994); "Culture of Animal Cells-A Manual of Basic Technique", Freshney, Wiley-Liss, New York (1994), 3rd edition; "Current Protocols in Immunology", Vols. 1-3, Coligan JE ed.Editors (1994); Stites et al. (eds.), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds.), "Strategies for Protein Purification and Characterization-A Laboratory Course Manual", CSHL Press (1996); "Monoclonal Antibodies: Methods and Protocols", Vincent Ossipow, Nicolas Fischer, Humana Press (2014); "Monoclonal Antibodies: Methods and Protocols", Maher Albitar, Springer Science & Business Media (2007), all of which are incorporated herein by reference. Other general references are provided in this document. .

[0146] Example 1

[0147] The stability of CCDC40 lacking exon 3 is comparable to that of WT CCDC40

[0148] To evaluate whether exon 3 skipped CCDC40 is expressed at the protein level, the present inventors designed two plasmids: a plasmid encoding the complete cDNA sequence of wild-type CCDC40 (CCDC40 WT ), and a second deletion of exon 3 (CCDC40 ex3skp )( Figure 1A ). Plasmids were ordered from VectorBuilder encoding the cDNA sequence of transcript NM_017950.4. HEK293T cells were transfected with 1 μg of each plasmid using FuGene HD transfection reagent, and protein lysates were prepared in RIPA buffer with a protease / phosphatase inhibitor cocktail 48 hours after transfection. CCDC40 expression was analyzed by Western blot using a specific anti-CCDC40 antibody (Proteintech #25049-1-AP) that detects the C-terminal region of CCDC40 ( Figure 1B ). CCDC40 ex3skp The protein expression seems to be related to CCDC40 WT Similarity indicates that CCDC40 ex3skp is stable and is not a target for degradation.

[0149] Example 2

[0150] ASO induces exon 3 skipping

[0151] To identify ASOs that can induce CCDC40 exon 3 skipping, the present inventors designed a mini-screen consisting of 30 ASOs targeting CCDC40 exon 3 and ASO controls ( Figure 1F ). The ASO consists of 20 nucleotides with complete phosphorothioate (PS) and 2'-O-methoxyethyl (2'-MOE) chemical modifications. The PS modification improves stability, increases nuclease resistance, and enhances transport across the cell membrane. The 2'-MOE modification increases the binding affinity to RNA and further improves nuclease resistance. Importantly, when all 20 nucleotides are modified with 2'-MOE, the ASO does not recruit RNase-H, and therefore, it is suitable for exon skipping experiments. A549 cells (lung epithelial) were transfected with 500nM of the different ASOs using Lipofectamine 2000 transfection reagent. RNA was extracted 48 hours after transfection, reverse transcribed, and exon skipping was assessed by semi-quantitative PCR ( Figure 1D Densitometry analysis of the first microscreen (ASOs 1-16) showed that ASOs 2, 3, and 4 (SEQ ID NOs: 5-7) induced skipping of exon 3 of CCDC40, respectively, compared to cells treated with the control ASO ( Figure 1E Left panel). A second miniscreen (ASO 17-30) was designed to increase the resolution around the ASO-2 binding site. Densitometry analysis showed that most ASOs in this region induced skipping of exon 3 compared to the control ASO ( Figure 1E right).

[0152] Example 3

[0153] CCDC40 lacking exon 3 colocalizes with microtubules

[0154] As an evaluation of CCDC40 ex3skp In the first step to functionalize CCDC40 ex3skp The subcellular localization of CCDC40 is similar to that of CCDC40, which is known to colocalize with microtubules. WT To this end, the inventors transiently transfected CCDC40 ex3skp and CCDC40 WTAfter plasmid (48 hours), colocalization was assessed by immunofluorescence in HeLa cells. CCDC40 in both plasmids was tagged with Flag at the C-terminus and detected with anti-Flag antibody (Sigma-Aldrich #F1804). Microtubules were detected using anti-tubulin antibody (Abcam #ab6046). Nuclei were stained with Hoechst 33342. Images were taken with a confocal Leica microscope. CCDC40 WT and CCDC40 ex3skp The expression of CCDC40 was similar and both colocalized with microtubules, indicating that the deletion of exon 3 does not affect the basic functional properties of CCDC40. Figure 2 ).

[0155] Example 4

[0156] CCDC40 with skipped exon 3 maintains physical interaction with CCDC39

[0157] To further evaluate CCDC40 ex3skp To investigate the functionality of CCDC40, the inventors demonstrated the physical and functional relationship between WT and skipped versions of CCDC40 and its known interactor, CCDC39 (Merveille et al., Nat Genet (2011)). Structural studies have shown that CCDC39 and CCDC40 form a complex that is important for guiding the placement of radial spokes along bimodal microtubules that form motile cilia (Gui et al., Nat Struct Mol Biol (2021)). Plasmids encoding cDNA for CCDC39 and CCDC40 WT or CCDC40 ex3skp The present inventors demonstrated that CCDC39 and CCDC40 WT The physical interactions between CCDC39 and CCDC40 ex3skp This strengthens the hypothesis that exclusion of exon 3 from CCDC40 does not abolish its interaction with CCDC39 ( Figure 3A-3B). In this experiment, HEK293T cells were transfected with 1 μg of plasmid (single transfection) or 0.5 μg of plasmid (double transfection) using FuGene HD transfection reagent. 48 hours after transfection, protein lysates were prepared in RIPA IP buffer with a protease / phosphatase inhibitor cocktail. The protein lysates were then immunoprecipitated with HA magnetic beads (ThermoFisher #88837) according to the manufacturer's instructions. The amount of CCDC40 co-immunoprecipitated with CCDC39 was analyzed by western blot using an anti-Flag antibody. The successful binding of HA beads to CCDC39-HA was analyzed by western blot using an anti-HA antibody. LDLR was used as a flag tag negative control because it is known not to interact with CCDC39. Next, the inventors demonstrated rescue of this interaction using ASOs on mutant copies of the gene ( Figure 3C-3D ). To this end, the inventors designed a CCDC40 plasmid with a partial intron (300 bp at each end of the intron) between exons 1-9, and then the inventors only included cDNA ( Figure 3C WT and mutant (c.248delC) CCDC40 plasmids carrying part of the intron were co-immunoprecipitated with CCDC39 plasmids with or without ASO-2, which has been previously shown to induce exon 3 skipping. The results showed that ASO-2 not only has the ability to rescue the truncated mutant protein, but also restores its interaction with CCDC39 ( Figure 3D ).

[0158] Example 5

[0159] CCDC40 WT and the skipping version colocalize with CCDC39 on microtubules

[0160] Furthermore, by immunofluorescence in HeLa cells after transient co-transfection of CCDC39 and CCDC40 plasmids, the inventors demonstrated that CCDC39 altered CCDC40 in a similar manner. WT and CCDC40 ex3skp First, CCDC40-flag, CCDC40 ex3skp -flag, CCDC39-HA, and GRN-flag (as a negative control, as it is known not to interact with CCDC39) plasmids were transfected into HeLa cells alone ( Figure 4A ). After 48 hours, cells were fixed and immunostained with anti-Flag and anti-HA antibodies. Cell nuclei were stained with Hoechst 33342. Images were taken with an EVOS FL microscope. ex3skpappears to be evenly dispersed throughout the microtubules within the cell body, whereas CCDC39 appears to be concentrated in small spots along the microtubules ( Figure 4A ). Transfection of CCDC39 together with CCDC40 resulted in the latter colocalizing with CCDC39 at small spots along microtubules. This colocalization with CCDC39 was consistent for both WT and skipped versions or forms of CCDC40, but did not appear to occur when cells were cotransfected with CCDC39 and an irrelevant control gene ( Figure 4B ).

[0161] Although the present invention has been described in detail, it will be appreciated by those skilled in the art that many variations and modifications may be made thereto. Therefore, the present invention should not be construed as being limited to the specifically described embodiments, and the scope and concept of the present invention will be more readily understood by reference to the claims.

Claims

1. A method for treating primary ciliary dyskinesia (PCD) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one synthetic antisense oligonucleotide (ASO), wherein the ASO induces skipping of exon 3 of coiled-coil domain-containing protein 40 (CCDC40) pre-mRNA, thereby treating PCD in the subject.

2. The method of claim 1, wherein the ASO comprises a backbone selected from the group consisting of a phosphate-ribose backbone, a phosphate-deoxyribose backbone, a thiophosphate-deoxyribose backbone, a 2'-O-methyl-thiophosphate backbone, a phosphodiamidate morpholinyl backbone, a peptide nucleic acid backbone, a 2-methoxyethylthiophosphate backbone, an alternating locked nucleic acid backbone, a thiophosphate backbone, an N3'-P5' phosphoamide, a 2'-deoxy-2'-fluoro-β-d-arabinoic acid, a cyclohexene nucleic acid backbone nucleic acid, a tricyclic DNA (tcDNA) nucleic acid backbone, and combinations thereof.

3. The method according to claim 1 or 2, wherein the ASO comprises 14 to 25 bases.

4. The method according to any one of claims 1 to 3, wherein the ASO has at least 75% complementarity with an equal length portion of a nucleic acid sequence derived from the following polynucleotide sequence: GTGTCACCACCAGAGAAGGATGATGGCCAGAAAGGTGAAGAAGCTGTCGGTAGCACAGAGCATCCTGAGGAAGTCACAACCCAAGCGGAAGCTGCAATTGAAGAGGGGGAGGTGGAGACAGAAGGGGAAGCAGCAGTGGAAGGGGAAGAGGAGGCTGTGTCCTATGGAGATGCTGAAAGCGAAGAGGAATATTACTATACAGAAACTTCATCCCCGGAAGGGCAAATCAGT GCTGCAGATACGACTTACCCGTATTTCAGTCCTCCTCAGGAACTGCCTGGAGAGGAGGCATACGATAGTGTTAGCGGGGGAGGCTGGTCTCCAAGGCTTCCAGCAAGAGGCCACCGGTCCACCAGAATCCAGAGAAAGGAGGGTCACCTCCCCAGAGCCATCCCACGGAGTCTTAGGCCCGTCGGAGCAAATGGGCCAGGTCACCTCTGGGCCAGCAGTGGGCAGATTG(SEQ ID NO:1).

5. The method according to any one of claims 1 to 4, wherein the ASO has at least 75% complementarity with any one of the following sequences: TGTCACCACCAGAGAAGGATGATGGCCAG (SEQ ID NO: 2); AGGATGATGGCCAGAAAGGTGAAGAAGC (SEQ ID NO: 3); and AAGGTGAAGAAGCTGTCGGTAGCACAGA (SEQ ID NO: 4).

6. The method according to any one of claims 1 to 5, wherein the ASO comprises a nucleic acid sequence listed in any one of the following: SED ID NOs: 5-7, 23-26 and 28-35.

7. The method according to any one of claims 1 to 6, wherein the ASO comprises a nucleic acid sequence listed in any one of the following: SED ID NOs: 5, 6, 23, 25, 26 and 30-33.

8. The method according to any one of claims 1 to 7, wherein the ASO comprises a nucleic acid sequence listed in any one of the following: SED ID NOs: 5, 23, 25, 26, 30 and 32.

9. The method according to any one of claims 1 to 8, wherein the subject comprises at least one nonsense and / or frameshift mutation in exon 3 of CCDC40.

10. The method of claim 9, wherein the at least one mutation is c.248delC.

11. A composition comprising an ASO comprising 14 to 25 bases having at least 80% complementarity with CCDC40 pre-mRNA and characterized in that Induces the splicing activity of exon 3 of the CCDC40 pre-mRNA.

12. The composition of claim 11, wherein the ASO comprises a nucleic acid sequence listed in SED ID Nos: 5-7, 23-26 and 28-35.

13. The composition according to claim 11 or 12, wherein the ASO comprises a nucleic acid sequence listed in SED ID No: 5, 6, 23, 25, 26 and 30-33.

14. The composition according to claim 11 or 12, wherein the ASO comprises a nucleic acid sequence listed in SED ID No: 5, 23, 25, 26, 30 and 32.

15. The composition of any one of claims 11 to 14, wherein the ASO comprises a chemically modified backbone.

16. The composition of claim 15, wherein the chemically modified backbone comprises: Phosphate-ribose backbone, phosphate-deoxyribose backbone, thiophosphate-deoxyribose backbone, 2'-O-methyl-thiophosphate backbone, phosphorodiamidate morpholino backbone, peptide nucleic acid backbone, 2-methoxyethylthiophosphate backbone, alternating locked nucleic acid backbone, thiophosphate backbone, N3'-P5' phosphoamide, 2'-deoxy-2'-fluoro-β-d-arabinoic acid, cyclohexene nucleic acid backbone nucleic acid, tricyclic DNA (tcDNA) nucleic acid backbone and combinations thereof.

17. The composition according to any one of claims 11 to 16, further comprising a pharmaceutically acceptable carrier.

18. A composition according to any one of claims 11 to 17 which is an inhalation composition.

19. A composition according to any one of claims 11 to 18 for use in treating PCD in a subject in need thereof.

20. The composition according to any one of claims 11 to 18, for inducing skipping of exon 3 of the CCDC40 pre-mRNA in a subject in need thereof or in a cell of the subject.

21. The composition for use according to claim 20, wherein the subject suffers from PCD.

Images