Application of USP9X inhibitor in preparation of medicine for treating ovarian cancer and drug combination for improving effect of chemotherapy medicine for ovarian cancer

Abstract

The invention provides application of a USP9X inhibitor in preparation of a medicine for treating ovarian cancer and application of the USP9X inhibitor in preparation of a combined medicine for improving the medication effect of an ovarian cancer chemotherapy medicine. On one hand, the USP9X inhibitor is independently used to significantly inhibit development of ovarian cancer, and on the other hand, the USP9X inhibitor significantly improves the chemotherapy effect and improves the chemosensitivity of tumors to first-line chemotherapy drugs such as paclitaxel (PTX), cis-platinum (CDDP) and carboplatin. The pharmaceutical mechanism of the USP9X inhibitor in ovarian cancer treatment is found for the first time. According to the present invention, the single drug treatment of the USP9X inhibitor and the combined treatment of the USP9X inhibitor and the chemotherapeutic drug can significantly reduce the USP9X and Hif2alpha protein levels, and the half-life period detection of the protein finds that the USP9X inhibitor can promote the degradation of the Hif2alpha-dependent proteasome so as to provide the antitumor effect;

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology and relates to a pharmaceutical composition for treating ovarian cancer and its pharmaceutical application. Specifically, it relates to the application of USP9X inhibitor in the preparation of therapeutic drugs for treating ovarian cancer and in combined use of the drugs for improving the efficacy of chemotherapeutic drugs for ovarian cancer. Background Art

[0002] Ovarian cancer is one of the most common malignant tumors of the female reproductive system, with more than 295,000 new cases of ovarian cancer and more than 184,000 deaths worldwide each year, ranking first among gynecological malignancies. Despite the rapid development of oncology and medical technology in recent years, the 5-year survival rate of ovarian cancer patients is still only about 40%. The main reason is that ovarian cancer develops in an insidious manner, and most patients are not discovered until they develop into the late stage, at which time it is almost impossible to completely remove the tumor tissue through surgery. Moreover, advanced cancer cells are more likely to resist and develop drug resistance to chemotherapy drugs, resulting in recurrence in about 70% of patients and extremely poor prognosis. Therefore, revealing the molecular mechanism of ovarian cancer recurrence and drug resistance and developing corresponding treatment strategies are urgent needs to solve the poor prognosis of ovarian cancer patients in clinical practice. Summary of the invention

[0003] The purpose of the present invention is to systematically explain the important biological functions of USP9X in the occurrence and development of ovarian cancer through systematic in vitro and in vivo functional experiments and clinical sample studies, and to prove that quantitative detection of USP9X transcription and protein expression levels is expected to become a reliable marker for the diagnosis and stratification of ovarian cancer. In a conversion-oriented treatment experiment, treatment experiments using in situ tumors, patient-derived xenografts (PDX), organoids, and chemotherapy-resistant cell models proved that inhibition of USP9X significantly inhibited the occurrence of ovarian cancer, and specific USP9X inhibitors effectively treated ovarian cancer and increased the sensitivity of patient-derived ovarian cancer to first-line chemotherapy drugs, achieving an effective combined treatment effect. The present invention provides a new target, namely USP9X, for the diagnosis, treatment and targeted treatment of clinical ovarian cancer, and at the same time proves that USP9X inhibitors can become reliable drugs for improving the sensitivity of ovarian cancer chemotherapy and achieving effective combined treatment.

[0004] In order to achieve the above-mentioned object, the present invention provides the use of a USP9X inhibitor in the preparation of a drug for treating ovarian cancer.

[0005] The USP9X inhibitors described in the present invention include both nucleotide inhibitors that target the USP9X gene and inhibit the expression of USP9X, and inhibitors that target the USP9X protein and inhibit the function of the USP9X protein.

[0006] Preferably, the USP9X inhibitor is an RNA interference sequence, and the RNA interference sequence targets at least one nucleotide sequence among gene numbers NM_001410748.1, NM_001410749.1, NM_001039590.3 or NM_001039591.3.

[0007] Preferably, in any of the above items, the USP9X inhibitor comprises the shRNA sequence shown in SEQ ID NO:1 and / or SEQ ID NO:2.

[0008] Preferably, any of the above items is that the USP9X inhibitor is a small molecule chemical inhibitor.

[0009] Preferably, in any of the above items, the USP9X inhibitor comprises WP1130.

[0010] The present invention also provides the use of a USP9X inhibitor in the preparation of a combined drug for improving the efficacy of ovarian cancer chemotherapy drugs, wherein the USP9X inhibitor includes any one of the above-mentioned USP9X inhibitors.

[0011] In combination therapy, USP9X inhibitors significantly enhance the sensitivity of ovarian cancer to chemotherapy drugs.

[0012] The present invention also provides a pharmaceutical composition for treating ovarian cancer, comprising a chemotherapy drug for treating ovarian cancer and a USP9X inhibitor.

[0013] Preferably, the chemotherapy drug for treating ovarian cancer includes at least one of cisplatin, carboplatin or paclitaxel.

[0014] Preferably, any of the above items has an IC50 value of paclitaxel higher than 6 nM, preferably 6 nM to 54 nM, preferably 6, 10, 15, 20, 30, 40, 50, 54 nM and the range therebetween; preferably greater than 55 nM.

[0015] Preferably, any of the above items has an IC50 of cisplatin higher than 3.7 μM, preferably 3.7 μM to 27 μM, preferably 3.7, 10, 15, 20, 25, 27 μM, and preferably greater than 28 μM.

[0016] Preferably, any of the above items is that the USP9X inhibitor is 0.1 μM to 100 μM WP1130. More preferably, it is 0.1, 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 μM WP1130 and ranges therebetween.

[0017] The present invention also provides the use of USP9X in preparing ovarian cancer diagnosis and stratification products.

[0018] The present invention provides quantitative detection of USP9X transcription and protein expression levels as a potential reliable marker for the diagnostic stratification of ovarian cancer, and is applied in the diagnostic stratification of ovarian cancer.

[0019] Preferably, the quantitative detection of USP9X transcription level includes, but is not limited to, quantitative detection using various PCR techniques (such as qPCR, etc.), DNA hybridization technology, in situ hybridization technology, high-throughput sequencing technology, etc.

[0020] Preferably, the expression level of USP9X protein is quantitatively detected by Western Blot, ELISA, mass spectrometry, protein microarray, immunohistochemistry and immunofluorescence.

[0021] In a preferred embodiment of the present invention, USP9X is significantly highly expressed in malignant ovarian cancer tissues, confirming that the protein expression level of USP9X (Gene ID: 8239) is significantly positively correlated with the malignant progression of ovarian cancer; USP9X (Gene ID: 8239) mRNA is significantly highly expressed in highly advanced and poorly differentiated ovarian cancer. The present invention found that the expression level of USP9X is positively correlated with the pathological grade of ovarian cancer. Moreover, patients with high expression of USP9X have a significantly worse prognosis after receiving cisplatin or paclitaxel treatment compared with patients with low expression of USP9X.

[0022] The present invention provides a new application of USP9X inhibitors in the preparation of drugs for treating ovarian cancer:

[0023] 1) On the one hand, the USP9X inhibitor of the present invention can significantly inhibit the development of ovarian cancer when used alone, and on the other hand, the USP9X inhibitor can significantly improve the effect of chemotherapy.

[0024] 2) The present invention found that knocking down USP9X by shRNA significantly inhibited the occurrence of ovarian cancer organoids and tumors, and increased the sensitivity of tumors to first-line chemotherapeutic drugs PTX and CDDP.

[0025] 3) The present invention found that USP9X inhibitors including WP1130 significantly inhibited ovarian cancer organoids and effectively improved the chemosensitivity of various ovarian cancer cells to first-line chemotherapy drugs paclitaxel PTX and cisplatin CDDP.

[0026] 4) The present invention discovered for the first time the drug mechanism of USP9X inhibitors in the treatment of ovarian cancer. Monotherapy with USP9X inhibitors, as well as combined therapy with USP9X inhibitors and chemotherapeutic drugs (such as PTX, CDDP, etc.), significantly reduced USP9X and Hif2ɑ protein levels. Moreover, protein half-life detection found that USP9X inhibitor WP1130 promoted the proteasome-dependent degradation of Hif2ɑ, thereby exerting an anti-tumor effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a graph showing the significant correlation between the expression level of USP9X and the malignant progression and chemotherapy resistance of ovarian cancer in preferred embodiment 1 of the present invention.

[0028] Figure 2 This is a graph showing the results of knocking down USP9X in preferred embodiment 2 of the present invention to inhibit the occurrence of ovarian cancer and improve its chemotherapy sensitivity.

[0029] Figure 3 This is a graph showing the results of the USP9X inhibitor in preferred embodiment 3 of the present invention inhibiting ovarian cancer organoids and improving chemotherapy sensitivity.

[0030] Figure 4 The whole tissue imaging of primary ovarian cancer cell-derived organoids treated with different drugs in embodiment 3 of the present invention is preferred.

[0031] Figure 5 The USP9X inhibitor in preferred embodiment 4 of the present invention effectively treats ovarian cancer and significantly improves the therapeutic effect of first-line chemotherapy drugs on patient-derived ovarian cancer transplanted tumors.

[0032] Figure 6 The immunohistochemical staining results of Ki-67, Cleaved-Caspase3, CA9 and PAX8 (ovarian cancer markers) in preferred embodiment 4 of the present invention are shown.

[0033] Figure 7 For the preferred implementation of the present invention 5 Figure 3 In B, USP9X and Hif2ɑ immunofluorescence staining was performed on primary cell-derived organoids from ovarian cancer patients after treatment with USP9X inhibitors and PTX / CBP.

[0034] Figure 8 For the preferred implementation of the present invention 5 Figure 5 In B, immunohistochemical staining of USP9X and Hif2ɑ was performed on ovarian cancer PDX tumor tissues after treatment with USP9X inhibitor and PTX / CBP.

[0035] Fig. 9 In the preferred embodiment 5 of the present invention, the USP9X and Hif2ɑ protein levels and half-lives are detected by Western Blot.

[0036] Fig.10 This is the result of detecting the interaction between USP9X and Hif2ɑ by co-immunoprecipitation in ovarian cancer cells of different species in the preferred embodiment 6 of the present invention.

[0037] Fig.11This is the result of the preferred embodiment 6 of the present invention, in which different amounts of Flag-tagged USP9X are overexpressed in ovarian cancer cells of different species using a lentivirus-mediated transfection system, and the protein expression of Hif2ɑ is detected.

[0038] Fig.12 In the preferred embodiment 6 of the present invention, wild-type USP9X or mutant USP9X with defective deubiquitinase activity with Flag tag is overexpressed in HEK293T cells. C1566S , as well as HA-tagged Hif2ɑ and different types of ubiquitin proteins, and then the results of ubiquitination experiments.

[0039] Fig.13 This is the result of detecting the protein half-life of Hif2ɑ in USP9X stably knocked-down ovarian cancer cells and control cells in preferred embodiment 6 of the present invention. DETAILED DESCRIPTION

[0040] The present invention is further described in detail below through the accompanying drawings and specific embodiments.

[0041] Example 1

[0042] USP9X is significantly highly expressed in malignant ovarian cancer tissues and is positively correlated with chemotherapy resistance (Example 1 confirms that the protein expression level of USP9X is significantly positively correlated with the malignant progression of ovarian cancer, and the mRNA of USP9X is significantly highly expressed in highly advanced and poorly differentiated ovarian cancer).

[0043] In order to detect the pathological correlation between USP9X and ovarian cancer, Example 1 systematically performed immunohistochemical analysis on a series of ovarian cancer tissue sections of different stages, and analyzed the samples in the database, and found that the expression level of USP9X was positively correlated with the pathological grade of ovarian cancer. Moreover, patients with high expression of USP9X had a significantly worse prognosis after receiving cisplatin or paclitaxel treatment compared with patients with low expression of USP9X.

[0044] Experimental process:

[0045] Tissue chips from ovarian cancer patients of different stages (including benign, borderline, and malignant) were selected for immunohistochemical staining of USP9X, and it was found that the expression level of USP9X increased from benign to borderline and then to malignant cancer tissues.

[0046] Then, the expression of USP9X transcription level in TCGA ovarian cancer samples included in the Kaplan-Meier plotter (www.kmplot.com) data set was statistically analyzed, and the content of USP9X was higher in highly advanced and poorly differentiated ovarian cancer.

[0047] Further statistical analysis found that patients with high USP9X expression had significantly worse prognosis after receiving cisplatin or paclitaxel treatment compared with patients with low USP9X expression, and this trend of worse prognosis was more significant in the high-grade / poorly differentiated group.

[0048] The antibody used for immunohistochemical staining of USP9X in Example 1 is preferably Anti-USP9X (#55054-1-AP, Proteintech, 1:1000), however, the present invention is not limited thereto, and all antibody products for detecting USP9X protein in the prior art are suitable for the present invention.

[0049] like Figure 1 As shown, the expression level of USP9X is significantly correlated with the malignant progression and chemotherapy resistance of ovarian cancer; A is USP9X IHC staining on ovarian cancer tissues with different progressions (n=83); B is the expression of USP9X between low-grade (grade 1 and 2) and high-grade (grade 3 and 4) groups based on the ovarian cancer sample information of TCGA; C is the survival analysis of ovarian cancer patients with different USP9X expression levels after receiving paclitaxel (PTX) or cisplatin (CDDP) treatment based on different TCGA and GEO databases.

[0050] Example 2

[0051] Knockdown of USP9X inhibits the occurrence of ovarian cancer and improves its chemotherapy sensitivity.

[0052] In Example 2, primary cell organoids derived from ovarian cancer patients and different ovarian cancer cell lines were used to explore the effects of USP9X knockdown on cancer occurrence and chemotherapy resistance. It was found that knockdown of USP9X significantly inhibited the occurrence of ovarian cancer organoids and tumors, and increased the tumor's sensitivity to first-line chemotherapy drugs PTX and CDDP.

[0053] Experimental process:

[0054] Using the high-serous ovarian cancer organoid culture kit (bisGenous, K2167-HS), follow the instructions, mix the primary cell suspension from ovarian cancer patients and Matrigel in a 1:1 ratio and place on ice, inoculate in the center of a 24-well plate as soon as possible, place at 37 degrees for 30 minutes (2500 cells / well), add 500 μl of organoid culture medium to each well, and observe the size of the organoid after 5 days of culture. For the USP9X knockout primary cell organoid formation experiment, the primary cells were infected with USP9X knockdown lentivirus (shRNA was cloned into the pLKO.1 lentiviral vector, and the core plasmids were packaged using pAX8 and pVSVG to produce lentivirus. The shRNA sequence is shUSP9X#12 as shown in SEQ ID NO:1: CGACCCTAAACGTAGACATTA, and shUSP9X#13 as shown in SEQ ID NO:2:

[0055] CGATTCTTCAAAGCTGTGAAT)) and then cultured the organoids. It was found that USP9X knockdown significantly inhibited the efficiency of organoid formation.

[0056] On the other hand, mouse ovarian cancer cell line ID8 was infected with lentivirus to obtain a stable cell line by inoculating 5×10 6 Mouse high-grade serous ovarian cancer cells ID8 (ID8-luc) expressing luciferase were injected into the ovarian bursa cavity of C57BL / 6 mice to establish an orthotopic tumor model, and the Caliper IVIS Spectrum System was used for visualization analysis. After 5 weeks, the mice were killed and the mouse tumors were collected and weighed for comparison. Compared with ID8-luc cells, USP9X deficiency significantly reduced the bioluminescent signal intensity of local and intraperitoneal tumors in transplanted mice. The volume and number of orthotopic tumors in the peritoneum and small intestine were significantly reduced. Among them, the RNA targeting sequences were shUSP9X#2 with a nucleotide sequence as shown in SEQ ID NO:3 and shUSP9X#3 with a nucleotide sequence as shown in SEQ ID NO:4.

[0057] In the chemotherapy sensitivity experiment, ID8 ovarian cancer cells with stable knockdown of USP9X and control cells were inoculated at 1000 cells / well, and stimulated with PTX (starting concentration 500nM) or CDDP (starting concentration 100μM) by half-dilution method. After 72h, the cell viability was detected by CCK-8 method. It was found that USP9X knockdown increased the sensitivity of ovarian cancer cells to two types of first-line chemotherapy drugs (cisplatin and paclitaxel), and the IC50 of PTX treatment decreased from 55nM to 6nM, and the IC50 of CDDP treatment decreased from 28μM to 3.7μM.

[0058] like Figure 2 As shown, knockdown of USP9X inhibits the occurrence of ovarian cancer and improves its chemotherapy sensitivity, wherein A is an organoid formed in primary ovarian cancer cells with USP9X knockdown, and organoids with a diameter greater than 75 μm were used for analysis, and the right panel is a quantitative chart, scale: 100 μm; B is the mouse ovarian cancer cells with USP9X knockdown and control cells were implanted in situ into the mouse ovary, and the in situ tumors were collected and weighted after 5 weeks, with n=4 mice in each group, and the right panel is a quantitative chart; C is the dose-response curve and IC50 value of mouse ovarian cancer cells and control cells with USP9X knockdown treated with paclitaxel PTX or cisplatin CDDP for 72 hours (shUSP9X#2 and #3 in the figure are different targeting sequences of RNA, respectively, shUSP9X#2 shown in SEQ ID NO: 3: GATAATTGCAGCCCTTATTAA, shUSP9X#3 shown in SEQ ID NO: 4: TCGTAATGTATGCCAATTTAG).

[0059] Example 3

[0060] USP9X inhibitors suppress ovarian cancer organoid formation and enhance chemotherapy sensitivity of cancer cells.

[0061] Example 3 used primary cell organoid culture from ovarian cancer patients and ovarian cancer cell lines of different species to explore the effect of USP9X-specific inhibitors on chemotherapy drug response and tumor organoid development. It was found that USP9X inhibitors significantly inhibited ovarian cancer organoids and effectively improved the chemosensitivity of various ovarian cancer cells to first-line chemotherapy drugs paclitaxel PTX and cisplatin CDDP.

[0062] Experimental process:

[0063] The primary cell suspension from ovarian cancer patients and Matrigel were mixed in a 1:1 ratio and placed on ice. They were seeded in the center of a 24-well plate as soon as possible. After being placed at 37 degrees for 30 minutes (2500 cells / well), each well was supplemented with 500 μl of organoid culture medium. After 14 days of culture, USP9X inhibitor WP1130 (WP1130 concentration is preferably 0.1uM to 100uM; 1μM is further preferred in Example 3), chemotherapy drugs paclitaxel (PTX, 1nM) and carboplatin (CBP, 1μM) were given respectively, or WP1130 and chemotherapy drugs PTX / CBP were given at the same time. After 7 days, the size of the organoid was observed under a phase contrast microscope. Cell proliferation and apoptosis were evaluated by Ki67 and Cleaved-Caspase3 immunofluorescence staining. The number of organoids, formation efficiency, Ki67, and Cleaved-Caspase3 positive efficiency were quantitatively counted to evaluate the effects of USP9X inhibitors on ovarian cancer organoid occurrence and cancer cell chemotherapy response.

[0064] like Figure 3 As shown, USP9X inhibitors inhibit ovarian cancer organoids and improve chemotherapy sensitivity, where A is the dose-response curve and IC50 value of human high-grade serous ovarian cancer cells CAOV3 and mouse high-grade serous ovarian cancer cells ID8 treated with WP1130 for 72 hours; B is the dose-response curve and IC50 value of human high-grade serous ovarian cancer cells CAOV3 and mouse high-grade serous ovarian cancer cells ID8 treated with WP1130 (1 μM) and cisplatin CDDP or paclitaxel PTX for 72 hours.

[0065] like Figure 4 As shown, whole-tissue imaging of primary ovarian cancer cell-derived organoids treated with different drugs, and cell proliferation and apoptosis were evaluated by Ki67 and Cleaved-Caspase3 immunofluorescence staining. The quantification chart is on the right, scale bar: 100 μm.

[0066] Example 4

[0067] USP9X inhibitors are effective in treating ovarian cancer and significantly improve the efficacy of first-line chemotherapy drugs in treating patient-derived ovarian cancer xenografts.

[0068] Example 4 Tumor tissue from ovarian cancer patients was subcutaneously implanted into BALB / c female nude mice to construct an ovarian cancer PDX model, and then USP9X inhibitors were used for treatment alone and in combination with first-line chemotherapy drugs to explore the anticancer effect of USP9X inhibitors themselves and their effects on the response to chemotherapy drugs. It was found that on the one hand, USP9X inhibitors significantly inhibited the development of ovarian cancer when used alone, and on the other hand, USP9X inhibitors significantly improved the effect of chemotherapy.

[0069] Experimental process:

[0070] The patient's tumor mass was subcutaneously implanted into the dorsal flank of 8-week-old female BALB / c nude mice to construct an ovarian cancer PDX tumor model. The mouse strain was purchased from Vital River Laboratory Animal Technology Co., Ltd. (Vital River, Beijing, China) (n=4). After tumor formation reached a palpable process, USP9X inhibitor WP1130 (30 mg / kg), chemotherapeutic drugs PTX (20 mg / kg) and CBP (60 mg / kg) were administered by intraperitoneal injection, or WP1130 and chemotherapeutic drugs PTX / CBP were administered simultaneously. 1 time / 3 days, 12 cycles, n=4 mice per group. Tumor volume was measured approximately every 10 days and calculated according to the following formula: volume (mm3) = 1 / 2 × length × width 2. Tumor growth curves of ovarian cancer PDX models receiving different therapies were drawn based on changes in tumor volume. Mice were killed after 40 days of treatment, and tumor tissues were collected and weighed for comparison. Ki67 and Cleaved-Caspase3 immunofluorescence staining were used to evaluate cell proliferation and apoptosis, and CA9 and PAX8 immunofluorescence staining were used to evaluate tumor tissue hypoxia and lineage specificity. Ki-67, Cleaved-Caspase3, CA9 and PAX8 positive efficiency were quantitatively counted to evaluate the effect of USP9X inhibitor itself on the development process of ovarian cancer PDX tumors and the effect on the treatment effect of first-line chemotherapy drugs.

[0071] like Figure 5 As shown, USP9X inhibitors effectively treat ovarian cancer and significantly improve the therapeutic effect of first-line chemotherapy drugs on patient-derived ovarian cancer transplanted tumors, where A is a tumor mass derived from an ovarian cancer patient, which was subcutaneously implanted into the dorsal flank of 8-week-old female BALB / c nude mice to construct an ovarian cancer PDX tumor model. After palpable tumor formation, different therapies were used for treatment by intraperitoneal injection, once / 3 days, for 12 cycles, with n=4 mice in each group. The tumor growth curve of the ovarian cancer PDX model was drawn by volume measurement and calculation; B and C are the PDX model tumors in A that were harvested and weighed to compare the tumor weights after different treatments, with n=4 mice in each group.

[0072] Figure 6 Shown are the above-mentioned immunohistochemical staining of Ki-67, Cleaved-Caspase3, CA9 and PAX8 (ovarian cancer markers), and statistical quantification, scale bar: 50 μm.

[0073] Example 5

[0074] In Example 5, the USP9X inhibitor exerts an anti-tumor effect by promoting the proteasome-dependent degradation of Hif2ɑ. As a deubiquitinating enzyme, USP9X functions by maintaining the stability of proteins, and our previous studies have found that Hif2ɑ may be a potential substrate of USP9X. Through immunofluorescence, immunohistochemistry, and Western Blot detection of primary cell-derived organoids from ovarian cancer patients after treatment with USP9X inhibitors and PTX / CDDP, PDX tumor tissues, and ovarian cancer cells of different species, it was found that USP9X inhibitor monotherapy and combined treatment with PTX / CDDP significantly reduced USP9X and Hif2ɑ protein levels. Moreover, protein half-life detection found that the USP9X inhibitor WP1130 promoted the proteasome-dependent degradation of Hif2ɑ, thereby exerting an anti-tumor effect.

[0075] Experimental process:

[0076] Example 5 For Example 3 Figure 3 The primary cell-derived organoids from ovarian cancer patients after treatment with USP9X inhibitor and PTX / CDDP in B, and Figure 5 In B, ovarian cancer PDX tumor tissues after treatment with USP9X inhibitor and PTX / CDDP were subjected to immunofluorescence and immunohistochemistry staining of USP9X and Hif2ɑ, respectively, and statistical quantification was performed to evaluate the protein expression levels of the two molecules under different treatment conditions.

[0077] On the other hand, Western Blot was used to detect the protein expression levels of USP9X and Hif2ɑ in different species of ovarian cancer cells and primary cells from ovarian cancer patients stimulated by the USP9X inhibitor WP1130 and the protein synthesis inhibitor cycloheximide (CHX).

[0078] like Figure 7-9 As shown, USP9X inhibitors exert antitumor effects by promoting proteasome-dependent degradation of Hif2ɑ.

[0079] like Figure 7 As shown, for Figure 3 In B, USP9X and Hif2ɑ immunofluorescence staining was performed on primary cell organoids derived from ovarian cancer patients after treatment with USP9X inhibitors and PTX / CBP. The quantification chart is on the right, scale bar: 100 μm.

[0080] like Figure 8 As shown, for Figure 5B. Immunohistochemical staining of USP9X and Hif2ɑ in ovarian cancer PDX tumor tissues after treatment with USP9X inhibitor and PTX / CBP, with quantification graphs on the right. Scale bar, 50 μm.

[0081] like Fig. 9 The figure shows the detection of USP9X and Hif2ɑ protein levels and half-life by Western Blot, where A is the detection of USP9X and Hif2ɑ protein levels by Western Blot in different species of ovarian cancer cells and primary cells of ovarian cancer patients stimulated by USP9X inhibitor WP1130. B is the detection of USP9X and Hif2ɑ protein half-life by Western Blot in different species of ovarian cancer cells stimulated by USP9X inhibitor WP1130.

[0082] Example 6

[0083] USP9X mediates the deubiquitination modification of Hif2ɑ protein through direct interaction and stabilizes its protein level. Based on the previous findings that USP9X inhibitor treatment significantly reduces Hif2ɑ expression in ovarian cancer cells and that Hif2ɑ may be a potential substrate of USP9X, Example 6 systematically confirms the molecular mechanism by which USP9X, as a deubiquitinating enzyme, promotes cancer by stabilizing Hif2ɑ during the development of ovarian cancer through protein interaction, USP9X overexpression, ubiquitination experiments, and protein half-life experiments. The results show that USP9X does indeed stabilize its protein level by directly binding to Hif2ɑ protein, removing its ubiquitination modification.

[0084] Experimental process:

[0085] In order to detect the direct interaction between USP9X and HIF-2α in ovarian cancer cells of different species, and the effect of USP9X dose on the expression level of HIF-2α, Example 6 first used the immunoprecipitation method to detect the binding of endogenous USP9X and HIF-2α, and found that HIF-2α or USP9X could be precipitated in cells using USP9X or HIF-2α as bait.

[0086] On the other hand, after overexpressing different doses of Flag-tagged USP9X in CAOV3 and ID8 cells (6-well plates were transfected with 0μg, 1.0μg, 2.0μg, and 3μg plasmid gradients per well), it was found that Flag-USP9X increased the level of HIF-2α protein in a dose-dependent manner. Subsequently, wild-type USP9X or mutant USP9X with defective deubiquitinase activity, as well as HA-tagged Hif2ɑ and different types of ubiquitin proteins were overexpressed in HEK293T cells, and the level of Hif2ɑ ubiquitination was detected by immunoprecipitation experiments. Western Blot was used to detect the protein expression levels of USP9X and Hif2ɑ in ovarian cancer cells that had been knocked down by USP9X and stimulated with the protein synthesis inhibitor cycloheximide (CHX).

[0087] Example 6 also found that although HIF-1ɑ and HIF-2ɑ are both hypoxia-inducible factors, they have overlapping but different functions. In the present invention, overexpression of USP9X stabilizes the level of HIF-2ɑ protein without affecting the level of HIF-1ɑ protein.

[0088] The method for constructing the overexpression vector in Example 6 is similar to that in Example 2, wherein the target gene fragment is cloned into the pLKO.1 lentiviral vector, and the pAX8 and pVSVG core plasmids are used to package the lentivirus, wherein:

[0089] The plasmid overexpressing different amounts of Flag-tagged USP9X (i.e., the plasmid overexpressing the wild-type Flag-tagged USP9X), wherein the inserted target gene fragment is a Flag-tagged USP9X expression sequence (Flag-USP9X); the Flag-tagged USP9X expression sequence is shown in SEQ ID NO: 5.

[0090] A mutant USP9X plasmid defective in deubiquitinase activity, wherein the inserted gene is a fragment encoding a mutant USP9X defective in deubiquitinase activity in which the codon encoding Cys (cysteine) at position 1566 is mutated to a codon encoding Ser (serine) C1566S Expression sequence (Flag-USP9X C1566S ); mutant USP9X defective in deubiquitinase activity C1566S The expressed sequence is shown in SEQ ID NO:6.

[0091] The plasmid expressing Hif2α protein containing an HA tag has an inserted gene fragment of a HIF-2α expression sequence containing an HA tag (HA-HIF-2α): the HIF-2α expression sequence containing an HA tag is shown in SEQ ID NO: 7.

[0092] The construction method of plasmids expressing different types of ubiquitin proteins is described in Proteostatic reactivation of the developmental transcription factor TBX3 drives BRAF / MAPK-mediated tumorigenesis (DOI: 10.1038 / s41467-024-48173-9).

[0093] like Figures 10 to 13 Shown is the deubiquitination of USP9X and stabilization of Hif2ɑ protein expression.

[0094] like Fig.10 Shown is the interaction between USP9X and Hif2ɑ detected by co-immunoprecipitation in ovarian cancer cells of different species.

[0095] like Fig.11 As shown, different amounts of Flag-tagged USP9X were overexpressed in ovarian cancer cells of different species using a lentivirus-mediated transfection system, and the protein expression of Hif2ɑ was detected.

[0096] like Fig.12 Shown are the overexpression of Flag-tagged wild-type USP9X or mutant USP9X deficient in deubiquitinase activity in HEK293T cells C1566S , as well as HA-tagged Hif2ɑ and different types of ubiquitin proteins, and then ubiquitination experiments were performed.

[0097] like Fig.13 Shown is the protein half-life of Hif2ɑ detected in USP9X stably knocked-down ovarian cancer cells and control cells.

[0098] The above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. Application of USP9X inhibitors in the preparation of drugs for the treatment of ovarian cancer.

2. The use according to claim 1, characterized in that The USP9X inhibitor is an RNA interference sequence, and the targeting sequence of the RNA interference sequence is NM_001410748.1, At least one of NM_001410749.1, NM_001039590.3 or NM_001039591.

3.

3. The use according to claim 1, characterized in that The USP9X inhibitor includes shUSP9X#12 whose nucleotide sequence is shown in SEQ ID NO:1, and / or shUSP9X#13 whose nucleotide sequence is shown in SEQ ID NO:

2.

4. The use according to claim 1, characterized in that The USP9X inhibitor is a small molecule inhibitor.

5. The use according to claim 4, characterized in that The USP9X inhibitors include WP1130.

6. Use of a USP9X inhibitor in the preparation of a combined drug for improving the efficacy of ovarian cancer chemotherapy drugs, wherein the USP9X inhibitor comprises the USP9X inhibitor according to any one of claims 1 to 5.

7. A pharmaceutical composition for treating ovarian cancer, characterized in that: Including chemotherapy drugs and USP9X inhibitors for the treatment of ovarian cancer.

8. The pharmaceutical composition according to claim 7, characterized in that The chemotherapy drug for treating ovarian cancer includes at least one of cisplatin, carboplatin or paclitaxel.

9. The pharmaceutical composition according to claim 8, characterized in that The IC50 value of paclitaxel is higher than 6 nM; the IC50 value of cisplatin is higher than 3.7 μM; the USP9X inhibitor is 0.1 uM to 100 uM WP1130.

10. Application of USP9X in the preparation of ovarian cancer diagnostic stratification products.

Images