Method for rapidly obtaining transgenic raspberry plant

Abstract

The invention discloses a method for rapidly obtaining a transgenic raspberry plant. 3-6 mature leaves facing downwards from the top end of the raspberry are selected as receptor materials, the receptor materials are contacted with agrobacterium rhizogenes ATCC15834 for infection, the infected receptor materials are inserted into a soil matrix for co-culture, antibiotics are applied every week after co-culture, then calluses are formed at petioles, the calluses are differentiated into roots, and the roots sprout, so that the raspberry is obtained. And finally obtaining a transgenic raspberry plant. The method has the advantages of simplicity, short culture period and no need of tissue culture.

Description

Technical Field

[0001] The invention relates to the technical field of plant transgenic technology, and in particular to a method for quickly obtaining transgenic raspberry plants. Background Art

[0002] Raspberry (Rubus ideaus L.) is a perennial small shrub fruit tree of the genus Rubus in the family Rosaceae. Fresh raspberry fruit is rich in a variety of nutrients, including a variety of vitamins, mineral elements, amino acids and a variety of bioactive substances that are beneficial to human health. It is an emerging fruit for nutrition and health care. The difficulty of raspberry to adapt to cold and warm growth conditions, its sensitivity to high temperature environment and its low tolerance to high temperature are important constraints for the widespread promotion of raspberry planting. The traditional hybrid breeding method is used to breed new varieties, which has a long cycle and a large workload, and is affected by the variation of the breeding materials themselves, so the improvement is limited. With the rapid development of biotechnology, plant cell engineering and genetic engineering technologies are becoming more and more mature. On the basis of keeping other traits of the variety relatively stable, the traits controlled by exogenous genes can be used to improve the directional characteristics, which improves the efficiency of breeding and provides a new way to breed new raspberry varieties.

[0003] The study of raspberry genetic transformation is the basis of genetic engineering breeding, but there are very limited reports on the success of raspberry genetic transformation at home and abroad, and all of them are obtained by plant tissue culture. The genetic transformation of raspberries is mostly carried out by Agrobacterium-mediated method at home and abroad, and other genetic transformation methods, such as gene gun method, PEG chemical mediation method, pollen tube channel method, etc., are less studied. At present, there are no successful reports on obtaining transgenic raspberry plants without tissue culture at home and abroad. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a method for quickly obtaining transgenic raspberry plants. The present invention uses mature raspberry leaves as receptor materials and mediates raspberry genetic transformation through Agrobacterium rhizogenes ATCC15834-PK7WG2D.1. The method has the advantages of simple method, short culture cycle and no need for tissue culture.

[0005] To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0006] The present invention provides a method for rapidly obtaining transgenic raspberry plants, comprising the following steps:

[0007] (1) Preparation of receptor material: Select mature leaves with the top facing downward from the seedlings of raspberries, sterilize them, and cut fresh wounds at the petioles to serve as receptor materials;

[0008] (2) Infection: Dip the receptor material into Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 bacteria for infection;

[0009] (3) Co-cultivation: The infected receptor material is inserted into the soil matrix for co-cultivation;

[0010] (4) Selective culture: Antibiotics are applied to the recipient material after co-culture, and antibiotics are applied once a week to obtain transgenic raspberry plants after culture.

[0011] Furthermore, in step (1), the mature leaves are sterilized in a 1‰ potassium permanganate dilution for 10 to 15 minutes.

[0012] Furthermore, in step (2), Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 carries the PK7WG2D.1 plasmid, and the PK7WG2D.1 plasmid carries the EGFP reporter gene behind the proID promoter;

[0013] The infection time is 3 to 5 seconds.

[0014] Furthermore, the nucleotide sequence of the EGFP reporter gene is shown in SEQ ID NO: 1; and the infection time is 5 s.

[0015] Furthermore, the method for preparing the bacterial body of Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 comprises the following steps:

[0016] 1) The PK7WG2D.1 plasmid was electroporated into Agrobacterium rhizogenes competent cells ATCC15834 to obtain a single colony of Agrobacterium rhizogenes ATCC15834-PK7WG2D.1;

[0017] 2) Streaking and activating a single colony of Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 on TY solid medium containing antibiotics to grow a single colony;

[0018] 3) Pick a single colony and inoculate it in TY liquid medium containing antibiotics for activation culture to obtain an activated bacterial solution;

[0019] 4) inoculating the activated bacterial solution into TY liquid culture medium containing antibiotics to obtain a bacterial solution;

[0020] 5) The bacterial liquid was centrifuged to collect the bacterial cells, and the cells were added to the MMA resuspension solution for resuspending and then statically cultured. The bacterial cells were collected by centrifugation to obtain the Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 bacterial cells.

[0021] Furthermore, in the antibiotic-containing TY solid culture medium and the antibiotic-containing TY liquid culture medium, the antibiotic is spectinomycin, and the content of spectinomycin is 100 mg / L.

[0022] Furthermore, in step 2), the streaking activation condition is culturing in the dark in a 28° C. incubator for 2 days;

[0023] In the step 3), the activation culture conditions are 28° C., 200 rpm shaking culture for 12 to 16 hours;

[0024] In the step 4), the volume ratio of the activated bacterial solution to the TY liquid culture medium containing antibiotics is 1:900-1000, and the culture conditions are 28° C. and 200 rpm shaking culture until the bacterial solution OD600 is 0.8-1.0;

[0025] In the step 5), the components of the MMA resuspension solution include 10 mM magnesium chloride, 10 mM 2-morpholineethanesulfonic acid, 100 μM acetosyringone, pH=5.6; the static culture condition is 2 to 4 hours.

[0026] Furthermore, in step (3), the composition of the soil matrix is ​​matrix soil: peat soil: vermiculite mass ratio = 2:1:1;

[0027] The co-cultivation conditions are a temperature of 24±2°C, a humidity of 80-90%, a light intensity of 3000-3500 lux, a photoperiod of 16 hours of light and 8 hours of darkness, and a growth period of 7 days.

[0028] Furthermore, in step (4), the antibiotic is kanamycin, the concentration is 100 mg / L, and the application amount is 200 to 300 mL.

[0029] Furthermore, in step (3) and step (4), foliar fertilizer is sprayed on the receptor material every week during the co-cultivation and selection culture stages. The foliar fertilizer is a 500-fold diluted solution of nitrogen, phosphorus and potassium water-soluble fertilizer, and the spraying amount is 50 mL.

[0030] Beneficial effects of the present invention:

[0031] 1. The present invention utilizes Agrobacterium rhizogenes to infect raspberry leaves to obtain transgenic hairy roots, and further cultivates transgenic raspberry plants from the transgenic hairy roots. The entire genetic transformation process does not require aseptic operation. Compared with the traditional method of obtaining transgenic plants through plant tissue culture, not only is the genetic transformation operation simpler and more convenient, but the genetic transformation cycle is also greatly shortened. Transgenic raspberry plants can be obtained in only 8 to 10 weeks.

[0032] 2. The method of the present invention successfully achieved the transformation of raspberry leaves as the receptor material, and obtained transgenic plants containing the GFP reporter gene through Agrobacterium rhizogenes mediation and subsequent further cultivation, which laid a good foundation for the transformation of the target gene.

[0033] 3. The present invention is simple to operate, has a short culture cycle, and does not require plant tissue culture and aseptic operation. The receptor material used in the present invention is easy to obtain, and the genetic transformation experiment of raspberries can be carried out without material restrictions. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is the plasmid map of PK7WG2D.1;

[0035] Figure 2 A technical roadmap for a method to rapidly obtain transgenic raspberry plants;

[0036] Figure 3 The phenotype comparison diagram of transgenic raspberry plants and untransformed raspberry plants under natural light and 475nm excitation light;

[0037] In the figure, a-b: transgenic raspberry plants and untransformed raspberry plants under natural light, a: transgenic plants, b: untransformed raspberry plants;

[0038] c~d: transgenic and untransformed raspberry plants under 475nm excitation light, c: transgenic plants, d: untransformed raspberry plants;

[0039] Figure 4 This is the PCR detection diagram of transgenic raspberry plants;

[0040] In the figure, M represents DNA Maker, and WT represents untransformed raspberry plants. DETAILED DESCRIPTION

[0041] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0042] Test Materials:

[0043] 1. Receptor material: 3 to 6 mature leaves from the top of the raspberry seedling.

[0044] 2. Strains and plasmids: The Agrobacterium rhizogenes strain used in the experiment was Agrobacterium rhizogenes competent cell ATCC15834, purchased from Shanghai Weidi Biotechnology Co., Ltd. The plasmid used in the experiment was PK7WG2D.1 plasmid. The plasmid map is as follows: Figure 1 As shown, the plasmid carries the EGFP reporter gene behind the proID promoter, and the nucleotide sequence of the EGFP reporter gene is shown in SEQ ID NO:1.

[0045] 3. Culture medium or solution formulation

[0046] (1) YT solid or liquid medium: 3 g / L Yeast Extract, 5 g / L Tryptone, 10 mM CaCl2, 15 g / L Agar in solid medium;

[0047] (2) MMA resuspension solution: 10 mM magnesium chloride (MgCl2), 10 mM 2-morpholineethanesulfonic acid (MES), 100 μM acetosyringone (AS), pH = 5.6;

[0048] (3) Antibiotics: 100 mg / L Spectinomycin (Spe), 100 mg / L Kanamycin (Km);

[0049] (4) AS acetosyringone: Weigh a certain amount of AS, dissolve it in 95% alcohol, and finally dilute it with sterile distilled water to prepare a 100 mM stock solution. Sterilize it by filtering with a 0.45 μm filter membrane and store it at -20°C.

[0050] (5) Soil matrix composition: mass ratio of matrix soil: peat soil: vermiculite = 2:1:1.

[0051] Example 1

[0052] Preparation of Agrobacterium for infection

[0053] 1. Transform PK7WG2D.1 plasmid into Agrobacterium rhizogenes competent cells ATCC15834

[0054] (1) Take out the 0.1 cm electric shock cup and cup cover from the storage solution and invert it on clean absorbent paper for 5 minutes to drain the water. Place it upright for 5 minutes to allow the ethanol to evaporate completely. Once the ethanol has evaporated, immediately insert it into ice and compact the ice surface. Keep the top of the electrode cup 0.5 cm away from the ice surface to facilitate the cup cover. Let it stand in the ice for 5 minutes to fully cool down.

[0055] (2) Take the competent cells of Agrobacterium rhizogenes ATCC15834 stored at -80°C and put them in ice for 5 min. After they melt, add 100 ng of PK7WG2D.1 plasmid DNA (the plasmid carries the EGFP reporter gene after the proID promoter, and the nucleotide sequence of the EGFP reporter gene is shown in SEQ ID NO: 1), stir the bottom of the tube by hand to mix, and immediately put it in ice. Use a 200 μL pipette tip to quickly transfer the competent cell-plasmid mixture to the electroporation cup, cover the cup, and keep the empty tube for later use.

[0056] (3) Start the electroporator and set the parameters: C = 25 μF, PC = 200 ohm, V = 2400 V. Take the electroporation cup out of the ice, dry the outer surface with absorbent paper, quickly put it into the electroporation tank, start the electroporation, and quickly insert it into ice after the electroporation is completed. Add 1 mL of liquid TY culture medium without antibiotics and transfer it to a 1.5 mL empty tube. Incubate at 28°C with shaking for 2 to 3 h.

[0057] (4) Centrifuge at 6000 rpm for one minute to collect the bacteria. Take about 100 μL of the supernatant and gently blow to resuspend the bacteria. Spread the plate on a TY solid culture medium containing 100 mg / L Spe antibiotics and invert it in a 28°C incubator for 72 h.

[0058] (5) Pick a single clone and perform PCR detection using primers GFP-F / R. The primer sequences are as follows:

[0059] GFP-F: ATGGTGAGCAAGGGCGAGGA;

[0060] GFP-R:GCCGTCGTCCTTGAAGAAGA.

[0061] After verification, a positive single colony was obtained, namely Agrobacterium rhizogenes ATCC15834-PK7WG2D.1.

[0062] 2. Preparation of Agrobacterium rhizogenes ATCC15834-PK7WG2D.1

[0063] (1) A single colony of Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 was selected and inoculated into 2 mL of TY liquid culture medium containing 100 mg / L Spe, and cultured overnight (12 to 16 h) on a constant temperature shaker at 28°C and 200 rpm.

[0064] (2) On the next day, 200 μL of bacterial solution was transferred to 200 mL of TY liquid medium containing 100 mg / L Spe, and cultured on a 28°C constant temperature shaker at 200 rpm until OD600 = 0.8-1.0.

[0065] (3) Transfer the bacterial solution from the conical flask to a 50 mL centrifuge tube, centrifuge at 5000 r / min for 10 min, remove the supernatant, place the collected Agrobacterium rhizogenes ATCC15834 cells in MMA resuspension solution, resuspend and culture at room temperature for 2 to 4 h, then centrifuge at 5000 r / min for 10 min to collect Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 cells for infection of the receptor material.

[0066] Example 2

[0067] A method for quickly obtaining transgenic raspberry plants

[0068] Combination Figure 2 As shown, the method for rapidly obtaining transgenic raspberry plants comprises the following steps:

[0069] 1. Preparation of receptor material: Use 3 to 6 mature leaves from the top of the raspberry seedling as explants, sterilize the explants in 1‰ potassium permanganate dilution for 10 to 15 minutes, and cut new wounds at the petiole to provide receptor material for genetic transformation.

[0070] Since the leaves of raspberry seedlings are used as the transformation receptor material, healthy and disease-free leaves are strictly selected when taking materials. Leaves that are too young or old will gradually turn yellow or die during the subsequent growth process after being infected by Agrobacterium.

[0071] 2. Infection: The receptor material prepared in step 1 is directly dipped into the Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 cells prepared in Example 1 for infection. The infection time is 3 to 5 seconds.

[0072] 3. Co-cultivation: Insert the infected receptor material into the prepared soil matrix and grow for 7 days at 24±2℃, 80-90% humidity, 3000-3500 lux light intensity, and a photoperiod of 16h light and 8h dark.

[0073] For raspberry leaves, fresh wounds are an important factor affecting infection. When infected with Agrobacterium rhizogenes, the disinfected raspberry leaves must be cut with new wounds at the petiole. Furthermore, through multiple experiments, it was found that the control of water and fertilizer during the growth of infected raspberries has a great impact on the entire genetic transformation cycle. Reasonable fertilization can shorten the cycle of obtaining transgenic raspberries. Therefore, foliar fertilizer is sprayed weekly during the co-cultivation and selection culture stages. The foliar fertilizer is a 500-fold diluted solution of nitrogen, phosphorus and potassium water-soluble fertilizer, and the spraying amount is 50mL.

[0074] 5. Selective culture: Apply 200-300 mL of 100 mg / L Km solution to the recipient material after co-cultivation for 7 days, apply antibiotics once a week, and positive callus will form at the petiole after one week. The positive callus will differentiate into positive roots after two weeks of growth. Positive roots will grow positive buds after four weeks of growth. The leaves of the positive buds will unfold after one week of growth to obtain transgenic raspberry plants.

[0075] Example 3

[0076] Detection of genetically modified raspberry plants

[0077] The transgenic raspberry plants and untransformed raspberry plants obtained in Example 2 were placed under 475nm excitation light for GFP fluorescence detection, and the untransformed raspberry plants were used as negative controls; the leaves of the transgenic raspberry plants were used as materials, and the total DNA was extracted by the CTAB method and PCR detection was performed. The experiment was repeated 3 times independently, and a total of 50 raspberry leaves were transformed.

[0078] The results are as follows Figure 3-4 As shown, after GFP fluorescence detection and PCR identification, 44 of the 50 transformed raspberry leaves grew positive callus tissue, with a transformation rate of 88%. Finally, 13 transgenic plants were obtained, with a transformation efficiency of 26%. The method of the present invention can quickly obtain transgenic raspberry plants, and the operation is simple, the culture cycle is short, and plant tissue culture and aseptic operation are not required.

[0079] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A method for rapidly obtaining transgenic raspberry plants, characterized in that: The following steps are involved: (1) Preparation of receptor material: Select mature leaves with the top facing downward from the seedlings of raspberries, sterilize them, and cut fresh wounds at the petioles to serve as receptor materials; (2) Infection: Dip the receptor material into Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 bacteria for infection; (3) Co-cultivation: The infected receptor material is inserted into the soil matrix for co-cultivation; (4) Selective culture: Antibiotics are applied to the recipient material after co-culture, and antibiotics are applied once a week to obtain transgenic raspberry plants after culture.

2. The method according to claim 1, characterized in that: In the step (1), the mature leaves are sterilized in a 1‰ potassium permanganate dilution for 10 to 15 minutes.

3. The method according to claim 1, characterized in that: In the step (2), Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 carries the PK7WG2D.1 plasmid, and the PK7WG2D.1 plasmid carries the EGFP reporter gene behind the proID promoter; The infection time is 3 to 5 seconds.

4. The method according to claim 3, characterized in that: The nucleotide sequence of the EGFP reporter gene is shown in SEQ ID NO: 1; the infection time is 5 s.

5. The method according to claim 3, characterized in that: The method for preparing the bacterial cells of Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 comprises the following steps: 1) The PK7WG2D.1 plasmid was electroporated into Agrobacterium rhizogenes competent cells ATCC15834 to obtain a single colony of Agrobacterium rhizogenes ATCC15834-PK7WG2D.1; 2) Streaking and activating a single colony of Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 on TY solid medium containing antibiotics to grow a single colony; 3) Pick a single colony and inoculate it in TY liquid medium containing antibiotics for activation culture to obtain an activated bacterial solution; 4) inoculating the activated bacterial solution into TY liquid culture medium containing antibiotics to obtain a bacterial solution; 5) The bacterial liquid was centrifuged to collect the bacterial cells, and the cells were added to the MMA resuspension solution for resuspending and then statically cultured. The bacterial cells were collected by centrifugation to obtain the Agrobacterium rhizogenes ATCC15834-PK7WG2D.1 bacterial cells.

6. The method according to claim 5, characterized in that: In the antibiotic-containing TY solid culture medium and the antibiotic-containing TY liquid culture medium, the antibiotic is spectinomycin, and the content of spectinomycin is 100 mg / L.

7. The method according to claim 5, characterized in that: In the step 2), the streaking activation condition is culturing in the dark in a 28° C. incubator for 2 days; In the step 3), the activation culture conditions are 28° C., 200 rpm shaking culture for 12 to 16 hours; In the step 4), the volume ratio of the activated bacterial solution to the TY liquid culture medium containing antibiotics is 1:900-1000, and the culture conditions are 28° C. and 200 rpm shaking culture until the bacterial solution OD600 is 0.8-1.0; In the step 5), the components of the MMA resuspension solution include 10 mM magnesium chloride, 10 mM 2-morpholineethanesulfonic acid, 100 μM acetosyringone, pH=5.6; the static culture condition is 2 to 4 hours.

8. The method according to claim 1, characterized in that: In the step (3), the composition of the soil matrix is ​​matrix soil: peat soil: vermiculite mass ratio = 2:1:1; The co-cultivation conditions are a temperature of 24±2°C, a humidity of 80-90%, a light intensity of 3000-3500 lux, a photoperiod of 16 hours of light and 8 hours of darkness, and a growth period of 7 days.

9. The method according to claim 1, characterized in that: In the step (4), the antibiotic is kanamycin, the concentration is 100 mg / L, and the application amount is 200-300 mL.

10. The method according to claim 1, characterized in that: In the steps (3) and (4), during the co-cultivation and selection culture stages, foliar fertilizer is sprayed on the receptor material every week, the foliar fertilizer being a 500-fold diluted solution of nitrogen, phosphorus and potassium water-soluble fertilizer, and the spraying amount is 50 mL.

Images