SSR primer group for oat genetic diversity analysis and variety identification and application of SSR primer group

Abstract

The invention belongs to the technical field of biological detection, particularly relates to an SSR (simple sequence repeat) primer group for oat genetic diversity analysis and variety identification and application thereof, and develops 14 pairs of primers (nucleotide sequences of the primers are as shown in SEQ ID NO.1-28) which are high in polymorphism and stable in amplification and are used for the oat genetic diversity analysis; 4 pairs of primers are combined to establish DNA fingerprint codes of 48 oat varieties, and the codes have uniqueness; the four pairs of primers can accurately and efficiently identify the authenticity of the oat varieties, prevent counterfeit and shoddy varieties from entering the market, provide technical reference for reasonable utilization of excellent germplasm in the breeding process of the oat varieties, and analyze the genetic relationship among the oat varieties, so that the breeding accuracy of the oat varieties is improved. And support can be provided for protection and utilization of excellent germplasm resources of the oats.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and specifically relates to an SSR primer set for oat genetic diversity analysis and variety identification and an application thereof. Background Art

[0002] Oats (Avena sativa L.) are annual herbaceous plants of the genus Avena in the Poaceae family. Oats have a significant effect on lowering low-density lipoprotein cholesterol and a certain effect on increasing serum high-density lipoprotein cholesterol, and the lipid-lowering effect is very obvious. Oats are also widely used in other industries, such as cosmetics and pharmaceuticals. Glucan has a good moisturizing effect and is often used as an ingredient in cosmetics. Oats are also a fiber-rich food base, and there are many types of foods that can be processed. Oat food processing is mainly based on Western food, and Chinese food is less. In recent years, oats have been valued for their rich nutrition, and the breeding research of new oat varieties has made rapid progress. There is an urgent need for a method that can quickly identify new oat varieties so that the varieties can be confirmed and protected in a timely manner.

[0003] SSR (Simple Sequence Repeats), also known as microsatellite DNA, is a DNA fragment consisting of several (mostly 1-6) nucleotides repeated in series to form a size of tens to hundreds of bases. During DNA replication, base mismatches cause changes in one or several repeating units, leading to the generation of allelic variation. Since SSR is flanked by conserved base sequences, primers can be designed for PCR amplification to obtain polymorphic information of these repeating sequences for the distinction between different species. SSR markers have the characteristics of rich polymorphism, co-dominant inheritance, good stability and repeatability, and simple and easy-to-use technology, so they are widely used in the construction of fingerprint maps and the identification of variety authenticity.

[0004] So far, no reports have been found on SSR primer sets for identifying the authenticity of oat varieties and SSR primer sets for analyzing genetic diversity. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and to provide an SSR primer set and application thereof for oat genetic diversity analysis and variety authenticity identification. The 14 pairs of primers provided by the present invention can be used for variety authenticity identification and oat genetic diversity analysis. Combining 4 pairs of primers (primer YM-1+primer YM-2+primer YM-7+primer YM-14) can quickly and accurately identify oat varieties with short time consumption and low cost.

[0006] In order to achieve the above-mentioned object, the present invention provides an SSR primer set for oat genetic diversity analysis, the primer set comprising 14 pairs of primers, namely primer YM-1, primer YM-2, primer YM-3, primer YM-4, primer YM-5, primer YM-6, primer YM-7, primer YM-8, primer YM-9, primer YM-10, primer YM-11, primer YM-12, primer YM-13 and primer YM-14, and the nucleotide sequences thereof are shown in SEQ ID NO.1-28.

[0007] The 14 pairs of primers described in the present invention have the advantages of strong polymorphism, stable amplification, etc.

[0008] The present invention also provides application of the 14 pairs of primers in genetic diversity analysis of oat varieties.

[0009] The present invention provides an SSR primer set for oat variety identification, the primer set comprising 4 pairs of primers, namely primer YM-1, primer YM-2, primer YM-7 and primer YM-14, and the nucleotide sequences thereof are as follows:

[0010] Primer YM-1:

[0011] F: AGCAGTACATACACATACACGC (SEQ ID No.1),

[0012] R: GGTAAAGCCTCTCACCAACC(SEQ ID No.2);

[0013] Primer YM-2:

[0014] F:CTCATGATGACGATGACGACG (SEQ ID No. 3),

[0015] R:GGCTTCGTTCTCTTCCTTGG (SEQ ID No. 4);

[0016] Primer YM-7:

[0017] F:GCAGATGATGACTACTTTCATGC(SEQ ID No.13),

[0018] R:CCACCATGGGATTAGTAGTTCC (SEQ ID No. 14);

[0019] Primer YM-14:

[0020] F: GCAAGAGAGAGAGAGAGAGC (SEQ ID No. 27),

[0021] R: TAAATAAAGAGGTGCCCATGGG (SEQ ID No. 28).

[0022] The present invention also provides the use of the four pairs of primers in identifying oat varieties. The steps of the method for identifying oat varieties are as follows:

[0023] (1) Extract the DNA of the oat varieties to be tested, and use 4 pairs of primers (primer YM-1, primer YM-2, primer YM-7 and primer YM-14) to perform PCR amplification on the DNA of the oat varieties to be tested; the PCR reaction system is 50μL, including 1μL genomic DNA, 2μL of upstream and downstream primers, 25μL 10×Es Taq MasterMix, and 20μL ddH2O. The PCR reaction program is: 94℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 30 cycles, and finally 72℃ extension for 10 min, and storage at 4℃;

[0024] (2) Based on the presence and size of the detection bands of the Labchip macromolecular analysis system, the obtained fingerprint code of the oat variety to be tested is compared with the characteristic fingerprint maps of 48 known oat varieties to determine the oat variety to be tested.

[0025] Compared with the prior art, the present invention develops 14 pairs of primers with strong polymorphism and stable amplification for oat genetic diversity analysis, and develops 4 pairs of primers for authenticity identification of oat varieties. The present invention combines the 4 pairs of primers to establish DNA fingerprint codes of 48 oat varieties, and the codes are unique; the 4 pairs of primers of the present invention can be used to identify the authenticity of oat varieties, with high accuracy, short time, high efficiency and low cost, and can effectively prevent counterfeit and inferior varieties from entering the market, and also provides a technical reference for the rational use of excellent germplasm in the process of oat variety breeding, and at the same time, by analyzing the genetic relationship between various oat varieties, it can provide support for the protection and utilization of excellent oat germplasm resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a cluster diagram of 48 oat germplasm resources involved in the present invention.

[0027] Figure 2 The results are shown in Table 1. These are the results of amplifying 48 oat samples using the polymorphic primer YM-1 of the present invention.

[0028] Figure 3 This is the LabChip macromolecule electrophoresis detection peak diagram obtained by amplifying Linna material using primer YM-1.

[0029] Figure 4 This is the LabChip macromolecule electrophoresis detection peak diagram obtained by Meida Materials using primer YM-1 for amplification.

[0030] Figure 5 The peak diagram of LabChip macromolecule electrophoresis detection obtained by amplifying the model material with primer YM-1.

[0031] Figure 6 This is the peak diagram of the LabChip macromolecule electrophoresis detection obtained by amplifying the Aiwo material using primer YM-1. DETAILED DESCRIPTION

[0032] The present invention will be further described in detail below through specific embodiments in conjunction with the accompanying drawings.

[0033] Example 1: Primer set for oat genetic diversity analysis

[0034] 1. Test materials

[0035] The 48 oat varieties selected in the present invention are all taken from the oat germplasm resource garden of Mengcao Ecological Environment (Group) Co., Ltd. in Hohhot, Inner Mongolia Autonomous Region. The basic information of the varieties is shown in Table 1.

[0036] Table 1 Information on oat germplasm resources

[0037]

[0038]

[0039] 2. Genomic DNA Extraction

[0040] For each of the 48 oat varieties, 24 plants were randomly selected for leaf DNA extraction, and the DNA of the 24 plants was mixed as the DNA sample of this variety. Specifically, 100 mg of leaf sample was weighed, and genomic DNA was extracted using the DNA extraction kit (NuClean Plant Genomic DNA Kit) of Kangwei Century Company. The quality and concentration of DNA were measured by 1% agarose gel electrophoresis and nucleic acid protein analyzer. The qualified DNA sample was diluted to 30 ng·µL -1 ; Mix equal amounts of leaf DNA from 24 strains and dilute to 30 ng·µL -1 , as a DNA sample of this breed.

[0041] 3. SSR primer design and screening

[0042] (1) Primer design

[0043] Based on the published genome sequence information of hexaploid oat "OT3098" (Index of / pub / plants / release-57 / gff3 / avena_sativa_ot3098 (ebi.ac.uk)), the microsatellite search software krait was used to search for whole genome microsatellite sequences. The microsatellite search parameters were set as follows: 10 mononucleotide repeats; a minimum of 6 and 5 dinucleotide and trinucleotide repeats, respectively; a minimum of 5 tetranucleotide and pentanucleotide repeats; and a minimum of 5 hexanucleotide repeats. A total of 765,514 microsatellite sequences were detected from the oat genome.

[0044] According to the results of SSR loci analysis of oat genome, SSR loci located on different chromosomes and different nucleotide types were randomly selected, and SSR primers were designed in batches using Primer Premier 3.0 built into krait software. The primer design parameters were set as follows: primer length 18-27 bp, amplification product length 150-300 bp, GC content between 40% and 60%, and annealing temperature (Tm value) between 55 and 63 °C. 40 pairs of primers were randomly selected and synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0045] (2) Primer screening

[0046] According to the 40 synthesized primer pairs, 6 oat DNA samples (genomic DNA of oat varieties numbered 1-6) were randomly selected for PCR amplification. The sample number was set to 24, and the PCR reaction system was 50 µL, including 1 µL of genomic DNA, 2 µL of upstream and downstream primers, 25 µL of 10×Es Taq MasterMix, and 20 µL of ddH2O. The PCR reaction program was as follows: 94°C pre-denaturation for 3 min, 95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 1 min, 30 cycles, and finally 72°C extension for 10 min, and then stored at 4°C. The PCR products were subjected to electrophoresis using a biomacromolecule analyzer (Lab-Chip GX) to detect the presence and size of the bands. Primer sequences with allele numbers > 2, fragment sizes between different alleles > 2 bp, clear electrophoresis bands, good reproducibility, and high polymorphism were screened. A total of 14 pairs of primers were screened, and the primer sequences are shown in Table 2. A total of 116 allele sites were detected by the 14 pairs of primers, and an average of 8.28 allele sites per primer pair were detected. The primers with the most sites were YM-6 and YM-8, with 13 sites, and the primers with the least were YM-10 and YM-13, with 3 polymorphic sites. The PIC index was between 0.405 and 0.877.

[0047] Table 2 Information of 14 pairs of SSR primers

[0048]

[0049]

[0050] (3) Analysis of oat genetic diversity based on SSR technology

[0051] PCR amplification was performed on 48 oat varieties using the 14 pairs of primers in Table 2. The PCR reaction system and PCR reaction procedure were the same as above. Based on the genetic distance between the 48 materials, cluster analysis was performed using the UPG-MA (unweighted average method) in the DPS7.05 software. The effective allele number, Nei's gene diversity index and Shannon information index were calculated using the popgene32 software. The primer PIC index was calculated using the PIC software. The results are shown in Table 3.

[0052] The calculation results of the polymorphic band ratio (Table 3) showed that the average polymorphic band ratio of 48 samples amplified by 14 pairs of primers was 95.67%. According to the calculation results of Nei's gene diversity index and Shannon information index, the total genetic diversity of oats was 0.2234 and 0.3824, respectively. The Nei's gene diversity index (H) of 48 samples amplified by 14 pairs of primers of oats ranged from 0.1347 to 0.3878, with an average of 0.2237; the Shannon information index (I) ranged from 0.1679 to 0.6400, with an average of 0.3672, and the effective number of alleles (Ne) ranged from 1.0834 to 1.8807. Among the 14 primer pairs, the Ne (1.8807), H (0.4559) and I (0.6400) of primer YM10 were at higher levels. In summary, the genetic diversity of the 48 oat varieties was at a medium level, and the primer polymorphism was good.

[0053] Table 3 Analysis of genetic diversity parameters of 48 oat materials

[0054]

[0055] (4) Cluster analysis

[0056] UPGMA cluster analysis based on 48 oat varieties ( Figure 1 ), showing the relationship between 48 oat varieties, and the 48 oat varieties showed high genetic diversity.

[0057] Example 2: Primer set for oat variety identification

[0058] 1. Primer combination

[0059] The present invention provides a combination of 4 pairs of SSR primers (primer YM-1+primer YM-2+primer YM-7+primer YM-14) for distinguishing oat varieties by combining the 14 pairs of primers in Example 1. The nucleotide sequences of the forward primers and the reverse primers of the 4 pairs of oat SSR primers are shown in Table 4. The number of polymorphic sites of primer YM-1 is 7, the number of polymorphic sites of primer YM-2 is 5, the number of polymorphic sites of primer YM-7 is 7, and the number of polymorphic sites of primer YM-14 is 9.

[0060] Table 4 SSR primer combinations for identification of oat varieties

[0061]

[0062] 2. Construction of oat fingerprint

[0063] PCR detection was performed on 48 oat varieties (Table 1) using the four pairs of primers in Table 4. The PCR reaction system and PCR reaction procedure were the same as in Example 1. The electrophoresis results of the biomacromolecule analyzer (Lab-Chip GX) were interpreted. Each pair of primers could produce clear bands for the oat test samples, such as Figure 2 This is the electrophoresis result of primer YM-1. Different test samples show polymorphism and can be used to distinguish varieties. According to statistics, all varieties can be distinguished by these four pairs of primers (primer YM-1 + primer YM-2 + primer YM-7 + primer YM-14). The present invention constructs its variety fingerprint map, detects the presence and size of the band according to the Labchip macromolecular analysis system, and uses the assignment method to assign the value of the band to "1", the value of the bandless band to "0", and the value of the missing band to "-", and finally forms a "0-1" matrix. A 0-1 matrix is ​​generated according to the site and the size of the band, thereby obtaining the DNA fingerprint codes of 48 oat varieties represented by 0-1. Each oat variety has a fingerprint code containing 4 site information, which is unique, and each fingerprint code can be used as an identifier of a variety. Figure 3-Figure 6The peak diagram of LabChip macromolecular electrophoresis detection obtained by amplifying four oats, Linna, Meida, Kaimo and Aiwo, with primer YM-1. Table 5 shows the DNA fingerprint information of 10 oat varieties at four amplification sites. Taking the YM-1 primer as an example, its DNA fingerprint information consists of seven digits, indicating that the number of alleles amplified by YM-1 on 48 oats is 7, and the fragment sizes are 131, 134, 138, 150, 160, 163, and 166 respectively. The fingerprint information of Bayou / YM-1 is 1100001, indicating that the primer can amplify fragments with band sizes of 131, 134 and 166 in Bayou varieties; the allele amplified by YM-2 is 5, and the fragment sizes are 119, 121, 123, 125, and 154 respectively; the allele amplified by YM-7 is 7, and the fragment sizes are 170, 172, 174, 176, 178, 180, and 184 respectively; the allele amplified by YM-14 is 9, and the fragment sizes are 98, 105, 114, 122, 127, 134, 138, 145, and 158 respectively; the fingerprint information of Bayou / YM-2 is 01001, indicating that the primer can amplify fragments with band sizes of 121 and 154 in Bayou varieties; The fingerprint information of YM-7 is 0100000, indicating that the primer can amplify a fragment with a band size of 172 in the Bayou variety; the fingerprint information of Bayou / YM-14 is 111010100, indicating that the primer can amplify fragments with band sizes of 98, 105, 114, 122, and 134 in the Bayou variety; the fingerprint information of Meida / YM-1 is 0000001, indicating that the primer can amplify a fragment with a band size of 166 in the Bayou variety; the fingerprint information of Meida / YM-2 is 10011, indicating that the primer can amplify fragments with band sizes of 119, 125, and 154 in the Bayou variety; and the same applies to other fingerprint information.

[0064] According to this method, a “0-1” array DNA fingerprint library of 48 oat varieties at four amplification sites was finally constructed, as shown in Table 6 for details.

[0065] Table 5 DNA fingerprint information of 10 oat varieties at four amplification sites

[0066]

[0067] Table 6 Fingerprint codes of 48 oat varieties

[0068]

[0069]

[0070]

[0071] As can be seen from Table 6, the fingerprint codes of the 48 oat varieties are different and unique, indicating that the 48 oat varieties can be distinguished using 4 pairs of primers.

[0072] Example 3: Method for identifying oat varieties

[0073] 1. Extract the DNA of the oat variety to be tested, and use the four pairs of primers constructed in Example 2 to construct the fingerprint code to perform PCR amplification on the DNA of the oat variety to be tested; the PCR reaction system is 50 μL, including 1 μL of genomic DNA, 2 μL of upstream and downstream primers, 25 μL of 10×Es Taq MasterMix, and 20 μL of ddH2O. The PCR reaction program is: 94℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 30 cycles, and finally 72℃ extension for 10 min, and storage at 4℃.

[0074] 2. According to the presence and size of the detection strips of the Labchip macromolecular analysis system, the obtained fingerprint code of the oat variety to be tested is compared with the characteristic fingerprint maps of the above 48 oat varieties to determine the oat variety to be tested.

Claims

1. An SSR primer set for oat genetic diversity analysis, characterized in that: The primer set includes 14 pairs of primers, namely primer YM-1, primer YM-2, primer YM-3, primer YM-4, primer YM-5, primer YM-6, primer YM-7, primer YM-8, primer YM-9, primer YM-10, primer YM-11, primer YM-12, primer YM-13 and primer YM-14, and their nucleotide sequences are shown in SEQ ID NO.1-28.

2. An SSR primer set for oat variety identification, characterized in that: The primer set includes 4 pairs of primers, namely primer YM-1, primer YM-2, primer YM-7 and primer YM-14, and their nucleotide sequences are as follows: Primer YM-1: F: AGCAGTACATACACATACACGC, R: GGTAAAGCCTCTCACCAACC; Primer YM-2: F:CTCATGATGACGATGACGACG, R:GGCTTCGTTCTCTTCTCTGG; Primer YM-7: F:GCAGATGATGACTACTTTCATGC, R:CCACCATGGGATTAGTAGTTCC; Primer YM-14: F:GCAAGAGAGAGAGAGAGAGAGAGC, R:TAAATAAAGAGGTGCCCATGGG.

3. Use of the four pairs of primers according to claim 2 in identifying oat varieties.

4. The use of the four pairs of primers in identifying oat varieties according to claim 3, characterized in that: The steps of the method for identifying oat varieties are as follows: (1) Extracting DNA of the oat variety to be tested, and using primers YM-1, YM-2, YM-7, and YM-14 to perform PCR amplification on the DNA of the oat variety to be tested, respectively; (2) Based on the presence and size of the detection bands detected by the Labchip macromolecular analysis system, the obtained fingerprint code of the oat variety to be tested is compared with the characteristic fingerprint maps of known oat varieties to determine the oat variety to be tested.

5. The use of the four pairs of primers according to claim 4 in identifying oat varieties, characterized in that: The PCR reaction system was 50 µL, including 1 µL of genomic DNA, 2 µL of upstream and downstream primers, 25 µL of 10×Es Taq MasterMix, and 20 µL of ddH2O. The PCR reaction program was as follows: pre-denaturation at 94°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 30 cycles, and finally extension at 72°C for 10 min, and storage at 4°C.

Images