Use of dendritic cells in the prevention and / or treatment of demyelinating diseases

Abstract

The present invention belongs to the field of biomedical technology, and particularly relates to the use of dendritic cells in the prevention and / or treatment of demyelinating diseases. The expression level of Talin1 protein in the dendritic cells is reduced or not expressed. Loading the dendritic cells with myelin peptides can safely and effectively alleviate immune inflammation and nerve damage, and thus is expected to develop into a new therapy for the prevention and / or treatment of demyelinating diseases.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and particularly relates to the application of dendritic cells in the prevention and / or treatment of demyelinating diseases. Background Art

[0002] Demyelinating diseases are a group of diseases characterized by the loss of myelin sheaths of nerve fibers, with relatively less involvement of neuron cell bodies and axons, including two major categories: hereditary and acquired. Among them, acquired demyelinating diseases are further divided into central and peripheral types. The most representative peripheral demyelinating diseases are acute and chronic inflammatory demyelinating polyneuropathy, while central nervous system demyelinating diseases include multiple sclerosis (MS), acute disseminated encephalomyelitis (ADEM), and neuromyelitis optica spectrum disorder (NMOSD), etc. Among them, MS is the most common central nervous system demyelinating disease, which can cause visual impairment and motor disorders, seriously affecting the quality of life. Clinically, drugs such as teriflunomide, dimethyl fumarate, β-interferon, and hormones are mostly used to relieve the progression and recurrence of the disease, but there are disadvantages such as drug tolerance and large toxic and side effects, especially the obvious increase in the risk of malignant tumors and opportunistic infections due to extensive immunosuppression.

[0003] Dendritic cells (DC) are the most powerful antigen-presenting cells in the body and the only antigen-presenting cells that can activate naive T cells. They participate in antigen recognition, processing, and presentation, and are the initiators of the body's immune response, playing a key role in the induction of immune responses. According to the degree of maturity, they can be divided into immature DC and mature DC. Under normal circumstances, the vast majority of DCs in the body are in an immature state, with strong antigen capture and processing capabilities, but lack the ability to activate T cells. After DCs receive antigen stimulation, they gradually mature and migrate to secondary lymphoid organs. The mature DCs in secondary lymphoid organs lose the ability to process antigens but acquire the ability to activate naive T cells, and can activate T cells to induce an immune response. Therefore, immature DCs can induce immune tolerance, while mature DCs can induce immune activation (see non-patent literature: The role and clinical significance of dendritic cells in immune responses, Chinese Journal of Maternal and Child Clinical Medicine (Electronic Edition), Vol. 5, No. 2, April 2009). Summary of the Invention

[0004] To fill the gap in the existing technology, the present invention can be used for the prevention and / or treatment of demyelinating diseases, especially central demyelinating diseases, by downregulating talin 1 (Talin1) in dendritic cells. The specific solution is as follows:

[0005] In the first aspect of the present invention, there is provided an application of dendritic cells in the preparation of a drug for preventing and / or treating demyelinating diseases, wherein the expression level of Talin1 protein in the dendritic cells is reduced or not expressed.

[0006] The dendritic cells include dendritic cells in the skin, airway, spleen, blood, lymph or bone marrow. Preferably, they are dendritic cells in the lymph or bone marrow.

[0007] In a specific embodiment of the present invention, the dendritic cells are dendritic cells in the bone marrow.

[0008] The Talin1 gene is knocked out or knocked down in the dendritic cells.

[0009] Preferably, the method for knocking out includes CRISPR / Cas9, Cre / LoxP system, Gin / Gix system, FLP / FRT system or R / RS system.

[0010] Preferably, the method for knocking down includes RNA interference.

[0011] The shRNA sequence targeting the Talin1 gene in the RNA interference includes CCAAATGGCCCAGTACTTTTT (SEQ ID NO: 2).

[0012] The vectors used in the RNA interference include viral vectors or non-viral vectors. Preferably, they are viral vectors. Further preferably, the viral vectors include lentiviral vectors, adenoviral vectors, AAV viral vectors or piggyBac vectors, etc.

[0013] In a specific embodiment of the present invention, the vector is a lentiviral vector.

[0014] The dendritic cells are loaded with myelin peptides.

[0015] The myelin peptides include myelin basic protein peptide (MBP), myelin oligodendrocyte glycoprotein peptide (MOG), proteolipid protein peptide (PLP) or myelin-associated glycoprotein peptide (MAG).

[0016] Preferably, the myelin peptide is MOG peptide. Further preferably, the MOG peptide is the MOG35-55 peptide segment (as shown in SEQ ID NO: 5).

[0017] The demyelinating diseases include hereditary demyelinating diseases or acquired demyelinating diseases.

[0018] Preferably, the acquired demyelinating diseases include central demyelinating diseases.

[0019] More preferably, the acquired demyelinating disease is a central demyelinating disease.

[0020] More preferably, the central demyelinating disease is multiple sclerosis (MS), acute disseminated encephalomyelitis or neuromyelitis optica spectrum disorder.

[0021] The prevention and / or treatment includes administering the drug to a subject.

[0022] The administration methods include, but are not limited to, intradermal injection, subcutaneous injection, intramuscular injection or intravenous injection.

[0023] In a specific embodiment of the present invention, the administration method is intravenous injection.

[0024] In a second aspect of the present invention, there is provided a dendritic cell in which the expression level of Talin1 protein is reduced or not expressed, and the dendritic cell is loaded with myelin peptides.

[0025] Preferably, the myelin peptides include myelin basic protein peptide (MBP), myelin oligodendrocyte glycoprotein peptide (MOG), proteolipid protein peptide (PLP) or myelin-associated glycoprotein peptide (MAG).

[0026] More preferably, the myelin peptide is MOG.

[0027] More preferably, the myelin peptide is the MOG35-55 peptide segment (as shown in SEQ ID NO: 5).

[0028] The dendritic cells include dendritic cells in the skin, airway, spleen, blood, lymph or bone marrow.

[0029] The Talin1 gene is knocked out or knocked down in the dendritic cell;

[0030] Preferably, the method for knocking out includes CRISPR / Cas9, Cre / LoxP system, Gin / Gix system, FLP / FRT system or R / RS system;

[0031] Preferably, the method for knocking down includes RNA interference.

[0032] In a third aspect of the present invention, there is provided a method for preparing a dendritic cell as described in the second aspect, the preparation method comprising: knocking out or knocking down the Talin1 gene in the dendritic cell loaded with myelin peptides.

[0033] Preferably, the method for knocking out includes CRISPR / Cas9, Cre / LoxP system, Gin / Gix system, FLP / FRT system or R / RS system.

[0034] Preferably, the method for knockdown includes RNA interference.

[0035] The shRNA sequence targeting the Talin1 gene in the RNA interference includes CCAAATGGCCCAGTACTTTTT (SEQ ID NO: 2).

[0036] Preferably, the preparation method includes: adding MOG35-55 peptide segment and LPS to the dendritic cells with the Talin1 gene knocked out or knocked down, and treating for 12 - 48 h (preferably 24 h) to obtain.

[0037] In the fourth aspect of the present invention, there is provided a drug for preventing and / or treating demyelinating diseases, and the drug includes the dendritic cells described in the second aspect or the dendritic cells obtained by the preparation method described in the third aspect.

[0038] In the fifth aspect of the present invention, there is provided a method for preventing and / or treating demyelinating diseases, and the method includes administering an effective amount of the dendritic cells described in the second aspect or the dendritic cells obtained by the preparation method described in the third aspect or the drug described in the fourth aspect to a subject.

[0039] In a specific embodiment of the present invention, the subject is a human. Preferably, it is administered once every 2 weeks, and the total number of times is 3 times. Preferably, the administration method can be intravenous injection. Preferably, the total administered dose is 1×10 6 ~5×10 9 of dendritic cells, and more preferably 5×10 6 ~3×10 9 of dendritic cells.

[0040] "Treatment" as used in the present invention means slowing down, interrupting, preventing, controlling, stopping, alleviating, or reversing the progression or severity of a sign, symptom, disorder, disease condition, or disease after the disease has begun to develop, but does not necessarily involve complete elimination of all disease-related signs, symptoms, disease conditions, or disorders.

[0041] "Effective amount" as used in the present invention refers to the amount or dose of the drug of the present invention that provides the desired treatment or prevention after being administered to an individual or organ in a single or multiple doses.

[0042] "Prevention" as used in the present invention means a manner implemented to prevent or delay the occurrence of a disease or disease condition or symptom in an organism.

[0043] The "subject" described in the present invention can be a human or non-human mammal, or a cell, tissue or organ of a human or non-human mammal. The non-human mammal can be a wild animal, a zoo animal, an economic animal, a pet, a laboratory animal, etc. Preferably, the non-human mammal includes but is not limited to pigs, cows, sheep, horses, donkeys, foxes, raccoons, minks, camels, dogs, cats, rabbits, mice (such as rats, mice, guinea pigs, hamsters, gerbils, chinchillas, squirrels) or monkeys, etc.

[0044] The present invention has the following beneficial effects: By downregulating Talin1 in dendritic cells, the present application reduces the number and length of protrusions on the surface of dendritic cells, significantly reduces the phagocytic vesicles and organelles in the cytoplasm, and reduces the secretion of pro-inflammatory cytokines and increases the secretion of anti-inflammatory cytokines, thereby reshaping the Th1 / Th17 / Treg balance. Dendritic cells with downregulated Talin1 loaded with MOG can treat MS, especially in terms of immune homeostasis and protection against nerve damage. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Hereinafter, the embodiments of the present invention will be described in detail with reference to the accompanying drawings, wherein:

[0046] Figure 1 It shows the verification result diagram of knocking down the Talin1 gene by lentiviral vector. Figure A: Lentiviral knockdown sequences, specifically the control sequence (shN) and shTalin1 sequences (shT1 - shT3); Figure B: The results of Western Blot detection of the expression level after knocking down Talin1 in BMDCs using different shRNA sequences (among them, shT2 significantly knocked down the expression level of Talin1 protein in BMDCs and was used for subsequent research); GADPH is glyceraldehyde-3-phosphate dehydrogenase, which is used as an internal reference.

[0047] Figure 2 It shows the scanning electron microscope analysis diagrams of dendritic cells in different groups. Figure A represents the scanning electron microscope analysis diagram of dendritic cells in the shN group, Figure B represents the scanning electron microscope analysis diagram of dendritic cells in the shN+L group, Figure C represents the scanning electron microscope analysis diagram of dendritic cells in the shT group, and Figure D represents the scanning electron microscope analysis diagram of dendritic cells in the shT+L group. Among them, shN represents that bone marrow-derived dendritic cells (BMDCs) are treated with a control medium for 12 h and transfected with a control lentiviral vector for 48 h, shN+L represents that BMDCs are treated with lipopolysaccharide (LPS, 1 μg / ml) for 12 h and transfected with a control lentiviral vector for 48 h, shT represents that BMDCs are treated with a control medium for 12 h and transfected with a Talin1 knockdown lentiviral vector for 48 h, and shT+L represents that BMDCs are treated with LPS (1 μg / ml) for 12 h and transfected with a Talin1 knockdown lentiviral vector for 48 h.

[0048] Figure 3Shown are transmission electron microscope images of dendritic cells under different treatment methods. Figure A represents the transmission electron microscope image of dendritic cells in the shN group, Figure B represents the transmission electron microscope image of dendritic cells in the shN+L group, Figure C represents the transmission electron microscope image of dendritic cells in the shT group, and Figure D represents the transmission electron microscope image of dendritic cells in the shT+L group. Among them, the red thin arrow indicates the phagocytic vesicle, the red thick arrow indicates the Golgi apparatus, the blue thin arrow indicates the mitochondrion, and the blue thick arrow indicates the endoplasmic reticulum. shN represents that BMDCs are treated with control medium for 12 h and transfected with a control lentiviral vector for 48 h. shN+L represents that BMDCs are treated with LPS (1 μg / ml) for 12 h and transfected with a control lentiviral vector for 48 h. shT represents that BMDCs are treated with control medium for 12 h and transfected with a Talin1 knockdown lentiviral vector for 48 h. shT+L represents that BMDCs are treated with LPS (1 μg / ml) for 12 h and transfected with a Talin1 knockdown lentiviral vector for 48 h;

[0049] Figure 4 Shown are the results of flow cytometry analysis of the expression of surface molecules CD80, CD86, and MHCII on dendritic cells after Talin1 knockdown. Isotype represents the isotype control group. shN represents that BMDCs are treated with control medium for 12 h and transfected with a control lentiviral vector for 48 h. shN+L represents that BMDCs are treated with LPS (1 μg / ml) for 12 h and transfected with a control lentiviral vector for 48 h. shT represents that BMDCs are treated with control medium for 12 h and transfected with a Talin1 knockdown lentiviral vector for 48 h. shT+L represents that BMDCs are treated with LPS (1 μg / ml) for 12 h and transfected with a Talin1 knockdown lentiviral vector for 48 h. The data are expressed as mean ± standard deviation. ns represents no significant difference, * represents p < 0.05, ** represents p < 0.01, and **** represents p < 0.0001;

[0050] Figure 5The bar chart shows the levels of IL-1β, IL-6, TNF-α, and IL-10 in the supernatant of Talin1-knockdown BMDCs. Figure A represents the bar chart of the level of IL-1β in the supernatant of BMDCs in the shN group, shN+L group, shT group, and shT+L group. Figure B represents the bar chart of the level of IL-6 in the supernatant of BMDCs in the shN group, shN+L group, shT group, and shT+L group. Figure C represents the bar chart of the level of TNF-α in the supernatant of BMDCs in the shN group, shN+L group, shT group, and shT+L group. Figure D represents the bar chart of the level of IL-10 in the supernatant of BMDCs in the shN group, shN+L group, shT group, and shT+L group. shN represents that BMDCs were treated with control medium for 12 h and transfected with a control lentiviral vector for 48 h. shN+L represents that BMDCs were treated with LPS (1 μg / ml) for 12 h and transfected with a control lentiviral vector for 48 h. shT represents that BMDCs were treated with control medium for 12 h and transfected with a Talin1-knockdown lentiviral vector for 48 h. shT+L represents that BMDCs were treated with LPS (1 μg / ml) for 12 h and transfected with a Talin1-knockdown lentiviral vector for 48 h. Data are expressed as mean ± standard deviation. ns represents no significant difference. * represents p < 0.05, ** represents p < 0.01, *** represents p < 0.001, **** represents p < 0.0001;

[0051] Figure 6 Shown is the effect of Talin1 knockdown on the ability of BMDCs to stimulate CD4 + T cell proliferation. BMDCs intervened in different groups (3 - 6 replicates / group) were further co-cultured with CD4 + T cells derived from the spleen of BALB / c mice at a ratio of 1:5 for 72 h. Flow cytometry analysis of CD4 + T cell proliferation was performed by CFSE staining. Among them, NC represents the negative control group. shN represents that BMDCs were treated with control medium for 12 h and transfected with a control lentiviral vector for 48 h. shN+L represents that BMDCs were treated with LPS (1 μg / ml) for 12 h and transfected with a control lentiviral vector for 48 h. shT represents that BMDCs were treated with control medium for 12 h and transfected with a Talin1-knockdown lentiviral vector for 48 h. shT+L represents that BMDCs were treated with LPS (1 μg / ml) for 12 h and transfected with a Talin1-knockdown lentiviral vector for 48 h. Data are expressed as mean ± standard deviation. ns represents no significant difference. **** represents p < 0.0001;

[0052] Figures 7A - 7F Shown is the effect of Talin1 knockdown on the ability of BMDCs to stimulate CD4 +To investigate the effect on T differentiation ability, BMDCs intervened in different groups (3 - 6 replicates / group) were further co - cultured with CD4 + T cells from the spleen of BALB / c mice at a ratio of 1:5 for 72 h. Among them, as shown in A - F, flow cytometry was used to analyze the ability of CD4 + T cells to differentiate into Th1 (CD4 + IFN - γ + ), Th2 (CD4 + IL - 4 + ), and Th17 (CD4 + IL - 17 + ). Among them, Figures 7A - 7B : Flow cytometry analysis of the situation of CD4 + T cells differentiating into Th1 (CD4 + IFN - γ + ), Figures 7C - 7D : Flow cytometry analysis of the situation of CD4 + T cells differentiating into Th2 (CD4 + IL - 4 + ), Figures 7E - 7F : Flow cytometry analysis of the situation of CD4 + T cells differentiating into Th17 (CD4 + IL - 17 + ). shN represents that BMDCs were treated with control medium for 12 h and transfected with control lentiviral vector for 48 h. shN + L represents that BMDCs were treated with LPS (1 μg / ml) for 12 h and transfected with control lentiviral vector for 48 h. shT represents that BMDCs were treated with control medium for 12 h and transfected with Talin1 - knockdown lentiviral vector for 48 h. shT + L represents that BMDCs were treated with LPS (1 μg / ml) for 12 h and transfected with Talin1 - knockdown lentiviral vector for 48 h. Data are expressed as mean ± standard deviation. ns represents no significant difference. * represents p < 0.05, ** represents p < 0.01;

[0053] Figure 8Shown is the detection of IFN-γ, IL-4 and IL-17 levels in co-culture supernatants by flow cytometry combined with cytometric bead array (CBA). Among them, Figure A: is IFN-γ, Figure B: is IL-4, Figure C: is IL-17. shN represents BMDCs treated with control medium for 12 h and transfected with control lentiviral vector for 48 h. shN+L represents BMDCs treated with LPS (1 μg / ml) for 12 h and transfected with control lentiviral vector for 48 h. shT represents BMDCs treated with control medium for 12 h and transfected with Talin1 knockdown lentiviral vector for 48 h. shT+L represents BMDCs treated with LPS (1 μg / ml) for 12 h and transfected with Talin1 knockdown lentiviral vector for 48 h. Data are expressed as mean ± standard deviation. ns represents no significant difference, * represents p < 0.05, ** represents p < 0.01, *** represents p < 0.001, **** represents p < 0.0001;

[0054] Figure 9 Shown is that Talin1 knockdown dendritic cells slow down the disease progression and nerve defects in EAE model mice. C57BL / 6 mice were induced to become EAE model mice. The EAE model mice were randomly grouped. EAE represents EAE model mice injected with normal saline via the tail vein (n = 10). EAE+shN represents EAE model mice injected with dendritic cells transfected with control lentiviral vector via the tail vein (n = 10). EAE+shT represents EAE model mice injected with dendritic cells with Talin1 knockdown via the tail vein (n = 10). BMDCs used to intervene in the EAE mouse model were loaded with MOG 35-55 peptide (20 μg / ml) and treated with LPS (1 μg / ml) for 24 h. Among them, Figure A: Flow chart of BMDCs intervening in EAE model mice. Figure B: Curve of body weight change of each group of mice over time. Figure C: Curve of nerve defect score change over time. Figure D: Kaplan-Meier survival curve comparing the onset time of each group. Data are expressed as mean ± standard deviation. ※ represents P < 0.05 compared with the EAE group, and # represents P < 0.05 compared with the EAE+shN group;

[0055] Figure 10Shown is that Talin1 slows down the disease progression and nerve defects in EAE model mice. C57BL / 6 mice were induced to become EAE model mice. The EAE model mice were randomly grouped. EAE represents EAE model mice injected with normal saline via the tail vein (n = 10). EAE+shN represents EAE model mice transfected with dendritic cells transfected with a control lentiviral vector via the tail vein (n = 10). EAE+shT represents EAE model mice transfected with dendritic cells with Talin1 knockdown via the tail vein (n = 10). BMDCs used to intervene in the EAE mouse model were loaded with MOG 35-55 peptide (20 μg / ml) and treated with LPS (1 μg / ml) for 24 h. Among them, Figure A: Comparison of the disease onset time of EAE model mice in different groups. Figure B: Comparison of the maximum nerve defect scores in different groups. Figure C: Comparison of the cumulative nerve defect scores in different groups. Data are expressed as mean ± standard deviation. ns represents no significant difference. * represents p < 0.05. **** represents p < 0.0001;

[0056] Figure 11 Shown is the effect of Talin1-knockdown BMDCs on the pathological severity of EAE mice. After 20 days of immunization, the mice were sacrificed, and the lumbar enlargement tissues of their spinal cords were collected for pathological analysis. Figures A - C: HE staining analysis of the white matter inflammatory infiltration score of spinal cord tissues (n = 6, scale bar in Figure A = 500 μm, scale bar in Figure B = 50 μm). Figures D - F: LFB staining analysis of the demyelination score of spinal cord tissues (n = 5 - 6, scale bar in Figure D = 500 μm, scale bar in Figure E = 50 μm). EAE represents EAE model mice injected with normal saline via the tail vein. EAE+shN represents EAE model mice transfected with dendritic cells transfected with a control lentiviral vector via the tail vein. EAE+shT represents EAE model mice transfected with dendritic cells with Talin1 knockdown via the tail vein. Data are expressed as mean ± standard deviation. ns represents no significant difference. **** represents p < 0.0001;

[0057] Figures 12A - 12H Shown is that Talin1-knockdown dendritic cells regulate the responses of Th1\Th17\Treg in the spleens of EAE model mice. Specifically, flow cytometry was used to analyze the proportions of Th1 (CD4 + IFN-γ + ), Th2 (CD4 + IL-4 + ), and Th17 (CD4 + IL-17 + ) cells in the spleen. Each group of mice (5 mice / group) was sacrificed 20 days after immunization, and their spleen cells were collected. The CD4 of spleen cells of EAE model mice was analyzed under the condition of restimulation with MOG 35-55 peptide+ T cell reactivity, wherein, Figures 12A - 12B : CD4 + T cells differentiate into Th1 (CD4 + IFN-γ + ) cell proportion, Figures 12C - 12D : CD4 + T cells differentiate into Th2 (CD4 + IL-4 + ) cell proportion, Figures 12E - 12F : CD4 + T cells differentiate into Th17 (CD4 + IL-17 + ) cell proportion, Figures 12G - 12H : CD4 + T cells differentiate into Treg (CD4 + CD25 + FoxP3 + ) cell proportion, EAE represents EAE model mice injected with normal saline via the tail vein, EAE+shN represents EAE model mice transfected with dendritic cells transfected with a control lentiviral vector via the tail vein, EAE+shT represents EAE model mice transfected with dendritic cells with Talin1 knockdown via the tail vein, the data are expressed as mean ± standard deviation, ns represents no significant difference, * represents p<0.05, ** represents p<0.01, **** represents p<0.0001;

[0058] Figure 13 Shown is the regulation of the infiltration of inflammatory cells Th1\Th17\Treg in the spinal cord tissue of EAE model mice by Talin1 knockdown dendritic cells. Each group of EAE model mice was sacrificed 20 days after immunization (5 mice / group), and the spinal cord lumbar enlargement tissue was collected for further analysis. Figures A - C: Immunohistochemical staining analysis of Th1 (IFN-γ + ), Th17 (IL-17 + ) and Treg (IL-10+) cells in the spinal cord tissue. Among them, Figure A: Infiltration map of Th1 (IFN-γ + ) cells, Figure B: Infiltration map of Th17 (IL-17 + ) cells, Figure C: Infiltration map of Treg (IL-10 +Cell infiltration diagram. EAE represents EAE model mice injected with normal saline via the tail vein. EAE+shN represents EAE model mice injected with dendritic cells transfected with a control lentiviral vector via the tail vein. EAE+shT represents EAE model mice injected with dendritic cells with Talin1 knockdown via the tail vein. Data are expressed as mean ± standard deviation. ns represents no significant difference, * represents p < 0.05, ** represents p < 0.01, *** represents p < 0.001, **** represents p < 0.0001. Detailed implementation manners

[0059] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of them. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0060] It should be noted that the methods used in the present invention are all conventional methods unless otherwise specified, and the reagents used in the present invention are all commercially available products unless otherwise specified.

[0061] Example 1 Preparation of tolerogenic dendritic cells

[0062] 1. Differentiation culture and activation of bone marrow-derived dendritic cells (BMDCs)

[0063] First, bone marrow mononuclear cells (BMMCs) were prepared by lysing and removing red blood cells from the cell suspension of the tibia and femur of donor C57BL / 6 mice. Secondly, BMMCs were cultured in RPMI 1640 medium at a density of 2×10 6 cells / ml. The medium was supplemented with 10% fetal bovine serum (FBS, Gibco, Invitrogen, Carlsbad, CA, USA), 2 mM glutamine (Sigma, St. Louis, MO, USA), 100 IU / mL penicillin-streptomycin (Sigma), 10 ng / mL recombinant murine granulocyte-macrophage colony-stimulating factor (rmGM-CSF; PeproTech, Rocky Hill, NJ, USA), and 10 ng / mL rmIL-4 (PeproTech), and cultured for 7 days at 37°C and 5% CO2. Among them, on the 2nd, 4th, and 6th days of culture, half of the volume of fresh medium containing GM-CSF and IL-4 was supplemented. On the 8th day, negative selection was performed using a CD11c cell isolation kit to obtain BMDCs. When necessary, 1 μg / mL lipopolysaccharide (LPS, Sigma) was added to the medium to activate or mature BMDCs.

[0064] Knockdown of Talin1 (shTalin1) lentiviral transfection of BMDCs and verification of transfection efficiency

[0065] Three shTalin1 lentiviruses with different sequences (shT1, shT2, and shT3) were constructed, with the shN sequence as a control, to compare the knockdown effects and screen the one with the best knockdown effect (shT2) for subsequent experiments. During the lentiviral transfection process, BMDCs (8×10 4 cells / well) were seeded into 6-well plates together with the lentiviral vector (multiplicity of infection was 10), and then incubated at 37 °C for 6 - 8 hours. The lentivirus was removed and fresh medium was added to the cells. Then the transfected cells were cultured for another 48 hours for further detection. The relevant shRNA sequence information and the results of verifying Talin1 gene knockdown by Western blotting are shown in Figure 1 .

[0066] The shT1 sequence is GCTCATTGCTGGCTACATATT (SEQ ID NO:1);

[0067] The shT2 sequence is CCAAATGGCCCAGTACTTTTT (SEQ ID NO:2);

[0068] The shT3 sequence is CCGAATGACCAAGGGTATTTT (SEQ ID NO:3);

[0069] Among them, the shN sequence is TTCTCCGAACGTGTCACGTTT (SEQ ID NO:4).

[0070] The results showed that the shT2 had the best knockdown effect, so the cells knocked down by shT2 (abbreviated as shTalin1 - BMDCs) were used for subsequent verification.

[0071] 3. Identification of the morphological structure, phenotype, and function of shTalin1 - BMDCs.

[0072] 1) Electron microscopic morphology and ultrastructure of shTalin1 - BMDCs

[0073] A series of morphological and internal structural changes occur in BMDCs after activation by LPS stimulation, including an increase in the number and length of surface protrusions, a decrease in phagocytic vesicles in the cytoplasm, and a significant increase in organelles. Detection of the morphology and ultrastructure of shTalin1 - BMDCs using scanning electron microscopy and transmission electron microscopy found that Talin1 knockdown does not affect the morphological structure of unactivated (unstimulated with LPS) BMDCs ( Figure 2); Talin1 knockdown led to fewer phagocytic vesicles and organelles (rough endoplasmic reticulum, mitochondria, Golgi complex) in activated BMDCs (LPS-stimulated) ( Figure 3 ), which is consistent with the morphological and structural characteristics of tolerogenic dendritic cells.

[0074] 2) Identification of phenotypic characteristics of shTalin1-BMDCs

[0075] As the body's main professional antigen-presenting cells, high expression of surface molecules (costimulatory molecules and MHC molecules) and pro-inflammatory cytokines is the material basis for the activation of BMDCs and the stimulation of T cell responses. In this study, flow cytometry, qRT-PCR, and Cytometric Bead Array (CBA) were used to detect the above indicators at the transcriptional and protein levels, and it was found that, as Figures 4 - 5 shown, Talin1 had no obvious effect on the surface molecule and cytokine levels of unactivated BMDCs; Talin1 knockdown significantly downregulated the levels of costimulatory molecules (CD80, CD86) and MHCII molecules in activated BMDCs, reduced the secretion of pro-inflammatory cytokines (IL-1β, IL-6, TNF-α), and increased the secretion of anti-inflammatory cytokines (IL-10), which is also consistent with the surface molecule and cytokine expression characteristics of tolerogenic dendritic cells.

[0076] 3) Identification of the functional characteristics of shTalin1-BMDCs in stimulating CD4 + T cell responses

[0077] As antigen-presenting cells, stimulating the activation, proliferation, and differentiation of other immune cells and coordinating adaptive immune responses are important functions of dendritic cells. Based on this, this example evaluated the effect of Talin1 knockdown on the ability of BMDCs to stimulate CD4 + T cell responses. CD4 + T cells were isolated and purified from the splenic mononuclear cells of BALB / c mice. The differentiation, culture, and LPS stimulation of BMDCs were carried out as described above. The cells were treated with mitomycin C (30 mg / L, Sangon Biotech, Shanghai, China) for 30 minutes before harvesting the cells. BMDCs and CD4 + T cells were co-cultured in a 96-well plate at a ratio of 1:5 for 72 hours. CD4 + T cells were stimulated with 50 ng / mL phorbol 12-myristate 13-acetate (PMA, Sigma) and 500 ng / mL ionomycin (Sigma) as a positive control, and CD4 + T cells alone were used as a negative control. The CD4 +Proliferation of T cells (detected by CFSE staining), differentiation (differentiation into Th1, Th2, Th17, Treg cells), and production of related cytokines.

[0078] The results showed that CD4 + T cells co-cultured with shTalin1-BMDCs showed lower proliferation ( Figure 6 ), differentiation into Th1 and Th17 cells ( Figures 7A - 7F ), and significantly reduced ability to secrete IFN-γ and IL-17 ( Figure 8 ). Therefore, Talin1 knockdown significantly disrupted the function of BMDCs in stimulating CD4 + T cell responses, and shTalin1-BMDCs conformed to the functional characteristics of tolerogenic dendritic cells.

[0079] Example 2 Intervention of shTalin1-BMDCs in the EAE model and evaluation of therapeutic effect

[0080] The EAE model is an animal model of inflammatory demyelination of the central nervous system (CNS) mainly mediated by abnormal activation of CD4 + T cells and is a classical animal model of MS. Based on the phenotypic and functional characteristics of shTalin1-BMDCs described in Example 1, in this example, shTalin1-BMDCs loaded with the MOG35-55 peptide were intravenously injected into mice 3 times on days 8, 12, and 16 after EAE modeling (as Figure 9 A) (10 6 cells / mouse / time) to evaluate its therapeutic effect on the EAE model.

[0081] Among them, the sequence of the MOG35-55 (myelin oligodendrocyte glycoprotein) peptide is MEVGWYRSPFSRVVHLYRNGK (SEQ ID NO:5), purchased from Nanjing Peptide Biotechnology Co., Ltd., with MF: C 118 H 177 N 35 O 29 S, MW: 2581.95, CAS: 149635-73-4.

[0082] shTalin1-BMDCs loaded with the MOG35-55 peptide were obtained by treating shTalin1-BMDCs (16 μM) with the MOG35-55 peptide (20 μg / ml) and LPS (100 ng / ml) for 24 h.

[0083] The results showed that: ① shTalin1-BMDCs significantly increased the survival rate of EAE mice and delayed the onset time ( Figure 9D and Figure 10 A); ② shTalin1 - BMDCs significantly reduced the average, maximum, and cumulative neurological deficit scores in EAE mice ( Figure 9 C, Figure 10 B and Figure 10 C); ③ The body weight of mice in the EAE model intervened with shTalin1 - BMDCs was stable during the overall experiment ( Figure 9 B), and no unexpected events such as obvious emaciation, skin ulceration, infection, death, etc. occurred. The above overall demonstrated the positive therapeutic effect of shTalin1 - BMDCs on the EAE model from the perspectives of intervention safety and effectiveness.

[0084] Example 3 Neuropathology

[0085] Experimental autoimmune encephalomyelitis (EAE) is a classical animal model of multiple sclerosis, with massive inflammatory cell infiltration in the central nervous system and demyelination of white matter as typical pathological features. In this example, hematoxylin - eosin staining (HE) and Luxol Fast Blue (LFB) staining were used to further evaluate the above - mentioned indicators.

[0086] The construction of the EAE model and the intervention of shTalin1 - BMDCs loaded with MOG35 - 55 peptide were the same as in Example 2. The data showed that Talin1 - knockdown BMDCs significantly reduced the inflammatory infiltration score ( Figure 11 A - C) and demyelination score ( Figure 11 D - F) in the spinal cord (lumbar enlargement) tissue of EAE mice. The above verified the neuroprotective effect of Talin1 - knockdown BMDCs on the EAE model from the perspective of neuropathology.

[0087] Example 4 Peripheral immune homeostasis

[0088] CD4 + T cells in the spleen of EAE mice had a strong response ability to re - stimulation with the MOG35 - 55 peptide, and were able to rapidly proliferate and differentiate into Th1 and Th17 cells, which were also important sources of pathogenic inflammatory cells in the EAE model. Based on this, this example evaluated the splenocyte reactivity of EAE mice intervened with shTalin1 - BMDCs.

[0089] The construction of EAE model and the intervention of shTalin1-BMDCs loaded with MOG35-55 peptide were the same as in Example 2. The results showed that the spleen cells of EAE mice treated with shTalin1-BMDCs showed a lower ability to differentiate into Th1 and Th17 cells under the condition of MOG35-55 peptide restimulation ( Figures 12A - 12F ), but the proportion of them differentiating into Treg cells increased significantly ( Figures 12G - 12H ), reshaped the Th1 / Th17 / Treg balance. The above explains the mechanism of shTalin1-BMDCs in treating EAE from the perspective of peripheral immune homeostasis regulation.

[0090] Example 5 Maintaining the balance of Th1 / Th17 / Treg in the CNS

[0091] Abnormally activated inflammatory cells in the periphery (mainly including Th1, Th17 cells, etc.) break the blood-brain barrier and enter the CNS. In the CNS, these inflammatory cells further proliferate and severely damage the differentiation and survival of oligodendrocytes or oligodendrocyte precursor cells that form myelin. This is the main pathological process of myelin loss caused by inflammation in the EAE model. This example uses immunohistochemistry (IHC) staining to detect Th1 (IFN-γ + ), Th17 (IL-17 + ), Treg (IL-10 + ) Cell infiltration.

[0092] The construction of EAE model and the intervention of shTalin1-BMDCs loaded with MOG35-55 peptide were the same as in Example 2. The results showed that the intervention of shTalin1-BMDCs significantly reduced the immunohistochemistry (IHC) scores of Th1 and Th17 cells in the lumbar enlargement tissue of the spinal cord of EAE mice ( Figure 13 A and Figure 13 B) and significantly increased the IHC score of Treg cells ( Figure 13 C) The above explains the mechanism of shTalin1-BMDCs in treating EAE from the perspective of maintaining the balance of Th1 / Th17 / Treg in the CNS.

Claims

1. Use of dendritic cells in the preparation of a drug for treating demyelinating diseases, characterized in that, Knock down the Talin1 gene in the dendritic cells and load myelin peptides; The myelin peptides are myelin basic protein peptides, myelin oligodendrocyte glycoprotein peptides, proteolipid protein peptides or myelin-associated glycoprotein peptides; The method of knockdown is RNA interference, and the shRNA sequence targeting the Talin1 gene in the RNA interference is: CCAAAUGGCCCAGUACUUUUU; The demyelinating disease is multiple sclerosis.

2. The application according to claim 1, characterized in that The dendritic cells include dendritic cells in the skin, airway, spleen, blood, lymph or bone marrow.

3. The application according to claim 1, characterized in that The myelin peptide is the MOG35-55 peptide segment, and the amino acid sequence of the MOG35-55 peptide segment is as shown in SEQ ID NO:

5.

4. A dendritic cell, characterized in that, Knock down the Talin1 gene in the dendritic cells, and the dendritic cells are loaded with myelin peptides; The myelin peptides are myelin basic protein peptides, myelin oligodendrocyte glycoprotein peptides, proteolipid protein peptides or myelin-associated glycoprotein peptides; The method of knockdown is RNA interference, and the shRNA sequence targeting the Talin1 gene in the RNA interference is: CCAAAUGGCCCAGUACUUUUU.

5. A method for preparing dendritic cells as described in claim 4, characterized in that, The preparation method includes: knocking down the Talin1 gene in dendritic cells loaded with myelin peptides; The myelin peptides are myelin basic protein peptides, myelin oligodendrocyte glycoprotein peptides, proteolipid protein peptides or myelin-associated glycoprotein peptides; The method of knockdown is RNA interference, and the shRNA sequence targeting the Talin1 gene in the RNA interference is: CCAAAUGGCCCAGUACUUUUU.

6. A drug for treating multiple sclerosis, characterized in that, The drug includes the dendritic cells described in claim 4.

Images