Use of miRNA-5134-5p inhibitors in the preparation of anti-breast cancer drugs
By preparing an anti-breast cancer drug containing a miRNA-5134-5p inhibitor and detecting its expression level, the application gap of miRNA-5134-5p in breast cancer treatment was filled, achieving inhibition of breast cancer cell invasion and migration, improving treatment efficacy, and providing a biomarker for early diagnosis and prognostic assessment.
Patent Information
- Application Number
- CN202510126071.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-27
- Publication Date
- 2026-03-31
- Estimated Expiration
- 2045-01-27
AI Technical Summary
The application of miRNA-5134-5p in the treatment of breast cancer has not been reported in the current technology, and the symptoms of advanced breast cancer are not obvious and are easily overlooked, making treatment difficult.
We provide miRNA-5134-5p inhibitors for the preparation of anti-breast cancer drugs, predict metastatic potential by detecting the expression level of miRNA-5134-5p in breast cancer, and prepare drugs containing recombinant plasmid vectors or recombinant viral vectors of miRNA-5134-5p inhibitors. These drugs, combined with small molecule drugs and kits, are used for the treatment and evaluation of breast cancer.
miRNA-5134-5p inhibitors can effectively inhibit the invasion and migration of breast cancer cells, improve treatment efficacy, and predict the metastatic ability of breast cancer by detecting the expression level of miRNA-5134-5p, providing biomarkers for early diagnosis and prognostic assessment.
Smart Images

Figure CN119925612B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, and specifically discloses the application of miRNA-5134-5p inhibitors in the preparation of anti-breast cancer drugs. Background Technology
[0002] Breast cancer (BC) is one of the most common malignant tumors affecting women's survival. Early-stage breast cancer often presents with subtle symptoms, primarily localized symptoms such as breast lumps, abnormal breast skin, nipple discharge, or nipple or areola abnormalities. These symptoms are easily overlooked due to their subtlety. In advanced stages, breast cancer can lead to cachexia, characterized by loss of appetite, anorexia, weight loss, fatigue, anemia, and fever. This is a critical issue that needs to be addressed in breast cancer treatment.
[0003] MicroRNAs (miRNAs) are short, non-coding RNA molecules, typically 18 to 25 nucleotides in length. As core regulatory molecules in tumor development, miRNAs have shown great potential as clinical diagnostic tools and biomarkers for novel anticancer therapies. Current research reveals that various miRNAs can specifically regulate the expression of genes closely related to cancer, potentially acting as oncogenes or tumor suppressor genes. Given their small molecular weight, ease of cellular acceptance, and relatively low synthesis cost, miRNAs are considered a preferred candidate for targeted cancer therapy. In breast cancer prevention strategies, miRNAs can regulate multiple biological processes related to breast cancer initiation and progression, covering key aspects such as epithelial-mesenchymal transition (EMT), programmed cell death (apoptosis), and cell cycle regulation. However, it is noteworthy that, to date, the practical application of miRNA-5134-5p in breast cancer treatment has not been reported. Summary of the Invention
[0004] To address the aforementioned issues, this invention provides the application of miRNA-5134-5p inhibitors in the treatment of breast cancer. The miRNA-5134-5p inhibitors disclosed in this invention can effectively inhibit the invasion and migration of breast cancer and have significant anti-liver cancer effects. Furthermore, this invention also discloses that detecting the expression level of miRNA-5134-5p in breast cancer can predict its metastatic potential, which has potential application value in the treatment of breast cancer.
[0005] This invention is achieved through the following technical solution:
[0006] This invention discloses for the first time the application of miRNA-5134-5p inhibitors in the preparation of anti-breast cancer drugs.
[0007] Furthermore, in the above application, the breast cancer referred to is triple-negative breast cancer.
[0008] Furthermore, in the above applications, the nucleotide sequence of the miRNA-5134-5p is shown in SEQ ID No. 1; and the nucleotide sequence of the miRNA-5134-5p inhibitor is shown in SEQ ID No. 2.
[0009] The present invention also discloses the application of a bioactive fragment containing a miRNA-5134-5p inhibitor in the preparation of an anti-breast cancer drug, characterized in that the bioactive fragment includes, but is not limited to, a recombinant plasmid vector or a recombinant viral vector containing a nucleotide sequence of a miRNA-5134-5p inhibitor.
[0010] The present invention also discloses a set of probes for detecting the expression level of miRNA-5134-5p, having nucleotide base sequences as shown in SEQ ID No. 3 and 4.
[0011] The present invention also discloses a small molecule drug for treating breast cancer, characterized in that the small molecule drug comprises a bioactive fragment containing a miRNA-5134-5p inhibitor.
[0012] Furthermore, the aforementioned small molecule drugs also include medically acceptable carriers and / or excipients; preferably, the carriers and / or excipients are one or more of chitosan, cholesterol, liposomes, cyclodextrin, and microcapsules.
[0013] Furthermore, the above-mentioned small molecule drug is in the form of an oral dosage form or an injection; the injection includes, but is not limited to, intravenous injection, intramuscular injection or intratumoral injection.
[0014] The present invention also discloses a kit for assessing the malignancy of breast cancer, the kit comprising primers for specifically detecting the expression level of miRNA-5134-5p, the primers comprising an upstream primer and a downstream primer.
[0015] Furthermore, in the above-mentioned kit, the sequence of the upstream primer is shown in SEQ ID No. 3, and the sequence of the downstream primer is shown in SEQ ID No. 4.
[0016] Compared with the prior art, the present invention has the following beneficial effects:
[0017] The miRNA-5134-5p inhibitor disclosed in this invention can significantly inhibit the invasion and migration of breast cancer cells in vitro and in vivo. In our examples, we found that overexpression of miRNA-5134-5p significantly increased the invasion and migration of breast cancer cells, while transfection with the miRNA-5134-5p inhibitor could suppress the malignant phenotype of breast cancer cells. Therefore, the miRNA inhibitor provided by this invention can be used to prepare anti-breast cancer drugs, improve the clinical treatment effect of advanced malignant breast cancer tumors, and has good clinical development and application value. Furthermore, this invention also found that by detecting the expression level of miRNA-5134-5p in breast cancer, the metastatic ability of breast cancer can be predicted, providing a new biomarker for the early diagnosis and prognostic assessment of breast cancer, which has important clinical application value. Attached Figure Description
[0018] Figure 1 To detect the expression level of miRNA-5134-5p in cells using qPCR;
[0019] Figure 2 To detect the effect of miRNA-5134-5p on the invasive ability of breast cancer cells using transwell assays;
[0020] Figure 3 To detect the effect of miRNA-5134-5p on the proliferation ability of breast cancer cells using the CCK8 assay;
[0021] Figure 4 To detect the effect of miRNA-5134-5p on the migration ability of breast cancer cells using a cell scratch assay;
[0022] Figure 5 To detect the effect of miRNA-5134-5p on the cloning ability of breast cancer cells using a plate cloning assay;
[0023] Figure 6 To detect the effect of miRNA-5134-5p on the transcriptional levels of proteins in the EMP and apoptosis pathway in breast cancer cells using qPCR experiments;
[0024] Figure 7 The purpose of this study was to examine the effect of miRNA-5134-5p on the protein levels of proteins involved in EMP and apoptosis pathways in breast cancer cells using Western blotting experiments. Detailed Implementation
[0025] The present invention will be further described below with reference to the accompanying drawings and embodiments. The content of the embodiments is not intended to limit the scope of protection of the present invention.
[0026] The nucleotide base sequence of miRNA-5134-5p provided by this invention is 5'-UUGGCAGAAAGGGCAGCUGUG-3' (as shown in SEQ ID NO.1), and the nucleotide base sequence of the miRNA-5134-5p inhibitor provided is CACAGCUGCCCUUUCUGCCAA (as shown in SEQ ID NO.2). The bioactive fragment of the miRNA-5134-5p inhibitor can be, but is not limited to, a recombinant plasmid vector or a recombinant viral vector of the nucleotide sequence of miRNA-5134-5p.
[0027] The kit for assessing the malignancy of breast cancer according to the present invention includes primers for specifically detecting the expression level of miRNA-5134-5p, wherein the primers include an upstream primer and a downstream primer; the nucleotide base sequence of the upstream primer is 5'-CCAGGAGGCTGAGGTC-3' (as shown in SEQ ID NO.3), and the nucleotide base sequence of the downstream primer is 5'-GTCCAGTTTTTTTTTTTTTTTAGGGA-3' (as shown in SEQ ID NO.4).
[0028] The reagents, materials, and instruments used in the experiments of the examples are shown in Tables 1 and 2 below:
[0029] Table 1: Relevant Materials Used in Cell Culture Experiments
[0030]
[0031]
[0032] Table 2: Instruments and Equipment
[0033]
[0034]
[0035] The following specific examples illustrate this point.
[0036] Example 1
[0037] In this embodiment, breast cancer cells 4T1 were used as an experimental model. The miRNA-5134-5p and miRNA-5134-5p inhibitor of the present invention were transfected into breast cancer cells to upregulate or downregulate the level of intracellular miRNA-5134-5p, and then the effects of miRNA-5134-5p on breast cancer cell invasion, migration, cell population dependence and proliferation were detected.
[0038] Step 1: Construct cell lines that overexpress and knock down miRNA-5134-5p
[0039] A. Prepare two 1.5 mL EP tubes, adding 250 μL of DMEM medium to each. In the overexpression group, add 3 μL of NC mimics to one EP tube and 3 μL of miRNA-5134-5p mimics to the other. Similarly, in the knockdown group, add 3 μL of NC inhibitor to one EP tube and 3 μL of miRNA-5134-5p inhibitor to the other.
[0040] B. Prepare four additional 1.5 mL EP tubes, each containing 250 μL of DMEM medium and 5 μL of Thermo Fisher Lip2000 transfection reagent, and mix thoroughly.
[0041] C. Combine the mixtures from steps A and B, gently mix them, and let them stand at room temperature in the dark for 15-20 minutes.
[0042] D. Select healthy 4T1 cells (60-80% density), discard the old culture medium, and wash with PBS.
[0043] E. Add the mixture from step C to the cells, supplement with 1.5 mL of DMEM medium, and incubate at 37°C.
[0044] F. After 4-6 hours, check the cell status, remove the culture medium, wash the cells with PBS, add fresh culture medium with 10% serum, continue culturing, and collect cells 24-36 hours after transfection to detect the expression effect of miRNA-5134-5p.
[0045] Step 2: Prepare the reverse transcription reaction solution according to the following proportions.
[0046] Table 3: miRNA Reverse Transcription Reaction Solution Formulation Table
[0047]
[0048] Table 4: miRNA Reverse Transcription PCR Procedure Table
[0049] 37℃ 60min 95℃ 5min
[0050] After obtaining the cDNA product, miRNA quantification was performed using the HG miRNA real-time PCR kit.
[0051] Prepare a 10 μl PCR reaction system according to the following proportions.
[0052] Table 5: miRNA Real-Time PCR Reaction Solution Formulation Table
[0053] 2×Hi SYBR Green qPCR Mix 5μl 1×miRNA Primer R (10μM) 0.4μl 1×miRNA Primer F (10μM) 0.4μl cDNA template 1~2.5μg ddH2O Up to 10μl
[0054] Real-time PCR reactions typically employ a two-step method, as follows:
[0055] Table 6: miRNA Real-Time PCR Reaction Procedure
[0056]
[0057] Obtain the test results. Figure 1 To detect the expression of miRNA-5134-5p in cells, we found that transfection with a miRNA-5134-5p-l analog significantly increased the expression level of miRNA-5134-5p (P<0.05). Conversely, transfection with a miRNA-5134-5p inhibitor significantly decreased the expression level of miRNA-5134-5p. Data are expressed as mean ± standard deviation (SD) and were measured in triplicate. Statistical significance levels are indicated as follows: **p<0.01, *p<0.05 compared to the NC group.
[0058] Cell invasion ability detection experiment:
[0059] Pre-wet the 24-well plate and Transwell chambers with PBS for 5 minutes to ensure they are moist. Centrifuge to recover the trypsin-digested cells and resuspend them in low-serum medium (approximately 2% serum) to a density of 3 × 10^5 cells / mL. Add approximately 5 × 10^4 cells to each chamber, taking care to avoid creating air bubbles when adding the cell suspension. Add high-serum medium (approximately 20% serum) to the bottom layer, with three replicates per group, and incubate for 36 hours. Use a cotton swab to aspirate the upper culture medium and cells, and wash three times with 1×PBS; then add an appropriate amount of anhydrous formaldehyde to each well and fix at room temperature for 15 minutes. Subsequently, wash three times with 1×PBS, add an appropriate amount of 2% crystal violet staining solution to each well, and incubate for 15 minutes; after the time is up, wash again until colorless and air dry. Observe the transmembrane penetration results under a microscope.
[0060] like Figure 2 As shown, the cell invasion assay revealed that miRNA-5134-5p could increase the invasive ability of breast cancer cells compared with the negative control group, while the number of invasive cells was significantly reduced under inhibitor treatment.
[0061] Cell proliferation capacity assay:
[0062] Cells were treated to a concentration of 1.5 × 10^4 cells / ml and seeded into 96-well plates (100 μl / well), with 3-5 replicates per group. Cells were cultured under normal conditions. Before each measurement, 1% CCK-8 reaction solution was added to each well, and the cells were incubated at a constant temperature for 1-4 hours. Cell viability was observed every 12 hours at a wavelength of 450 nm using a microplate reader. Report graphs were generated using GraphPad Prism 5 software.
[0063] like Figure 3 Therefore, the CCK8 assay of 4T1 cells showed that compared with the negative control group, miRNA-5134-5p could increase the proliferation of breast cancer cells, while the proliferation of cells decreased under the treatment of inhibitors.
[0064] Cell migration ability detection experiment:
[0065] Cells to be tested were treated with trypsin, and cell counts were performed using a cell counter. Appropriate culture medium dilution and density adjustments were then made. The prepared cell suspension was seeded into 6-well plates at a density of 1 × 10⁶ cells per well. 5 Cells were incubated at 37°C with 5% CO2. When the cell fusion rate reached 90%, a scratch was made using a sterile pipette tip, ensuring the tip was held vertically and applying even pressure. After washing the culture plate with 1×PBS, DMEM medium containing 2% FBS was added. The cell condition was observed and recorded under a microscope at 0 hours. After incubation for approximately 18-28 hours, the plate was rinsed with 1×PBS, the medium was replaced, and the healing process was photographed and recorded under a microscope.
[0066] like Figure 4 Therefore, the 4T1 cell migration assay showed that compared with the negative control group, miRNA-5134-5p could increase the migration ability of breast cancer cells, while the number of migrating cells was significantly reduced under inhibitor treatment.
[0067] Cell monoclonal capacity assay:
[0068] Collect cells in the logarithmic growth phase, digest them with trypsin, centrifuge, and add DMEM medium containing only 10% serum for cell counting. Add cells at a gradient of 500-1000 cells per well to a medium dish and incubate at a constant temperature for 10-14 days, changing the medium every 3 days. When clones are visible, wash with PBS and fix with 4% glutaraldehyde for 20 minutes. Remove the fixative, wash twice with PBS, and stain with crystal violet for 15 minutes. Aspirate the stain, wash away any residue, observe under a microscope, and record the number of clones.
[0069] like Figure 5Therefore, the 4T1 cell migration assay showed that compared with the negative control group, miRNA-5134-5p could increase the clonogenic ability of breast cancer cells, while the number of cell clones was significantly reduced under inhibitor treatment.
[0070] Example 2
[0071] In this embodiment, 4T1 breast cancer cells were used as an experimental model. The miRNA-5134-5p analogue and miRNA-5134-5p inhibitor of this invention were transfected into the breast cancer cells to upregulate or downregulate the intracellular miRNA-5134-5p level. The effects of miRNA-5134-5p on the transcriptional levels of genes related to EMT and apoptosis pathways in breast cancer cells were clarified using qRT-RCP experiments.
[0072] Step 1. Extraction of miRNA:
[0073] Cell samples were safely removed from the culture environment, and old culture medium was carefully removed. To avoid contamination and ensure cell purity, the cells were gently washed with PBS buffer. Subsequently, an appropriate amount of RNA lysis buffer was added to the cells to ensure complete lysis and release of RNA. The lysed mixture was collected into centrifuge tubes, properly labeled, and then stored at -80°C to ensure RNA stability and integrity.
[0074] The pre-frozen cell lysis buffer was removed and allowed to thaw. Next, RNA Extraction Agent was added to the lysis buffer and thoroughly mixed by vortexing until no visible precipitate remained. The mixture was then briefly vortexed at room temperature to further promote the separation of RNA from impurities. Subsequently, the RNA was enriched in the upper aqueous phase by centrifugation.
[0075] Transfer the separated supernatant to a new EP tube, add an appropriate volume of ice-cold isopropanol, invert the tube several times to mix thoroughly, and let it stand for 15 minutes to allow the RNA to precipitate completely. Centrifuge again to separate the RNA precipitate from the supernatant. Discard the supernatant and wash the RNA precipitate with 75% ethanol to remove residual impurities and salts. After centrifugation, place the centrifuge tube in a ventilated area to air dry at room temperature for about 5-10 minutes. Note that prolonged drying is not advisable, as the RNA will be difficult to dissolve. Finally, add an appropriate amount of enzyme-free water to dissolve the RNA precipitate, and accurately measure the RNA concentration using a concentration analyzer. Store the RNA sample again at -80°C for subsequent experiments.
[0076] Step 2. RNA reverse transcription
[0077] Thaw the template RNA and reagents on ice. Before use, gently tap or vortex each solution to mix. Briefly centrifuge to collect any remaining liquid from the tube wall to the bottom of the tube.
[0078] Prepare the following reaction system in an RNase-free tube on ice:
[0079] Table 6: RNA Reverse Transcription Reaction Solution Formulation Table
[0080]
[0081] Gently pipette to mix, then place in a PCR instrument and run the following program.
[0082] Table 7: RNA Reverse Transcription Procedure
[0083]
[0084] A rapid procedure is typically chosen for reverse transcription; if the template has complex secondary structures or high-GC regions, a standard procedure should be used. The resulting cDNA product can be used immediately for qPCR or stored at -20°C and used within six months; for long-term storage, aliquoting and storage at -80°C are recommended. Repeated freeze-thaw cycles should be avoided with cDNA.
[0085] Step 3. Quantitative Real-Time PCR Detection:
[0086] First, access the NCBI website and search for the CDS region sequence of the gene you wish to determine by gene name or ID. Input this sequence into the Primer-BLAST module and select an appropriate species so that the system can automatically design primers. Select primers that are far from the 5' end and send the selected primers to a biotechnology company for synthesis.
[0087] Prepare the qPCR reaction solution according to the table below, accurately add it to a 96-well plate, seal it, and place it in a qPCR instrument. Set the program according to Table 9, and ensure accurate spotting on ice. Analyze the data using Piko Real Software and use GraphPad Prism 5 to plot and display the qRT-PCR results. The results are shown below. Figure 6As shown. Overexpression of miRNA-5134-5p increased the expression levels of EMT-promoting genes (N-cadherin, Zeb2) and decreased the expression levels of EMT-inhibiting genes (E-cadherin), thus promoting the EMT process. Simultaneously, the expression level of the anti-apoptotic protein Bcl2 increased, inhibiting apoptosis. Knockdown of miRNA-5134-5p produced the opposite results, inhibiting EMT in cancer cells and promoting apoptosis. Data are expressed as mean ± standard deviation (SD) and were measured in triplicate. Statistical significance levels are indicated as follows: **p < 0.01, *p < 0.05 compared to the NC group.
[0088] Table 8: qPCR reaction system
[0089] Component Volume 2X SGExcel FastSYBR Mixture 5μL Forward Primer, 2.5μM 0.5μL Reverse Primer, 10μM 0.5μL Template DNA 1μL Nuclease-Free Water 3μL
[0090] Table 9: qPCR reaction procedure
[0091]
[0092] Example 3
[0093] This embodiment uses miR-5134-5p from the present invention, with 4T1 breast cancer cells as the experimental model. Following the transfection reagent instructions, 20 nM miR-5134-5p inhibitor and mimic were transfected into the cells for Western blot (WB) experiments. The experimental steps are as follows: SDS-PAGE protein lysis buffer was added to each group of cells, and lysis was performed on ice for 10 min, followed by incubation at 100°C for 10 min. 30 μl of protein was loaded onto the cell line, and the protein was separated by 10% SDS-PAGE gel electrophoresis and transferred to a PVDF membrane. Then, 5% skim milk powder was prepared with TBST and the membrane was blocked at room temperature for 1 h, followed by incubation with primary antibody at 4°C overnight. The membrane was washed three times with TBST for 10 min each time, and then incubated with secondary antibody according to the primary antibody type at room temperature for 1 h with shaking. ECL was used for imaging, and ImageJ software was used to calculate the band gray values and analyze the relative protein expression levels. The effects of miRNA-5134-5p on EMT and apoptosis pathways in breast cancer cells were observed. Figure 7As shown. Overexpression of miRNA-5134-5p decreased the expression level of E-cadherin, a gene that inhibits EMT, promoting the EMT process, while increasing the expression level of Bcl2 protein, inhibiting apoptosis. Transfection with the miRNA-5134-5p inhibitor yielded the opposite results: a significant increase in the expression level of E-cadherin, the gene that inhibits EMT, inhibiting the EMT process, while a decrease in Bcl2 protein expression, resulting in decreased anti-apoptotic ability. Data are expressed as mean ± standard deviation (SD) and were measured in triplicate. Statistical significance levels are indicated as follows: **p < 0.01, *p < 0.05 compared to the NC group.
[0094] In this invention, using breast cancer cells as the experimental subject, it was demonstrated that overexpression of miRNA-5134-5p promotes tumor invasion and migration. Conversely, miRNA-5134-5p inhibitors can suppress malignant phenotypes such as tumor invasion and migration. Therefore, inhibiting the biological activity of miRNA-5134-5p can serve as an adjunctive treatment for breast cancer. Furthermore, this invention provides a method for detecting miRNA-5134-5p expression levels in tumor samples and breast cancer cells using standard primers and quantitative PCR. This method is simple to operate and yields accurate results.
[0095] The above embodiments of the present invention are merely examples for clearly illustrating the present invention and are not intended to limit the implementation of the present invention. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is impossible to exhaustively list all possible implementations here. All obvious variations or modifications derived from the technical solutions of the present invention are still within the protection scope of the present invention.
Claims
1. Use of a miRNA-5134-5p inhibitor having a nucleotide sequence as shown in SEQ ID NO. 2 in the preparation of a medicament for treating triple-negative breast cancer in mice.
2. Use of a set of probes as shown in SEQ ID NO. 3 and SEQ ID NO. 4 in the preparation of a kit for evaluating the malignancy or prognosis of triple-negative breast cancer in mice.