Nucleic acid aptamer specifically binding to paroxetine hydrochloride small molecules and use thereof

By developing a nucleic acid aptamer that specifically binds to small molecules of paroxetine hydrochloride, personalized medication has been achieved, solving the adverse reaction problem of SSRI drugs and improving medication efficiency and safety.

CN115838730BActive Publication Date: 2026-07-10HANGZHOU BAICHEN MEDICAL LAB CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-28
Publication Date
2026-07-10

AI Technical Summary

Technical Problem

In the current technology, the increased prescription dosage of SSRI drugs such as paroxetine hydrochloride may induce suicide, especially in adolescents, and the lack of individualized medication guidance leads to frequent adverse reactions, long treatment time, and high costs.

Method used

Develop nucleic acid aptamers that specifically bind to small molecules of paroxetine hydrochloride, possessing high affinity and being easy to modify and label, for personalized and rational drug use, monitoring blood drug concentrations through bioassays, and developing individualized dosing regimens.

Benefits of technology

It has improved the efficacy of clinical medication, reduced adverse reactions, shortened treatment time, saved medication costs, and provided individualized medication guidance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115838730B_ABST
    Figure CN115838730B_ABST
Patent Text Reader

Abstract

The application discloses a nucleic acid aptamer specifically combined with a small molecule of paroxetine hydrochloride and application thereof, and relates to a nucleotide sequence shown in SEQ ID No. 1, or a nucleotide sequence with high homology to the nucleotide sequence shown in SEQ ID No. 1 and capable of being specifically combined with a small molecule of paroxetine hydrochloride, or a nucleotide sequence derived from the nucleotide sequence shown in SEQ ID No. 1 and capable of being specifically combined with a small molecule of paroxetine hydrochloride. The nucleic acid aptamer specifically combined with a small molecule of paroxetine hydrochloride has high affinity, high specificity, low molecular weight, easy modification, easy preservation and labeling.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, and relates to nucleic acid aptamers, especially to nucleic acid aptamers that specifically bind to small molecules of paroxetine hydrochloride and their applications. Background Technology

[0002] Depression is a mood disorder characterized by eight symptoms, including all three core symptoms and additional symptoms of a depressive episode. Its pathogenesis is complex, primarily involving the interaction of the nervous system, neuroendocrine system, and genetic and non-genetic factors. Paroxetine hydrochloride is a phenylpiperidine derivative and a SSRI (SSRI). SSRIs are currently the most widely used antidepressants in clinical practice. They significantly inhibit the reuptake of serotonin by nerve cells, increase serotonin levels in the synaptic cleft of nerve cells, enhance the transmission effects of serotonergic neurons, and effectively relieve depressive and anxiety symptoms. Paroxetine hydrochloride is one of the representative SSRIs, showing good efficacy in the vast majority of patients with depression, and is well-tolerated by patients.

[0003] Nucleic acid aptamers are DNA or RNA molecules isolated through systematic evolution of ligands using exponential enrichment (SELEX) technology. They can bind with high affinity and specificity to other targets such as proteins, metal ions, small molecules, peptides, and even whole cells, thus showing broad prospects in biochemical analysis, environmental monitoring, basic medicine, and new drug synthesis. Compared with antibodies, nucleic acid aptamers have advantages such as smaller molecular weight, better stability, ease of modification, no immunogenicity, shorter production cycle, and can be synthesized artificially.

[0004] Increased prescriptions of SSRIs may trigger suicide, especially among adolescents. Summary of the Invention

[0005] To overcome the shortcomings of existing technologies, the purpose of this invention is to provide a nucleic acid aptamer that specifically binds to paroxetine hydrochloride small molecules with high affinity, high specificity, low molecular weight, ease of modification, preservation, and labeling, and its application. This invention plays an important role and provides guidance for monitoring the blood concentration of antidepressants in the clinical diagnosis and treatment of depression. It offers individualized and tailored guidance for rational drug use for patients with primary or secondary depression, developing personalized and rational dosing regimens, improving clinical efficacy while effectively avoiding or minimizing adverse reactions, thereby significantly shortening clinical treatment time and saving on medication costs.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] The present invention first provides a nucleic acid aptamer that specifically binds to paroxetine hydrochloride small molecules, including the nucleotide sequence shown in SEQ ID No. 1; or, a nucleotide sequence that has high homology with the nucleotide sequence of SEQ ID No. 1 and can specifically bind to paroxetine hydrochloride small molecules; or a nucleotide sequence derived from the nucleotide sequence shown in SEQ ID No. 1 that can specifically bind to paroxetine hydrochloride small molecules.

[0008] As a preferred embodiment of the present invention, the high homology refers to at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% homology with the nucleotide sequence shown in SEQ ID Nos. 1.

[0009] As a preferred embodiment of the present invention, the nucleic acid aptamer comprises a nucleotide sequence complementary to the nucleotide sequence and maintains affinity.

[0010] As a preferred embodiment of the present invention, the nucleotide sequence of the nucleic acid aptamer includes base modifications and maintains affinity.

[0011] As a preferred embodiment of the present invention, the base modification is thiomodification, phosphorylation, methylation, amylation, thiolation, selenium-substituted oxygen modification, or isotope linkage modification.

[0012] As a preferred embodiment of the present invention, the nucleotide sequence of the nucleic acid aptamer contains a marker and maintains affinity.

[0013] As a preferred embodiment of the present invention, the marker is a fluorescent marker, a radioactive marker, a therapeutic marker, a biotin marker, a digoxigenin marker, a nanoluminescent material marker, a small peptide marker, an siRNA marker, or an enzyme marker.

[0014] This invention also provides a method for the biodetection of paroxetine hydrochloride small molecules using nucleic acid aptamers that specifically bind to the above-mentioned paroxetine hydrochloride small molecules.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] 1) The nucleic acid aptamer of the present invention that specifically binds to paroxetine hydrochloride small molecules has high affinity, high specificity, low molecular weight, is easy to modify, easy to store and label.

[0017] 2) The specific binding nucleic acid aptamer of paroxetine hydrochloride small molecules of the present invention provides guidance for individualized and rational drug use for a wide range of patients with primary or secondary depression, and formulates personalized and rational dosing plans. This improves the clinical efficacy of drug use while effectively avoiding or reducing adverse reactions to a limited extent, thereby greatly shortening the clinical treatment time and saving the economy and cost of drug use. Attached Figure Description

[0018] Figure 1 It represents the retention rate of paroxetine hydrochloride in each round of screening.

[0019] Figure 2 This is a simulated secondary structure diagram of a nucleic acid aptamer.

[0020] Figure 3 This invention is for detecting CD spectra.

[0021] Figure 4 This is the ITC diagram of the present invention.

[0022] Figure 5 This is the fluorescence detection pattern of the present invention.

[0023] Figure 6 This is the linear fitting graph of the present invention.

[0024] Figure 7 This is the chromatogram of the control group of this invention.

[0025] Figure 8 This is the chromatogram of the experimental group of this invention. Detailed Implementation

[0026] To facilitate understanding of the technical means, creative features, objectives, and effects of this invention, the invention is further described below with reference to specific embodiments. However, the following embodiments are merely preferred embodiments of this invention and not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments described herein without creative effort are all within the scope of protection of this invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0027] Example 1

[0028] Screening for specific binding of paroxetine hydrochloride aptamers

[0029] Library and primer information

[0030] Random single-stranded DNA library: 5'-TTCAGCACTCCACGCATAGC(N36)CCTATGCGTGCTACCGTGAA-3'; where "N36" represents a sequence of 36 arbitrary nucleotide bases linked together. This library was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0031] Primer information is shown in Table 1, and the primers were synthesized by General Biotech (Anhui) Co., Ltd.

[0032] Table 1. Primers and sequences for paroxetine hydrochloride

[0033]

[0034]

[0035] In this primer, S represents the forward primer, A represents the reverse primer, the 25 A's in the sequence represent a polyA tail composed of 25 adenosine nucleotides (A), and "Spacer 18" represents an 18-atom hexaethylene glycol intermediate arm. The structural formula of "Spacer 18" used in the above 3' primers is shown in formula (I).

[0036]

[0037] The specific screening method is as follows:

[0038] Experimental materials:

[0039] SA magnetic beads, DPBS buffer, library: Lib13-76nt, Lib13 library corresponding Q-PCR mix, Lib13 library corresponding ePCR mix, 12% denaturing PAGE gel, EM 90Oil, paroxetine hydrochloride (36.6mM).

[0040] The molecular formula of paroxetine hydrochloride is shown in formula (II):

[0041]

[0042] Experimental steps

[0043] The process for each round of screening is largely similar. The first round of screening is described in detail below:

[0044] 1) Take 28 μL of the dissolved lib13-CS-biotin primer and add it to the diluted lib13 library. Mix well and aliquot into eight-tube PCR tubes. Use a PCR instrument for slow annealing (slow annealing conditions: 95℃ for 10 min, slow cooling to 60℃ for 1 min, then slow cooling to 25℃, with a cooling rate of 0.1℃ / second). Hold at 25℃ for 1 min for later use.

[0045] 2) Take a small amount of a library with good reversibility for UV concentration detection and record the UV detection A260 data C1.

[0046] 3) Take 70 μL of magnetic beads and wash them with 200 μL of screening buffer each time, for a total of 5 washes. (For the last wash, you can temporarily store the magnetic beads in the screening buffer to prevent them from drying out and becoming inactive. Remove the screening buffer before adding them to the library.)

[0047] 4) After the renaturation process, add the library and lib13-CS-biotin mixture to the washed magnetic beads, mix well, and incubate on a rotating shaker at room temperature for 40 min. Use a strong magnet to adsorb all the magnetic beads, and use a pipette to take a small amount of supernatant to detect the UV A260 value C2. Use the C2 / C1 value to determine the concentration of nucleic acids in the supernatant that are not fixed to the magnetic beads to determine the library fixation efficiency.

[0048] 5) After fixation, wash four times with 200μL DPBS, and record them as wash1, wash2, wash3 and wash4.

[0049] 6) Reverse screening: Add 200 μL of DPBS and incubate on a shaker for 60 min. Use a magnet to adsorb the supernatant and record it as R-Elution-. Then wash with DPBS once and record it as wash5.

[0050] 7) Positive screening: Prepare 5 μL of stock solution, dilute with DPBS to make the final concentration of small molecules 800 uM / 200 μL, mix well and add to magnetic beads, incubate on a shaker for 60 min, adsorb by magnet, aspirate the supernatant and label it as R-Elution+.

[0051] 8) Take an 8-tube Roche PCR tube, add 30 μL of Q-PCR mix to each well, and then add 2 μL each of wash and Elution.

[0052] 9) Perform quantitative real-time PCR. The program is as follows: 95℃ for 2 min; 95℃ for 0.5 min, 60℃ for 0.5 min, 72℃ for 0.5 min for 30 cycles.

[0053] 10) Add the remaining R-Elution+ to 2 mL of large-scale PCR mix, mix well, then add 10 mL of EM90 oil, vortex to mix and prepare emulsion.

[0054] 11) Aliquot the prepared emulsion into PCR tubes, 100 μL per tube, and perform PCR for 28 cycles. The program is: 95℃ for 2 min; 95℃ for 1 min, 60℃ for 1 min, 72℃ for 1 min, 25 cycles.

[0055] 12) Recovery of Amplified PCR Products: Remove the caps from four 8-tube PCR tubes and arrange them in a row with the openings facing the same side. Wrap cotton thread around one end of each PCR tube and place them into a 50mL centrifuge tube. Secure the other end of the thread to the centrifuge tube cap to prevent the PCR tubes from sinking to the bottom during centrifugation. Place the centrifuge tubes in an angle centrifuge with the PCR tube openings facing outwards and centrifuge at 2500–3000 rpm for 1 min. After centrifugation, when opening the centrifuge tube caps, hold the cotton thread to prevent the PCR tubes from sinking to the bottom and lift the thread to remove all the PCR tubes. Collect the emulsion product from all the PCR tubes at the bottom and pour it into a 15mL centrifuge tube. Repeat the centrifugation process, and aliquot all the PCR amplification products into two 15mL centrifuge tubes.

[0056] 13) Concentrating PCR products with n-Butanol: Divide the PCR product into two 15mL centrifuge tubes. Add 50-100μL of ultrapure water to each tube, then add 8mL of n-butanol to the remaining tube. Cap the tubes and invert them about 10 times to mix thoroughly. Centrifuge at 7500g for 10 minutes. After centrifugation, the solution will become clear and separate into layers. Aspirate the clear liquid at the top and the oily emulsion in the middle. Transfer the bottom layer of PCR amplification product to the corresponding 1.5mL centrifuge tube according to its volume. If the volume is greater than 150μL, it is recommended to add about 5 times the volume of n-butanol and invert to mix until the liquid becomes slightly turbid (do not allow the solution to become clear). Centrifuge at 12000rpm for 2 minutes, aspirate the n-butanol from the top layer, and concentrate the bottom PCR product to about 100μL.

[0057] 14) Single-strand preparation: Purification of amplification products with n-butanol: Collect all ePCR products in 15mL conical centrifuge tubes, add 2 volumes of n-butanol, and vortex to mix thoroughly; centrifuge at 9000rpm for 10 minutes at 25℃ using a benchtop centrifuge; discard the upper phase (n-butanol) to obtain concentrated PCR amplification products, add TBE / urea denaturing buffer at a volume ratio of 1:1, boil for 15 minutes to denature the DNA, then incubate on ice for 1 minute, and perform urea-denaturing polyacrylamide gel electrophoresis on all samples at 300V until bromophenol blue reaches the bottom of the gel, separating the elongated FAM-labeled strands from the reversed strands. The formulation of 7M urea-denaturing polyacrylamide gel is shown in Table 4.

[0058] 15) Gel extraction and recovery of FAM-labeled strands: Remove the gel and place it on a plastic film. Ex (nm): 495, Em (nm): 517 to detect the desired FAM-labeled ssDNA. Use a clean blade to cut the target band directly, transfer the gel strip to a 1.5 mL EP tube and crush it. Add 1 mL ddH2O and boil in a water bath for 10 minutes to transfer the ssDNA from the gel to the solution. Centrifuge to remove gel fragments and keep the supernatant. Purify the supernatant with n-butanol, using the same method as in 13. Dialyze the obtained DNA single strands overnight using a 3KD dialysis bag. This can then be used as the library for the next round of screening.

[0059] 16) The magnetic bead method is repeated for 11 rounds, with each operation using the secondary library obtained in the previous operation as the starting nucleic acid library. In this screening method, the screening pressure can be increased round by round to improve the enrichment of nucleic acid aptamers and shorten the screening process. Increasing the screening pressure includes reducing the amount of single-stranded DNA library used, the amount of target small molecules used, and the incubation time for both; increasing the washing time; increasing the number of washing cycles; and increasing the amount of reverse screening magnetic beads used.

[0060] Table 2. Screening conditions for paroxetine hydrochloride in 11 rounds

[0061]

[0062]

[0063] For the retention rates of paroxetine hydrochloride in each round of screening, please refer to [link to relevant data]. Figure 1 As shown.

[0064] Other reagent formulations

[0065] Table 3. ePCR mix formulation

[0066] reagents Total volume 1000μL <![CDATA[ddH2O]]> 866μL 10*pfu enzyme buffer 100μL dNTPmix(10mM) 20μL Forward primer Lib1S1-ployA-FAM (100 μM) 5μL Reverse primer Lib1A2 (100 μM) 5μL Pfu enzyme 4μL (500U)

[0067] Table 4. Formulation of modified polyacrylamide gel

[0068] Element Dosage Urea 3.78g 40% polyacrylamide 1.8mL 5*TBE 1.8mL <![CDATA[ddH2O]]> 2.25mL 10% APS 60μL TEMED 15μL

[0069] Aptamer selection and affinity testing

[0070] After cloning and sequencing analysis of the enriched library products, several sequences were selected and synthesized by Shanghai Sangon Biotech. Affinity was then tested; the methods for affinity testing are detailed in Examples 2 and 3. One sequence was identified as having strong binding ability and, after verification, showed ideal affinity for paroxetine hydrochloride; this sequence was named YSPLXT-Apt-011. The sequence and secondary structure prediction diagram of this nucleic acid aptamer are shown in [reference needed]. Figure 2 As shown.

[0071] YSPLXT-Apt-011:

[0072] SEQ ID No. 1:

[0073] TTCAGCACTCCACGCATAGCACCAGCCAAAGGATGGTGCGGCTAAGCTCCCCTTAGCCTATGCGTGCTACCGTGAA.

[0074] Example 2

[0075] Preliminary detection of monoclonal affinity by circular dichroism chromatography

[0076] Test method:

[0077] 1) Dilute paroxetine hydrochloride small molecules to 5 uM with DPBS and set aside. Dilute all monoclonal antibodies to 4 uM and set aside.

[0078] 2) Taking clone 11 as an example;

[0079] Experimental group: Take 100 μL of diluted paroxetine hydrochloride small molecule, add 100 μL of diluted monoclonal antibody, mix well and incubate for 30 min.

[0080] Control group: Take 100 μL of DPBS, add 100 μL of diluted monoclonal antibody, mix well and incubate for 30 min.

[0081] 3) Add the samples from the experimental group and the blank group to quartz cuvettes respectively, and detect the CD spectrum at a wavelength of 220-320nm.

[0082] See the experimental results. Figure 3 As can be seen, the peak height of the experimental group is significantly larger, which is speculated to be due to the small molecule binding with the aptamer to produce a new conformation, and the aptamer may have affinity.

[0083] Example 3

[0084] Isothermal titration microthermal analysis (ITC) to determine the affinity of monoclonal antibodies against paroxetine hydrochloride small molecules.

[0085] Experimental methods:

[0086] 1. Dilute 36.6 mmol paroxetine hydrochloride solution to 200 μM with DPBS. Dissolve monoclonal antibodies 3, 5, 11, 12, and 13 in DPBS to 10 μM and add 1% methanol to the solution. Finally, prepare DPBS buffer containing 1% methanol.

[0087] 2. After the instrument completes its self-test upon startup, select the automatic cleaning function for the titration needle and titration cell. After cleaning, titrate with ultrapure water to check the instrument's stability and the cleanliness of the titration needle and titration cell. Then, begin sample injection, titrating 280 μL of DPBS buffer containing 1% methanol with 60 μL of paroxetine hydrochloride solution to obtain control group data. Clean the titration needle and titration cell again, and inject samples, titrating 280 μL of monoclonal solutions 3, 5, 11, 12, and 13 containing 1% methanol with 60 μL of paroxetine hydrochloride solution to obtain experimental group data. The experimental titration method is as follows: the first drop is injected as 0.4 μL, and the subsequent 19 drops are injected as 3 μL each, with each injection lasting 20 seconds and an interval of 150 seconds between injections. After the experiment, clean the titration needle and titration cell and turn off the instrument.

[0088] 3. Data analysis was performed using MicroCal PEAQ-ITC Analysis Software. The experimental group data was subtracted from the control group data, and the final titration curve of paroxetine hydrochloride and DNA No. 11 was plotted. The area of ​​each exothermic peak was automatically integrated by the software to obtain the binding isotherm curve.

[0089] See results Figure 4 According to ITC verification, the affinity of the paroxetine hydrochloride aptamer reached 9.06 uM.

[0090] Example 4

[0091] ELISA experiments verified that the paroxetine hydrochloride small molecule nucleic acid aptamer can bind to paroxetine hydrochloride small molecule.

[0092] 1. Coupled ELISA plate

[0093] Add 100 μL of diluted SA protein (1 mg / mL) to each of the eight samples in a row of the microplate, and incubate at 37°C for twelve hours.

[0094] 2. Clean the ELISA plate

[0095] Rinse the microplate once with 0.05% PBST, let it stand for 2 minutes, being careful of any air bubbles remaining at the bottom during rinsing. After 2 minutes, tap the plate vigorously to remove as much water as possible and wash away any remaining solution. Repeat this process three times.

[0096] 3. Blocking the ELISA plate

[0097] Add 100 μL of 10 mg / mL BSA blocking buffer to each of the 12 wells coated with SA protein, and block at 37°C for 2 hours (if at 4°C, overnight blocking is required).

[0098] After sealing, repeat step 2 and rinse the ELISA plate three times with 0.05% PBST for later use.

[0099] 4. Library variational complexity

[0100] The target aptamer clone library was diluted to 400 nM and mixed with matching CS-bition primers for slow renaturation.

[0101] The reversion program was 95℃ for 10 min, 60℃ for 1 min, and finally cooled to 25℃ (at a rate of 0.1℃).

[0102] 5. Library Incubation

[0103] Add 100 μL / well of the renatured library directly to the microplate and incubate at room temperature with shaking for 1 hour. After blocking, repeat step 2 and wash the microplate three times with 0.05% PBST for later use.

[0104] 6. Target incubation

[0105] Add the target solutions diluted at eight different concentration gradients sequentially, row by row:

[0106] The concentrations were 1600 nM, 1400 nM, 1200 nM, 1000 nM, 800 nM, 600 nM, 400 nM, and 200 nM, respectively.

[0107] That is, A1-A8, incubate with shaking at room temperature for 1 hour.

[0108] 7. Quantitative Real-Time PCR

[0109] After completing step 6 of the incubation process, let the ELISA plate stand still, and then perform quantitative real-time PCR with 2+30μL per well, following the same procedure as step 8 in Example 1.

[0110] See the experimental results. Figure 5 .

[0111] See the results after linear fitting. Figure 6 The regression curve equation is: y = -196.66x + 2511.3R² = 0.997.

[0112] Example 5:

[0113] Application of paroxetine hydrochloride small molecule aptamers in chromatographic detection pretreatment

[0114] Instrument manufacturer: Waters Corporation

[0115] Specifications: IC

[0116] Test method:

[0117] YSPLXT-Apt-011 was used for biotin-enhanced modification (Anhui General Biotechnology). The modified sequence is as follows:

[0118] Biotin-AAAAAAAAAAAAAAAAAAAAAAAA-Spacer18-TTCAGCACTCCACGCATAGCACCAGCCAAAGGAT GGTGCGGCTAAGCTCCCCTTAGCCTATGCGTGCTACCGTGAA.

[0119] 2) Dissolution: Take out the modified primer powder synthesized by General Biotech and centrifuge at 12000 rpm for 10 min. Add DPBS buffer to dissolve, then dilute with DPBS to a final concentration of 1 uM 1000 μL, vortex to mix, and set aside for use.

[0120] 3) Refolding treatment: The diluted solution obtained in step 2 was dispensed into a PCR instrument for refolding. The PCR program was: 95℃ for 10 min, 4℃ for 5 min; thereby forming the aptamer into the desired structure.

[0121] 4) Pipette 1 mL of 10 mg / mL streptavidin magnetic beads (purchased from Invitrogen, Dynabeads) TM MyOne TM Carboxylic Acid (catalog number: 65001) was used to wash the magnetic beads four times with 1000 μL of DPBS each time. The beads were then hooked with a magnet to remove the supernatant. (During the final wash, the magnetic beads were temporarily stored in a small amount of DPBS to prevent them from drying out.) The resulting magnetic bead solution was then aliquoted into two portions: one 500 μL portion, labeled as the experimental group; and the other 500 μL portion, labeled as the control group, for later use.

[0122] 5) Add 1000 μL of the aptamer liquid obtained in step 3 after the renaturation process to the magnetic beads obtained in step 4, mix well, and shake on a rotary table at room temperature for 60 min.

[0123] 6) Washing and Adsorption: Using a magnet to hold the magnetic beads from the previous step, remove the supernatant and wash them again. Each time, add 1000 μL of wash buffer (DPBS) to the magnetic beads, mix at room temperature for 1 min, then hold the beads with a magnet, let them stand at room temperature for 1 minute, remove the supernatant, and repeat the washing operation 5 times. Finally, add 500 μL of DPBS and mix to bring the volume to a final level. To prevent inconsistent bead volume due to bead loss during washing, the control group magnetic beads were also washed 5 times with 500 μL of DPBS.

[0124] 7) Dilute paroxetine hydrochloride standard with DPBS to a concentration of 200 μM, 1000 μL, for later use.

[0125] 8) Take the control group magnetic beads and the magnet fishing magnetic beads obtained in step 6, remove the supernatant, add 500 μL of paroxetine hydrochloride standard diluted with DPBS, mix well, shake on a rotary shaker at room temperature for 20 min, remove the supernatant, and rinse the magnetic beads twice with 500 μL of DPBS. Simultaneously, add 500 μL of paroxetine hydrochloride standard diluted with DPBS to the experimental group magnetic beads obtained in step 6, mix well, shake on a rotary shaker at room temperature for 20 min, remove the supernatant, and rinse the magnetic beads twice with 500 μL of DPBS.

[0126] 9) Elute each of the magnetic beads obtained in the previous step with 200 μL of methanol. After mixing, incubate at room temperature for 10 min, then use a strong magnet to adsorb the magnetic beads, collect the supernatant, label it, and use a mass spectrometer to detect the content of paroxetine hydrochloride.

[0127] This embodiment utilizes paroxetine hydrochloride standards and paroxetine hydrochloride aptamer magnetic beads prepared using the aptamer from the previous embodiment for the enrichment and purification of paroxetine hydrochloride samples. The paroxetine hydrochloride retained by the aptamer binding on the magnetic beads was eluted with methanol, and the concentration of paroxetine hydrochloride was detected by mass spectrometry. The main purpose is to test the enrichment ability of the aptamer-magnetic bead complex, providing a template for future applications.

[0128] See chromatographic data Figure 7 and Figure 8 As can be seen, the magnetic beads in the control group adsorbed some paroxetine hydrochloride small molecules, with a response value of 84680, while the response value of the experimental group was 3176000, approximately 37 times that of the blank, showing a significant difference. This provides broad prospects for the application of mass spectrometry and chromatography.

[0129] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent changes made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and evolutions made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. A nucleic acid aptamer that specifically binds to small molecules of paroxetine hydrochloride, characterized in that, The nucleotide sequence of the nucleic acid aptamer is the nucleotide sequence shown in SEQ ID No.

1.

2. The nucleic acid aptamer that specifically binds to paroxetine hydrochloride small molecules according to claim 1, characterized in that, The nucleotide sequence of the nucleic acid aptamer contains base modifications and maintains affinity.

3. The nucleic acid aptamer that specifically binds to paroxetine hydrochloride small molecules according to claim 2, characterized in that, The base modification includes thiomodification, phosphorylation, methylation, amylation, thiolation, selenium-substituted oxygen modification, or isotope linkage modification.

4. The nucleic acid aptamer that specifically binds to paroxetine hydrochloride small molecules according to claim 1, characterized in that, The nucleotide sequence of the nucleic acid aptamer contains markers and maintains affinity.

5. The nucleic acid aptamer that specifically binds to paroxetine hydrochloride small molecules according to claim 4, characterized in that, The marker is a fluorescent marker, a radioactive marker, a biotin marker, a digoxigenin marker, a nanoluminescent material marker, a small peptide marker, an siRNA marker, or an enzyme marker.

6. The nucleic acid aptamer that specifically binds to paroxetine hydrochloride small molecules according to claim 1, characterized in that, The method for screening nucleic acid aptamers that specifically bind to paroxetine hydrochloride small molecules includes the following steps: 1) Mix the primers with the library, perform micro-renaturation of the library, and record the A260 data C1 using UV detection; 2) Wash the magnetic beads multiple times, add a small amount of the renatured library and the mixture, and detect the UV A260 value C2. Use the C2 / C1 value to determine the concentration of nucleic acids in the supernatant that are not immobilized on the magnetic beads to determine the immobilization efficiency of the library. 3) Cleaning, reverse screening, and forward screening; 4) Quantitative real-time PCR; 5) Amplified PCR products were recovered, and the PCR products were concentrated with n-butanol; 6) Single-chain preparation, and gel cleavage and recycling of FAM-labeled chains; 7) The magnetic bead method was repeated for 11 rounds, with the secondary library obtained in the previous operation as the starting nucleic acid library for each operation.

7. The nucleic acid aptamer that specifically binds to paroxetine hydrochloride small molecules according to claim 6, characterized in that, The primer is lib13-CS-biotin, and the nucleotide sequence of lib13-CS-biotin is shown in SEQ ID No.

5.

8. The application of nucleic acid aptamers that specifically bind to paroxetine hydrochloride in the preparation of kits for detecting paroxetine hydrochloride, characterized in that, The nucleic acid aptamer is the nucleic acid aptamer according to any one of claims 1-5.

Citation Information

Patent Citations

  • Nucleic acid aptamer combined with nucleocapsid protein of novel coronavirus SARS-CoV-2 and application of nucleic acid aptamer

    CN111748558A

  • Nucleic acid aptamer for specifically recognizing beta3 subunit protein of integrin and application of nucleic acid aptamer

    CN112877333A