A glycosyltransferase ugt91c1 mutant and a method for catalyzing synthesis of rebaudioside d

By mutating the glycosyltransferase UGT91C1 and combining it with sucrose synthase AtSUS, the problem of low yield of rebaudioside D was solved, and efficient catalytic synthesis of rebaudioside D was achieved, resulting in a significant increase in yield.

CN119931983BActive Publication Date: 2026-06-05DONGTAI HAORUI BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410682592.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-29
Publication Date
2026-06-05
Estimated Expiration
2044-05-29

AI Technical Summary

Technical Problem

The current technology yields low levels of rebaudioside D, which cannot meet the high market demand.

Method used

By mutating the glycosyltransferase UGT91C1, a UGT91C1 mutant with high activity and high catalytic rate was obtained. By combining it with sucrose synthase AtSUS, lebodiin D was synthesized using lebodiin A and UDPG as substrates, and UDPG was recycled through sucrose synthase AtSUS.

Benefits of technology

It significantly increased the yield of rebaudioside D, with the mutant 2-12E yielding nearly 30 times more than the wild type, achieving a catalytic efficiency of 94.2%, meeting market demand.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119931983B_ABST
    Figure CN119931983B_ABST
Patent Text Reader

Abstract

The application discloses a glycosyltransferase UGT91C1 mutant and a method for catalyzing synthesis of rebaudioside D, and belongs to biological catalytic synthesis. The glycosyltransferase UGT91C1 mutant is any one of the following (A)-(C): A) a protein obtained by making any one or more mutations in the amino acid sequence shown in SEQ ID NO. 1: the 89th amino acid is mutated from N to Y; the 155th amino acid is mutated from M to L; the 274th amino acid is mutated from S to T; and the 361st amino acid is mutated from N to S; (B) a protein having 95% or 98% or above identity with the amino acid sequence defined in (A) and having the same function; and (C) a fusion protein obtained by connecting a tag to the end of the protein defined in (A) or (B). The glycosyltransferase UGT91C1 mutant is obtained by mutation screening from a wild-type glycosyltransferase UGT91C1, has higher enzyme activity and catalytic rate, and can efficiently synthesize rebaudioside D by taking rebaudioside A as a substrate.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biocatalytic synthesis technology, and in particular to a glycosyltransferase UGT91C1 mutant and a method for catalyzing the synthesis of rebaudioside D. Background Technology

[0002] Rebaudioside D is a natural, non-nutritive sweetener, one of the many steviol glycosides found in stevia. It is extremely low in calories and very sweet. Compared to other steviol glycosides in stevia extract, such as rebaudioside A, rebaudioside D has a relatively higher sweetness and a less pronounced aftertaste, making it closer to the taste of sucrose.

[0003] In the food and beverage industry: As a zero-calorie sweetener, rebaudioside D is widely used in various low-calorie and sugar-free foods such as beverages, baked goods, candies, dairy products, jams, and condiments to reduce the sugar content of products without affecting their sweetness. Furthermore, because rebaudioside D does not raise blood sugar levels, it is particularly suitable for diabetics and consumers who need to control their blood sugar, making it an ideal sugar alternative. Simultaneously, with increasing consumer focus on healthy lifestyles, more and more low-sugar and low-fat products are using rebaudioside D as a sweetener source to meet market demand for low-calorie foods.

[0004] However, rebaudioside D is generally extracted from stevia leaves using separation and purification techniques. This method yields relatively low amounts of rebaudioside D, which cannot meet the high market demand. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a glycosyltransferase UGT91C1 mutant and a method for catalyzing the synthesis of rebaudioside D, in order to overcome the technical problem of low yield of rebaudioside D in the prior art.

[0006] In a first aspect, the present invention provides a glycosyltransferase UGT91C1 mutant, wherein the UGT91C1 mutant is any one of the following (A)-(C):

[0007] (A) A protein obtained by performing any one or more of the following mutations based on the amino acid sequence shown in SEQ ID NO.1:

[0008] The 89th amino acid is mutated from N to Y;

[0009] The 155th amino acid was mutated from M to L;

[0010] The 274th amino acid is mutated from S to T;

[0011] The 361st amino acid was mutated from N to S;

[0012] (B) is a protein that has 95% or 98% or more of the same amino acid sequence as defined in (A) and has the same function;

[0013] (C) A fusion protein obtained by attaching a tag to the end of the protein defined in (A) or (B).

[0014] Compared with existing technologies, the glycosyltransferase UGT91C1 mutant provided by this invention is obtained by mutation screening of wild-type glycosyltransferase UGT91C1. It has higher enzyme activity and catalytic rate. The optimal mutant 2-12E can convert 27.4 mM rebaudioside A into 25.8 mM rebaudioside D within 15 hours, with a rebaudioside A conversion rate of 94.2%, which greatly improves the yield of rebaudioside D.

[0015] Furthermore, the amino acid sequence of the glycosyltransferase UGT91C1 mutant is shown in SEQ ID NO.3.

[0016] In a second aspect, the present invention provides a biomaterial comprising any one of the following:

[0017] (A) An expressed gene that encodes the above-mentioned glycosyltransferase UGT91C1 mutant;

[0018] (B) A recombinant plasmid containing the expression gene described in (A);

[0019] (C) A recombinant cell containing the above-mentioned recombinant plasmid or the gene expressing the glycosyltransferase UGT91C1 mutant.

[0020] The above-mentioned expressed gene is obtained by one or more of the following mutations in SEQ ID NO.2:

[0021] In SEQ ID NO.2, bits 265-267 are replaced with TAT instead of AAC;

[0022] In SEQ ID NO.2, bits 463-465 are replaced with TTG;

[0023] Bits 820-822 of SEQ ID NO.2 are replaced with ACG by TCC;

[0024] In SEQ ID NO.2, bits 1081-1083 are replaced with AGC instead of AAC;

[0025] Preferably, the nucleotide sequence of the expressed gene is shown in SEQ ID NO.4.

[0026] Thirdly, the present invention provides an enzyme composition comprising the above-mentioned glycosyltransferase UGT91C1 mutant and sucrose synthase AtSUS;

[0027] Sucrose synthase AtSUS is either (B1) or (B2) as follows: The amino acid sequence of (B1) is shown in SEQ ID NO.5;

[0028] Proteins that have 95% or 98% or more of the same amino acid sequence as (B1) and have the same function.

[0029] Fourthly, the present invention provides a complete set of recombinant strains for use in the above-mentioned enzyme composition, comprising recombinant strain A and recombinant strain B:

[0030] Recombinant strain A contains the aforementioned recombinant plasmid;

[0031] The recombinant strain B contains recombinant plasmid B, which is obtained by constructing the encoding gene of sucrose synthase AtSUS into a plasmid; the encoding gene of AtSUS is shown in SEQ ID NO.6.

[0032] Furthermore, the host bacteria include, but are not limited to, Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris, or Corynebacterium glutamicum.

[0033] Fifthly, the present invention provides a method for synthesizing rebaudioside D using a glycosyltransferase UGT91C1 mutant, comprising the following steps:

[0034] Add rebaudioside A, UDPG, sucrose, and the enzyme combination or the induced expression enzyme product of the above-mentioned recombinant strain to the catalytic reaction system. After the reaction is completed, inactivate the enzyme, centrifuge, and collect the supernatant, which contains rebaudioside D.

[0035] Compared with existing technologies, the glycosyltransferase UGT91C1 mutant can catalyze the synthesis of rebaudioside D and UDP via glycosylation using rebaudioside A and UDPG as substrates, while sucrose synthase AtSUS can catalyze the reaction of UDP and sucrose to produce UDPG and fructose. Therefore, this invention uses rebaudioside A, UDPG, and sucrose as substrates, and employs a two-enzyme coupling catalytic reaction of the glycosyltransferase UGT91C1 mutant and sucrose synthase AtSUS. On the one hand, the activity of the glycosyltransferase can be indirectly measured by quantitative analysis of the reaction product fructose, thereby screening for the glycosyltransferase UGT91C1 mutant with higher catalytic activity. On the other hand, the introduction of sucrose synthase AtSUS enables the recycling and regeneration of UDPG, further increasing the yield of rebaudioside D.

[0036] Furthermore, the inducible expression enzyme products of the above-mentioned complete set of recombinant strains include inducible expression enzyme product A and inducible expression enzyme product B;

[0037] The method for obtaining the induced expression enzyme product A is as follows:

[0038] The seed culture of the above recombinant strain A was inoculated into a culture medium containing kanamycin sulfate, and the OD of the culture medium was measured. 600 When the concentration reaches 0.6-0.8, add isopropyl-β-D-thiogalactoside to induce culture for 8-40 h. Centrifuge and collect the bacterial cells. Add lysozyme solution to the bacterial cells to disrupt the cells or sonicate to disrupt the cells. Centrifuge and collect the supernatant, which is the induced expression enzyme product A. The final concentration of kanamycin sulfate is 10-100 μg / mL. The final concentration of isopropyl-β-D-thiogalactoside is 0.01-1 mM.

[0039] The method for obtaining the induced expression enzyme product B is as follows:

[0040] The seed culture of the above recombinant strain B was inoculated into a culture medium containing kanamycin sulfate and cultured at 25-40℃ and 200-300 r / min until OD. 600 When the concentration reaches 0.6-0.8, L-arabinose is added and the culture is continued for 8-40 hours. The cells are then centrifuged and collected. Lysozyme solution is added to the cells to break them up or the cells are broken up by sonication. The cells are then centrifuged again and the supernatant is collected as the induced expression enzyme product B. The final concentration of kanamycin sulfate is 10-100 μg / mL, and the final concentration of L-arabinose is 0.1-15 mM.

[0041] Furthermore, the concentration of rebaudioside A in the catalytic reaction system is 5~100mM, the concentration of UDPG is 0.1~5mM, the concentration of sucrose is 40~800 mM, the amount of induced expression enzyme product A added is 0.1~50 mL, and the amount of induced expression enzyme product B added is 0.1~50 mL.

[0042] Furthermore, the pH value of the catalytic reaction system is 5.0~8.0, the temperature is 25~60℃, and the reaction time is 5~30h. Attached Figure Description

[0043] Figure 1 To determine the yield of rebaudioside D (RD) under the catalysis of different glycosyltransferase UGT91C1 mutants.

[0044] Figure 2 The yield of rebaudioside D (RD) varies with conversion time. Detailed Implementation

[0045] To make the technical problems to be solved, the technical solutions, and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are only for explaining the present invention and are not intended to limit the present invention.

[0046] It should be understood that, unless otherwise specified, all materials used in the following embodiments are commercially available materials.

[0047] Example 1

[0048] Construction of recombinant E. coli AtSUS expressing sucrose synthase AtSUS

[0049] Using Inf-pYB1k-atsus-F and Inf-pYB1k-atsus-R as primers and Arabidopsis thaliana sucrose synthase AtSUS cDNA as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) to obtain the correct atsus gene fragment. The atsus gene fragment is shown in SEQ ID NO.6, and the amino acid sequence of sucrose synthase AtSUS is shown in SEQ ID NO.5.

[0050] Inf-pYB1k-atsus-F: GCTAACAGGAGGAATTAACCATGGAAAATAAAACGGAGACC (SEQ IDNO.7)

[0051] Inf-pYB1k-atsus-R: CCAGATCTACCCTCGAGTTACAACGATGAAATGTAAGAAAC (SEQ IDNO.8)

[0052] The atsus gene fragment was ligated into the expression vector pYB1k using the Gibson assembly method to obtain the expression vector pYB1k-atsus.

[0053] Using pYB1k-F and pYB1k-R as primers and the empty pYB1k vector as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) to obtain the correct pYB1k expression vector fragment. (You R, Wang L, Shi C, Chen H, Zhang S, Hu M, Tao Y. Efficient production of myo-inositolin Escherichia coli through metabolic engineering. Microb. Cell Fact. 2020May 24;19(1):109. This pYB1k vector has been disclosed.)

[0054] pYB1k-F: CTCGAGGGTAGATCTGGTAC (SEQ ID NO.9)

[0055] pYB1k-R:GGTTAATTCCTCCTGTTAGC (SEQ ID NO.10)

[0056] The above-mentioned atsus gene fragment and pYB1k expression vector fragment were ligated using the Gibson assembly method.

[0057] Escherichia coli DH5α competent cells were prepared using the CaCl2 method (Beijing TransGen Biotech Co., Ltd.). The Gibson ligation product was added to the DH5α competent cells and reacted on ice for 30 min, then in a 42°C water bath for 90 s, followed by 2 min on ice. Then, 1 mL of LB medium was added, and the cells were incubated at 37°C in a shaker for 1 h. Finally, the cells were plated on LB agar plates containing kanamycin and incubated overnight at 37°C.

[0058] Multiple single-clone strains were selected for culture and PCR verification was performed using primers pBAD-F and atsus-F300-R. Positive clones with the correct target sequence size were selected for culture, and plasmids were extracted. The obtained positive clone plasmids were named pYB1k-atsus.

[0059] pBAD-F: GATTATTTGCACGGCGTCAC (SEQ ID NO. 11)

[0060] atsus-F300-R: CTTGTGGGTCGTTGTCGAGGATG (SEQ ID NO.12)

[0061] Escherichia coli BW25113 competent cells were prepared using the CaCl2 method. The recombinant expression vector pYB1k-atsus was transformed into the E. coli BW25113 competent cells, and the cells were then plated on LB agar plates containing kanamycin and incubated overnight at 37°C. Positive clones containing pYB1k-atsus were selected and named AtSUS.

[0062] Example 2

[0063] Construction of recombinant Escherichia coli UGT91C1 expressing wild-type glycosyltransferase UGT91C1

[0064] Using ugt91c1-F and ugt91c1-R as primers, and the cDNA of glycosyltransferase UGT91C1 from wild-type rice (Oryza sativa) as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct ugt91c1 gene fragment.

[0065] ugt91c1-F:

[0066] CTTTAAGAAGGAGATATACCATGGATTCGGGTTACTCTTCC (SEQ ID NO.13)

[0067] ugt91c1-R:

[0068] CTTGTCGACGGAGCTCGAATTCTTAGTCTTTATAGCTACGGAG (SEQ ID NO.14)

[0069] Using pET28a-F and pET28a-R as primers and the empty pET28a vector as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct pET28a expression vector fragment. (PeiWang, Hai-Yan Zhou, Bo Li, Wen-Qing Ding, Zhi-Qiang Liu, Yu-Guo Zheng, Multiple modification of Escherichia coli for enhanced β-alanine biosynthesis through metabolic engineering, Bioresource Technology, Volume 342)

[0070] The pET28a vector was disclosed in 2021, 126050.

[0071] pET28a-F:GAATTCGAGCTCCGTCGACAAG (SEQ ID NO. 15)

[0072] pET28a-R: GGTATATCTC CTTCTTAAAG (SEQ ID NO. 16)

[0073] The above-mentioned ugt91c1 gene fragment and pET28a expression vector fragment were ligated using the Gibson assembly method.

[0074] Escherichia coli DH5α competent cells were prepared using the CaCl2 method (Beijing TransGen Biotech Co., Ltd.). Gibson ligation products were added to the DH5α competent cells and reacted on ice for 30 min, then in a 42 °C water bath for 90 s, followed by 2 min on ice. Then, 1 mL of LB medium was added, and the cells were incubated at 37 °C in a shaker for 1 h. Finally, the cells were plated on LB agar plates containing kanamycin and incubated overnight at 37 °C.

[0075] Multiple single-clone strains were selected for culture and PCR verification was performed using primers T7-F and ugt91c1-F300-R. Positive clones with the correct target sequence size were selected for culture, and plasmids were extracted. The obtained positive clone plasmids were named pET28a-ugt91c1.

[0076] T7-F: TAATACGACTCACTATAGGG (SEQ ID NO.17)

[0077] ugt91c1-F300-R:GGCGGTGCAGTTCAACCATG (SEQ ID NO.18)

[0078] After preparing E. coli BL21(DE3) competent cells using the CaCl2 method, the recombinant expression vector pET28a-ugt91c1 was transformed into the E. coli BL21(DE3) competent cells, which were then plated on LB agar plates containing kanamycin and incubated overnight at 37°C. Positive clones containing pET28a-ugt91c1 were selected and named recombinant E. coli UGT91C1.

[0079] Example 3

[0080] Construction of a library of glycosyltransferase UGT91C1 mutants

[0081] UGT91C1 was randomly mutated using error-prone PCR. Primers ugt91c1-ATG-F and ugt91c1-TAA-R were used, and the pET28a-ugt91c1 plasmid was used as a template. ep-PCR amplification was performed using rTaq DNA polymerase (TAKARA). The amplification system and procedure are shown in Tables 1 and 2.

[0082] ugt91c1-ATG-F: ATGGCCGAAAACAAGACCGA (SEQ ID NO.19)

[0083] ugt91c1-TAA-R:TTACAAAGAGGAAATGTAAG (SEQ ID NO.20)

[0084] Table 1 Error-prone PCR amplification systems

[0085]

[0086] Table 2 Commonly Misunderstood PCR Amplification Procedures

[0087]

[0088] After purification of the PCR product, the mutant gene fragment of UGT91C1 was obtained. These fragments were then ligated to the vector pET28a using the Gibson seamless ligation kit to obtain a complete plasmid mutant library containing the UGT91C1 mutant gene. The Gibson ligation reaction system is shown in Table 3.

[0089] Table 3 Gibson linkage reaction system

[0090]

[0091] After reacting in a 50℃ water bath for 1 h, the plasmid containing the UGT91C1 mutant gene was transferred to *E. coli* DH5α competent cells and cultured. The cells were then incubated in a shaker for 1 h, and after incubation, plated onto agar plates and incubated at 37℃ for 12 h. Once colonies grew, five single-clone strains were randomly selected, and their plasmids were extracted and sequenced. Subsequently, colonies on the plates were scraped with a glass rod to extract plasmids, yielding a plasmid mutant library, which was stored at -20℃ for subsequent high-throughput screening of the mutant library.

[0092] Example 4

[0093] High-throughput screening of superior mutants

[0094] After the random mutant library was constructed, single colonies were picked from the plate using a toothpick sterilized by high temperature and autoclave, and inoculated into a 96-well plate containing 800 μL of LB medium (containing kanamycin sulfate). The seed culture was obtained by shaking in a 96-well plate at 37°C and 900 rpm for 24 h.

[0095] Dip the inoculation needle into the seed culture and transfer it to a new 96-well LB medium containing kanamycin sulfate (final concentration 50 μg / mL). Incubate at 37°C and 900 rpm until the OD of the culture medium is measured. 600 When the cytoplasmic reticulum reached 0.6–0.8, isopropyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 0.4 mM. The cells were then induced and cultured in a 96-well plate at 30°C and 900 rpm for 22 h. After induction, the cells were collected by centrifugation at 3000 × g for 20 min. Lysozyme solution was added to each well and mixed thoroughly to allow the lysozyme to fully act on the cells, lysing them and releasing the intracellular enzyme. After cell lysis, the cells were centrifuged at 4°C and 3000 × g for 20 min in a refrigerated centrifuge to obtain the glycosyltransferase UGT91C1 mutant enzyme solution.

[0096] Preparation of AtSUS enzyme solution: The seed culture of recombinant *E. coli* AtSUS was collected using an inoculation needle and transferred to an Erlenmeyer flask containing 10 mL of LB medium, which also contained kanamycin sulfate (final concentration 50 μg / mL). The flask was incubated at 37℃ and 220 r / min in a shaker. When the OD... 600 When the concentration reaches 0.6-0.8, L-arabinose with a final concentration of 1 mM is added, and the cells are cultured at 30℃ and 220 r / min for another 22 h. After centrifugation, the cells are collected and then sonicated to disrupt the cell structure. After centrifugation at 5000×g for 5 min, the sucrose synthase AtSUS enzyme solution is obtained.

[0097] The reaction system consisted of 7 mM rebaudioside A, 42 mM sucrose, 1.6 mM UDPG, 0.16 mL AtSUS enzyme solution, 0.16 mL of glycosyltransferase UGT91C1 mutant enzyme solution and wild-type UGT91C1 enzyme solution, mixed with 100 mM sodium phosphate buffer. The reaction was incubated in a water bath at 37°C for 6 h, then terminated by heating for 5 min. The pH of the reaction system was 8.

[0098] DNS assay: The reaction product was centrifuged at 3000×g for 20 min at 4°C in a refrigerated centrifuge, and the supernatant was collected. 70 μL of the supernatant and 210 μL of DNS were added to a clean 96-well plate, mixed, and heated for 5 min to develop the DNS colorimetric reaction. After cooling to room temperature, the plate was centrifuged at 3000×g for 18 min. 200 μL of the supernatant was transferred to a 96-well microplate, and the OD value was measured using a microplate reader. 540 Numerical value. OD 540 The UGT91C1 mutant used in the reaction solution with the high value is the mutant with high activity, and it is then retested in a vial.

[0099] Small-bottle validation: OD was obtained after screening with a 96-well plate. 540 After obtaining mutants with high OD values, single colonies of the mutant, wild-type UGT91C1, and recombinant Escherichia coli AtSUS were picked and inoculated into test tubes, respectively. The tubes were then incubated in a shaker at 37°C and 220 rpm for 12 h to obtain seed culture. The seed culture was then inoculated into 20 mL LB medium (containing kanamycin sulfate at a final concentration of 50 μg / mL) at a 1% volume ratio, and incubated again at 37°C and 220 rpm until OD values ​​were obtained. 600When the pH was 0.6-0.8, IPTG was added to the culture medium of mutant and wild-type UGT91C1 to a final concentration of 0.4 mM for induction, while L-arabinose was added to the culture medium of AtSUS to a final concentration of 1 mM for induction. All three were cultured at 30℃ and 220 rpm for 15 h. After the culture was completed, the bacterial cells were collected by centrifugation (5000×g for 10 min), and the cells were resuspended in 0.51 mL of 100 mM pH 8.0 sodium phosphate buffer. After disruption and centrifugation, UGT91C1 mutant enzyme solution, wild-type UGT91C1 enzyme solution, and sucrose synthase AtSUS enzyme solution were obtained.

[0100] The reaction system in vials consisted of: 8 mM rebaudioside A, 48 mM sucrose, 1.6 mM UDPG, 0.5 mL UGT91C1 mutant enzyme solution or wild-type UGT91C1 enzyme solution, 0.2 mL AtSUS enzyme solution, and 100 mM sodium phosphate buffer to a final volume of 10 mL. The pH of the reaction system was 8. The reaction was carried out in a water bath at 37°C for 6 h, then stopped by boiling for 5 min. The mixture was centrifuged at 10000×g for 2 min, and the supernatant was used for the DNS reaction. The OD was then analyzed. 540 The yield of rebaudioside D was verified by HPLC analysis of the reaction solution catalyzed by the mutant with a higher value than that of wild-type UGT91C1.

[0101] Filtering results:

[0102] After multiple screenings of the UGT91C1 mutant library, the inventors ultimately obtained seven superior mutants from nearly 500,000 mutants. These mutants all exhibited higher enzyme activities than the wild type, significantly improving the efficiency of catalyzing the synthesis of rebaudioside D from rebaudioside A. The yield results of rebaudioside D are shown below. Figure 1 As shown in the figure. Among them, the yield of rebaudioside D in the optimal mutant 2-12E was nearly 30 times higher than that in the wild type. Sequencing revealed that the amino acid sequence of mutant 2-12E was obtained by mutating amino acid N to Y at position 89, amino acid M to L at position 155, amino acid S to T at position 274, and amino acid N to S at position 361, based on the amino acid sequence shown in SEQ ID NO.1.

[0103] Example 5

[0104] Scale-up study of the synthesis of rebaudioside D by the optimal mutant 2-12E

[0105] Seed cultures of mutant 2-12E and sucrose synthase AtSUS were inoculated separately into 400 ml LB medium (containing kanamycin sulfate at a final concentration of 50 μg / mL) at a volume ratio of 1%, and cultured at 37°C with shaking at 220 rpm until OD was obtained. 600When the pH was 0.6-0.8, two culture media were sequentially induced with IPTG to a final concentration of 0.4 mM and L-arabinose to a final concentration of 1 mM, respectively, and cultured at 30℃ and 220 rpm for 15 h. After the culture was completed, the bacterial cells were collected by centrifugation (5000×g for 10 min), resuspended in 10.5 mL of 100 mM pH 8.0 sodium phosphate buffer, and then the bacterial cells were lysed and centrifuged to obtain UGT91C1 mutant 2-12E enzyme solution and sucrose synthase AtSUS enzyme solution.

[0106] The reaction system was as follows: Rebaudioside A 27.4 mM, sucrose 164.4 mM, UDPG 1 mM, AtSUS enzyme solution 10 mL, 2-12E enzyme solution 10 mL, and 100 mM sodium phosphate buffer to a final volume of 100 mL. Reaction conditions: pH 8, reaction at 37℃ for 15 h.

[0107] The reaction solution was sampled every 4 hours, and the yield of rebaudioside D was analyzed by HPLC as a function of conversion time. The results are as follows: Figure 2 As shown, the optimal mutant 2-12E can convert 27.4 mM rebaudioside A into 25.8 mM rebaudioside D within 15 h, with a RA conversion rate of 94.2%.

[0108] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A glycosyltransferase UGT91C1 mutant, characterized in that, The UGT91C1 mutant is any one of the following (A)-(B): (A) The protein obtained by making the following mutations based on the amino acid sequence shown in SEQ ID NO.1: The 89th amino acid is mutated from N to Y; The 155th amino acid was mutated from M to L; The 274th amino acid is mutated from S to T; The 361st amino acid was mutated from N to S; (B) A fusion protein obtained by attaching a tag to the end of the protein defined in (A).

2. The glycosyltransferase UGT91C1 mutant according to claim 1, characterized in that, The amino acid sequence of the UGT91C1 mutant is shown in SEQ ID NO.

3.

3. A biomaterial, characterized in that, The biomaterial includes any one of the following: (A) An expression gene encoding a mutant of the glycosyltransferase UGT91C1 as described in claim 1 or 2; (B) A recombinant plasmid containing the expression gene described in (A); (C) A recombinant cell containing the recombinant plasmid or the gene expressing the glycosyltransferase UGT91C1 mutant.

4. An enzyme composition, characterized in that, The enzyme composition comprises the glycosyltransferase UGT91C1 mutant as described in claim 1 or 2 and sucrose synthase AtSUS; The amino acid sequence of the sucrose synthase AtSUS is shown in SEQ ID NO.

5.

5. A complete recombinant bacterial strain for expressing the enzyme composition of claim 4, characterized in that, The complete set of recombinant strains includes recombinant strain A and recombinant strain B: The recombinant strain A contains the recombinant plasmid as described in claim 3; The recombinant strain B contains recombinant plasmid B, which is obtained by constructing the encoding gene of sucrose synthase AtSUS into a plasmid.

6. The complete set of recombinant strains according to claim 5, characterized in that, The host bacteria include, but are not limited to, Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris, or Corynebacterium glutamicum.

7. A method for synthesizing rebaudioside D using a glycosyltransferase UGT91C1 mutant, characterized in that, Includes the following steps: Rebaudin A, UDPG, sucrose, and the enzyme composition of claim 4 or the induced expression enzyme product of the complete set of recombinant strains in claim 5 are added to the catalytic reaction system. After the reaction is completed, the enzyme is inactivated, centrifuged, and the supernatant is collected. The supernatant contains rebaudin D.

8. The method according to claim 7, characterized in that, The inducible expression enzyme products of the complete set of recombinant strains in claim 5 include inducible expression enzyme product A and inducible expression enzyme product B; The method for obtaining the induced expression enzyme product A is as follows: The seed culture of recombinant strain A from claim 5 was inoculated into a culture medium containing kanamycin sulfate, and the OD of the culture medium was... 600 When the concentration reaches 0.6-0.8, add isopropyl-β-D-thiogalactoside to induce culture for 8-40 h. Centrifuge and collect the bacterial cells. Add lysozyme solution to the bacterial cells to disrupt the cells or sonicate to disrupt the cells. Centrifuge and collect the supernatant, which is the induced expression enzyme product A. The final concentration of kanamycin sulfate is 10-100 μg / mL. The final concentration of isopropyl-β-D-thiogalactoside is 0.01-1 mM. The method for obtaining the induced expression enzyme product B is as follows: The seed culture of recombinant strain B from claim 5 was inoculated into a culture medium containing kanamycin sulfate and cultured at 25-40°C and 200-300 rpm until OD. 600 When the concentration reaches 0.6-0.8, L-arabinose is added and the culture is continued for 8-40 hours. The cells are then centrifuged and collected. Lysozyme solution is added to the cells to break them up or the cells are broken up by sonication. The cells are then centrifuged again and the supernatant is collected as the induced expression enzyme product B. The final concentration of kanamycin sulfate is 10-100 μg / mL, and the final concentration of L-arabinose is 0.1-15 mM.

9. The method according to claim 7 or 8, characterized in that, In the catalytic reaction system, the concentration of rebaudioside A is 5-100 mM, the concentration of UDPG is 0.1-5 mM, the concentration of sucrose is 40-800 mM, the amount of induced expression enzyme product A added is 0.1-50 mL, and the amount of induced expression enzyme product B added is 0.1-50 mL.

10. The method according to claim 7 or 8, characterized in that, The catalytic reaction system has a pH of 5.0 to 8.0, a temperature of 25 to 60°C, and a reaction time of 5 to 30 hours.

Citation Information

Patent Citations

  • Glycosyl transferase mutant and method for catalytically synthesizing rebaudioside M by using glycosyl transferase mutant

    CN113462670A

  • Non-caloric sweetener

    US20150315623A1