Molecular breeding method for creating new germplasm of wheat with high resistance to scab, stripe and leaf rust
By hybridizing wheat and creating DH lines, new wheat germplasm carrying the QTGW/KL/KW-1A and QFhb-2DL genes was screened, solving the problems of homogenization of wheat breeding materials and insufficient disease resistance, and achieving a breakthrough in disease resistance breeding of wheat in the middle and lower reaches of the Yangtze River and the upper reaches.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- JIANGSU LIXIAHE REGION AGRI RES INST
- Filing Date
- 2024-10-28
- Publication Date
- 2026-06-26
AI Technical Summary
Existing technologies make it difficult to effectively utilize the Fusarium head blight resistance resources of closely related wheat species, resulting in severe homogenization of breeding materials and a lack of effective breeding methods to achieve breakthroughs in breeding wheat resistant to Fusarium head blight and stripe rust in the middle and upper reaches of the Yangtze River.
By selecting wheat varieties carrying candidate genes for resistance to Fusarium head blight, such as QTGW/KL/KW-1A and QFhb-2DL, for grain weight/length/width loci, and hybridizing them, DH lines were created. Disease resistance was identified and agronomic traits were investigated. New wheat germplasm that is resistant to stripe rust, leaf rust, and Fusarium head blight in both regions and whose agronomic traits are adapted to local needs was screened out.
This has achieved a breakthrough in disease-resistant breeding of wheat in the middle and lower reaches of the Yangtze River and the upper reaches, enriched the genetic basis of modern wheat, improved the disease resistance and yield traits of breeding materials, and alleviated the problem of homogenization in breeding.
Smart Images

Figure CN119955963B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of wheat molecular breeding technology and relates to a molecular breeding method for creating new wheat germplasm with high resistance to Fusarium wilt, stripe rust and leaf rust. Background Technology
[0002] Discovering superior wheat resources resistant to Fusarium head blight, elucidating the molecular regulatory mechanisms of genes with significant value for Fusarium head blight resistance, innovating breeding approaches and technical systems for wheat resistance to Fusarium head blight, cultivating groundbreaking wheat varieties (lines) resistant to Fusarium head blight, and creating new germplasm sources resistant to Fusarium head blight are of great significance for improving the overall level of wheat breeding for resistance to Fusarium head blight in my country and enhancing the core competitiveness of my country's seed industry.
[0003] The collection, identification, and application of wheat germplasm resources resistant to Fusarium head blight have been carried out both domestically and internationally for a long time, mainly exploring resistance sources from three types of wheat materials. The first is germplasm resistant to Fusarium head blight discovered from closely related wheat species. Due to the long-term use of a few core parents during artificial domestication and the bottleneck of polyploidization, the genetic base of common wheat varieties has become increasingly narrow, and the breeding parent materials are highly homogenized. To enrich the current genetic base of wheat resistance to Fusarium head blight, exploring closely related or distantly related wheat species with good resistance to Fusarium head blight is a very effective approach. Examples include *Leymus chinensis* (Kong Lingna et al., 2009; Luo Yuechuan et al., 2021; Song et al., 2023), *Leymus chinensis* (Wang Linsheng et al., 2019), the small fragment translocation line of wheat-rye 1RS-1BS / 1BL (Lü Tingting et al., 2020), *Leymus chinensis* (Wang Yi et al., 2008), and *Leymus chinensis* (Zhang Xiaojun et al., 2020). 0) *Triticum aestivum* (Guo et al., 2015; Zhang et al., 2016), but because these resistance sources are difficult to hybridize with wheat, even if a foreign homologous chromosome (or fragment) carrying the resistance gene is introduced into the wheat background, it usually does not recombine with the wheat chromosome. The foreign chromosome fragment may also contain genes that are unfavorable for breeding, causing linkage redundancy. The offspring have poor agronomic traits such as plant height, spike number, and grain weight, resulting in low yield, and therefore low utilization efficiency (Hao et al., 2020). Synthetic wheat is formed by crossing tetraploid wheat (AABB) and diploid jointed wheat (DD) from secondary gene sources and doubling the chromosomes. Its genome composition is consistent with that of common wheat. The foreign genes (alleles) in synthetic wheat can be introduced into diseased wheat through homologous recombination, making it easier to utilize. Furthermore, synthetic wheat possesses advantages such as resistance to stripe rust, leaf rust, strong tillering, and large ears and grains. Its disease-resistant and high-yielding loci have been successfully transferred to wheat breeding (Wan et al., 2015; Gaurav et al., 2022). Currently, there is a lack of effective breeding methods to achieve breakthroughs in breeding wheat for resistance to Fusarium head blight and stripe and leaf rust in the middle and upper reaches of the Yangtze River. Summary of the Invention
[0004] To address the aforementioned problems, this invention provides a molecular breeding method for creating new wheat germplasm highly resistant to Fusarium head blight, stripe rust, and leaf rust. First, artificially synthesized wheat families that have been identified over many years and at multiple locations as resistant to Fusarium head blight, stripe rust, and leaf rust, exhibiting strong tillering, large ears and large grains, and excellent agronomic traits are selected. These families are then combined with loci carrying grain weight / grain length / grain width loci. QTGW / KL / KW-1A Synergistic allelic variation and QFhb-2DL Wheat varieties with candidate genes for resistance to Fusarium head blight were hybridized, and then DH lines were created. Disease resistance identification and agronomic trait investigation were carried out. Through shuttle breeding, new wheat germplasm or new materials that are resistant to stripe rust, leaf rust, and Fusarium head blight in both regions and whose agronomic traits are adapted to local needs were finally screened out, achieving a breakthrough in disease resistance breeding of wheat in the middle and lower reaches of the Yangtze River and the upper reaches.
[0005] To achieve the above objectives, the present invention provides a molecular breeding method for creating new wheat germplasm highly resistant to Fusarium wilt, stripe rust, and leaf rust, comprising the following steps:
[0006] Step S1: Collect wheat varieties from the upper and lower reaches of the Yangtze River, using grain weight / grain length / grain width loci. QTGW / KL / KW-1A and QFhb-2DL Molecular marker detection of candidate genes for resistance to Fusarium head blight revealed loci carrying grain weight / grain length / grain width. QTGW / KL / KW-1A Synergistic allelic variation and QFhb-2DL Candidate genes for resistance to Fusarium head blight, as chassis varieties;
[0007] Three years of Fusarium head blight resistance testing was conducted on jointed wheat germplasm. Jointed wheat 18 was found to be resistant to Fusarium head blight, stripe rust, and leaf rust, and exhibited strong tillering; jointed wheat 462 was found to be resistant to stripe rust and leaf rust, and exhibited large ears and large grains. Two synthetic wheat varieties, LM / Jointed Wheat 462 and LM / Jointed Wheat 18, were created using tetraploid durum wheat LM, Jointed Wheat 18, and Jointed Wheat 462. Inoculation tests showed that LM / Jointed Wheat 18 exhibited resistance to Fusarium head blight, indicating that the Fusarium head blight resistance gene of Jointed Wheat 18 can be found in hexaploid wheat. Stable expression was achieved; therefore, a recombinant inbred line population F8 of (LM / Jointed Wheat 18) × (LM / Jointed Wheat 462) was constructed. After identification of Fusarium head blight single flower drip phenotype, stripe rust and leaf rust identification, and agronomic trait investigation, the families in (LM / Jointed Wheat 18) × (LM / Jointed Wheat 462) RIL that were resistant to Fusarium head blight, stripe rust and leaf rust, had strong tillering, large ears and large grains and excellent agronomic traits were identified. Using these excellent families as donors, hybrids were obtained by crossing them with the core parent chassis varieties.
[0008] Step S2: F0 is planted into F1, corn pollen is induced, haploid plants are rescued from the embryos, chromosome doubling is performed using colchicine, and the plants are cultured in an artificial climate chamber to obtain DH line seeds the following year.
[0009] Step S3: Cultivate DH line in greenhouse. When seedlings emerge, extract DNA from leaves and utilize grain weight / grain length / grain width loci. QTGW / KL / KW-1A and QFhb-2DL Linkage marker detection of candidate genes for resistance to Fusarium head blight was performed on DH single plants. DH single plants that were positive (homozygous) at both loci were selected, and seeds of the positive single plants were harvested.
[0010] Step S4: Select DH series seeds by planting in large fields in Pixian County, Chengdu, Sichuan Province and Wantou, Yangzhou, Jiangsu Province. Plant each series in 3 rows. During the seedling stage, assess tillering ability, resistance to stripe rust, and resistance to leaf rust, and eliminate DH series with poor tillering ability compared to Yangmai 25 and poor resistance to stripe rust and leaf rust compared to Chuannong 32. During the mature plant stage, assess resistance to Fusarium head blight at the heading and flowering stages, and eliminate DH series with heading and flowering stages later than Yangmai 25. At the flowering stage, spray the rows of DH series with Fusarium head blight spore solution to assess Fusarium head blight resistance, and eliminate DH series with a Fusarium head blight infection rate ≥5%. At the flowering stage, perform single-flower drip inoculation with Fusarium head blight pathogen, retain DH series with the assessment result of "high resistance", and harvest the selected DH series seeds.
[0011] Step S5: Plant the DH lines selected in Chengdu and Yangzhou the previous year in large fields in Pixian County, Chengdu, Sichuan Province and Wantou, Yangzhou, Jiangsu Province. Each line is planted in 10 rows. During the seedling stage, tillering ability, resistance to stripe rust, and resistance to leaf rust are assessed. DH lines with poorer tillering ability than Yangmai 25 and poorer resistance to stripe rust and leaf rust than Chuannong 32 are eliminated. During the mature plant stage, resistance to heading, flowering, and Fusarium head blight is assessed. DH lines with later heading and flowering stages than Yangmai 25 are eliminated. At the flowering stage, spray the rows of DH lines with Fusarium head blight fungus. Spore liquid was used to identify resistance to Fusarium head blight infection, and DH lines with a Fusarium head blight infection rate of ≥5% were eliminated. During the flowering period, single flowers were inoculated with Fusarium head blight pathogen by drip inoculation, and DH lines with the identification result of "high resistance" were retained. Then, the comprehensive agronomic traits of the selected DH lines were comprehensively evaluated. Among the yield factors, the number of ears per plant greater than or equal to 8 and the number of grains per ear greater than or equal to 50 were the criteria for excellence. Superior DH lines were selected. After harvest, grain weight and yield were identified, and DH lines with grain weight and yield levels higher than the control were selected.
[0012] Step S6: Continue planting the DH line 2-centimeter plots selected in Chengdu and Yangzhou respectively last year in the fields of Pixian County, Chengdu, Sichuan and Wantou, Yangzhou, Jiangsu. Based on the breeding objectives, comprehensively examine the integrated agronomic traits of the plots. After harvesting the superior plots, conduct yield assessment and select plots with a yield level 6% higher than the control variety to enter the multi-point yield assessment in the following year.
[0013] In some embodiments, in step S1, the chassis varieties are Yangmai 39, Yangmai 46, and Yangmai 53.
[0014] In some embodiments, the method for identifying the resistance of the DH line to Fusarium head blight during the flowering period in steps S4 and S5 is as follows: preparing a Fusarium head blight spore suspension of 2×10⁻⁶. 5 ~4×10 5 Spores / mL: During the flowering period, select 50 normal panicles from each row of DH plants, mark them, and spray each panicle evenly from top to bottom with Fusarium wilt spore solution, spraying twice with a 5-minute interval; 25 days later, investigate the marked panicles, count the number of diseased panicles, calculate the disease rate, and cull DH lines with a Fusarium wilt disease rate ≥5%.
[0015] In some embodiments, the method for inoculating the labeled plants with the Fusarium head blight pathogen by drip inoculation of individual flowers during the flowering period and retaining the DH strain with the identification result of "highly resistant" is as follows: Prepare a Fusarium head blight spore suspension of 4×10⁻⁶. 5 ~5×10 5 Spores / mL, in the field, during the wheat flowering period, the single-flower drip inoculation method was used. 20 ears of wheat were randomly selected from each row or line, and inoculated at the open florets in the middle of each ear, and marked. After inoculation, water was sprayed on the inoculated ears every 2 hours from 8:00 to 18:00 every day, spraying evenly and thoroughly onto the wheat ears for 10 minutes each time. Watering was stopped immediately 20 days after the wheat flowering. 21 days after inoculation, the disease incidence of the inoculated ears was investigated, counting the number of diseased spikelets per ear and the total number of spikelets. Rows or lines with PSS ≤ 10% and a level close to the "high resistance" level of Sumai 3 were retained. Sumai 3 and Anong 8455 were used as high resistance and high susceptibility controls, respectively, Yangmai 25 as a moderately resistant control, and Yangmai 13 as a moderately susceptible control.
[0016] In some embodiments, the method for comprehensively examining the integrated agronomic traits of the selected DH line and the integrated agronomic traits of the plot line in steps S5 and S6 is as follows: plant height less than 90cm, good stem toughness and lodging resistance, number of ears per plant greater than or equal to 8, and number of grains per ear greater than or equal to 50.
[0017] In some embodiments, in steps S5 and S6, the yield control is Yangmai 25 and / or Chuannong 32.
[0018] In some embodiments, grain weight / grain length / grain width sites QTGW / KL / KW-1A The specific detection primer sequences are shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4.
[0019] In some embodiments, QFhb-2DL The specific detection primer sequences for candidate genes against Fusarium head blight are shown in SEQ ID NO. 6 and SEQ ID NO. 7.
[0020] The second aspect of the present invention provides the above-mentioned grain weight / grain length / grain width sites. QTGW / KL / KW-1A Specific detection primers.
[0021] The third aspect of the present invention provides the above-described QFhb-2DL Primers for the specific detection of candidate genes for resistance to Fusarium head blight.
[0022] Compared with the prior art, the present invention has the following technical advantages:
[0023] 1) This invention has identified grain weight / grain length / grain width loci derived from Yangmai 4. QTGW / KL / KW-1A Unlike previously reported grain weight / grain length / grain width loci, this is a new yield-related locus. Developing its molecular markers will help to further introduce the favorable allelic variations of this locus into background varieties that need improvement, creating high-yielding germplasm or varieties. At the same time, it can also accelerate the fine localization and cloning of this locus.
[0024] 2) This invention is based on using genetic populations to locate Fusarium head blight resistance loci, followed by fine-tuning to further narrow down the physical interval of the target locus, eliminating linkage redundancy caused by a large initial localization interval. It is the first to develop a method that... QFhb-2DL Tightly linked molecular markers QFhb-2D-dcaps can accelerate the formation of disease-resistant sites. QFhb-2DL Its application in wheat disease resistance breeding, and it can also be used for QFhb-2DL Cloning of candidate genes for resistance to Fusarium head blight.
[0025] 3) This invention utilizes tetraploid durum wheat LM, diploid jointed wheat 18, and jointed wheat 462 to create two artificial synthetic wheat species, LM / jointed wheat 462 and LM / jointed wheat 18. These are primary gene sources for wheat and are easier to utilize for breeding compared to secondary and tertiary gene sources. Jointed wheat 18 (DD) and jointed wheat 462 (DD) belong to the tauschii subspecies, which are different from the modern wheat D group donor species stranglata. They have characteristics such as resistance to stripe rust, leaf rust, and Fusarium head blight, large ears and large grains, and strong tillering. Using artificial synthetic wheat as a bridge, not only can new Fusarium head blight resistance genes from jointed wheat be introduced, but the diversity of the modern wheat D genome can also be enriched at the same time to alleviate the homogenization problem in modern wheat breeding.
[0026] 4) This invention first ensures that the DH strain carries Yangmai. QFhb-2DL Candidate genes for resistance to Fusarium head blight and loci for grain weight / length / width QTGW / KL / KW-1AThe enhanced allelic variation ensures the basic resistance and yield traits of the bred germplasm or materials. This method of establishing superior traits in fixed-base varieties and introducing excellent and prominent traits from foreign materials is a reliable molecular design breeding method for creating new germplasm and materials. Furthermore, after propagating the DH lines, this invention conducted phenotypic identification in Yangzhou and Chengdu, simultaneously screening for resistance to Fusarium head blight, stripe rust, and leaf rust. Using local yield control varieties as comparisons, this facilitates the selection of germplasm or varieties adapted to local conditions and simultaneously resistant to Fusarium head blight, stripe rust, and leaf rust, achieving a breakthrough in disease-resistant wheat breeding in the middle and upper reaches of the Yangtze River. Attached Figure Description
[0027] Figure 1 For the particle weight / length / width sites in Example 1 QTGW / KL / KW-1A Genetic linkage maps of loci;
[0028] Figure 2 For the particle weight / particle length / particle width sites in Example 1 QTGW / KL / KW-1A KASP marker genotyping results of loci in natural populations;
[0029] Figure 3 In Example 2 QFhb-2DL Detailed positioning results display diagram;
[0030] Figure 4 This is a schematic diagram illustrating the highly significant Fhb-2D-dcaps amplification of the Yangmai 5 / Yanzhan 1 population against Fusarium head blight phenotype in Example 2.
[0031] Figure 5 In Example 2 QFhb-2DL The amplification of candidate genes for resistance to Fusarium head blight is shown in the image. Red arrows indicate positive results. The red arrows indicate bands that can be cleaved by enzymes, representing the resistant genotype, while bands that cannot be cleaved by enzymes represent the susceptible genotype.
[0032] Figure 6 This is a flowchart of the breeding process for Example 3;
[0033] Figure 7 The image shows the Yang 991 and Chuan 989 strains bred in Example 3 21 days after inoculation with Fusarium head blight, compared with the infected control. Detailed Implementation
[0034] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the scope of the invention.
[0035] Example 1: Molecular marker-assisted selection of sites for grain weight / length / width QTGW / KL / KW-1A Method establishment
[0036] The applicant used the Yangmai 4 / Yanzhan 1 RIL population (F) 10 Phenotypic data of grain weight, grain length, and grain width, and 55K SNP chip data of the RIL population were used for QTL mapping to identify grain weight / grain length / grain width loci originating from Yangmai 4. QTGW / KL / KW-1A Located on the long arm of chromosome 1A at 28.92-29.13 Mb, its phenotypic contribution rate reached 15.68%. Figure 1 (Table 1).
[0037] Table 1 QTGW / KL / KW-1A Location results
[0038]
[0039] analyze QTGW / KL / KW-1A The flanking sequence of the linked SNP marker AX108789085, SEQ ID NO.1: CAGGGTAGGTGCGTGCATGTCTTTGATGTCGGTCT[A / G]TTCCACACTGTAAGATTACTTCGGCATGCAAAGAT, was obtained by blasting its physical location online (http: / / 202.194.139.32 / blast / blast.html and http: / / wheatomics.sdau.edu.cn / genes / ). Comparison with previously reported grain weight / length / width related loci revealed this to be a novel locus. Therefore, based on its flanking sequence, a KASP marker, KASP.QTGW / KL / KW-1A, was developed using Primer 3.0. Wheat seedlings were used, and genomic DNA was extracted from the wheat seedlings using the CTAB method. The resulting template solution was diluted to a DNA concentration of approximately 30 ng / μL. Grain weight / length / width loci in wheat were then detected. QTGW / KL / KW-1A The KASP primer KASP.QTGW / KL / KW-1A was prepared. Preparation of the KASP-labeled primer working solution: Take 30 μL (100 μM) of the upstream primer (F1, SEQ ID NO.2 and F2, SEQ ID NO.3) and 12 μL (100 μM) of the downstream primer (R, SEQ NO.4) respectively, and add sterile ultrapure water to a final volume of 100 μL. Mix thoroughly to obtain the KASP-labeled primer working solution for later use.
[0040] PCR amplification reaction system: 2.2 μL of wheat DNA template to be tested (approximately 30 ng / μL), 0.06 μL of primer working solution, 2.5 μL of KASP Master Mix (LGC Corporation, KBS-1016-002), and added to a final volume of 5 μL with sterile ultrapure water;
[0041] PCR reaction procedure: (1) Pre-denaturation at 95℃ for 10 min; (2) Denaturation at 95℃ for 20 s, followed by 45 s at 61–55℃ (decreasing by 0.6℃ per cycle), for a total of 10 cycles; (3) Denaturation at 95℃ for 20 s, followed by annealing at 55℃ for 45 s, for a total of 34 cycles; store at 20℃. A blank control (NTC) without template DNA was also included in the reaction system. One or more blank controls were set up for each plate.
[0042] Using wheat genomic DNA as a template, PCR amplification was performed using the KASP primer set and PCR reagents described above to obtain PCR amplification products. The PCR reaction was performed on an ABI Veriti 384 PCR instrument (Thermo Fisher), and the fluorescence values of the PCR amplification products were scanned and read using an Omega F SNP genotyping instrument (LGC Genomics Ltd, KBS-0024-002). The excitation wavelength for FAM was 485 nm, and the emission wavelength for VIC was 535 nm, and the emission wavelength for the system reference fluorescence ROX was 575 nm, and the emission wavelength for ROX was 610 nm. Genotyping was performed using Kluster Caller™ (KBioscience), and the results were used to determine the genotype. QTGW / KL / KW-1A Genotype at the locus. A portion of the "Yangmai 4 / Yanzhan 1 RIL line" along with the two parents was amplified using the method described above, such as... Figure 2 As shown in Table 2, the fluorescence signal data of the amplified products, analyzed by Kluster Caller software, clustered near the X-axis (blue) in the fluorescence signal coordinate system of the genotyping results. Similar to Yangmai 4, this indicates an enhancing allelic variation in grain weight / grain length / grain width, confirming that the genotype of these wheat lines at the 36th base (SNP site) of the KASP marker flanking nucleotide sequence (original flanking sequence SEQ ID NO.1) is A. Conversely, the fluorescence signal data of the amplified products, analyzed by Kluster Caller software, clustered near the Y-axis (red) in the coordinate system. Unlike the Yangmai 4 genotyping, this indicates a diminishing allelic variation in grain weight / grain length / grain width, confirming that the genotype of these families at this SNP site is G (SEQ ID NO.3) (Table 2). Subsequently, the KASP.QTGW / KL / KW-1A marker was detected in 138 wheat breeding lines, and its effectiveness was analyzed by combining it with the grain weight, grain length, and grain width phenotypes of the 138 wheat breeding lines (Table 3).
[0043] Table 2. KASP.QTGW / KL / KW-1A marker primer sequence information
[0044]
[0045] Table 3 QTGW / KL / KW-1A Typing results of 138 wheat breeding lines
[0046]
[0047] Table 4 QTGW / KL / KW-1A t-test results of corresponding phenotypic values in 138 wheat breeding lines
[0048]
[0049] As shown in Tables 3 and 4, after testing with the KASP.QTGW / KL / KW-1A marker, 70 lines carried allelic variations in grain weight / grain length / grain width, and 68 lines carried low allelic variations in grain weight / grain length / grain width. The lines carrying high allelic variations in grain weight / grain length / grain width had an average grain weight 8.77% higher than the lines carrying low allelic variations in grain weight / grain length / grain width. p <0.01%, grain length increased by 1.46% ( p <0.05%, particle width and height 3.27% ( p <0.01), which clearly distinguishes between high and low grain weight, grain length, and grain width. This indicates that the KASP.QTGW / KL / KW-1A primer set and genotype detection system can be applied to molecular marker-assisted breeding for wheat resistance to Fusarium head blight, and can be further used for the detection and screening of breeding materials.
[0050] Genomic DNA was extracted from the candidate parental materials and DH line leaves involved in Example 3 using the CTAB method. After dilution, a template solution with a DNA concentration of approximately 30 ng / μL was obtained. Grain weight / grain length / grain width loci were then detected in wheat. QTGW / KL / KW-1A .
[0051] Example 2: Molecular marker-assisted selection QFhb-2DL Establishment of candidate gene methods for resistance to Fusarium head blight
[0052] The applicant used the Yangmai 4 / Yanzhan 1 and Yangmai 5 / Yanzhan 1 populations to discover Fusarium head blight resistance loci originating from both Yangmai 4 and Yangmai 5. QFhb-2DL The phenotypic contribution rate reached 11.14-37.39%. Using whole-genome sequencing results (BSA-seq) of the parental and RIL populations' resistance and susceptibility pools, and 30× resequencing results of 130 wheat varieties with significant differences in resistance and susceptibility, we explored... QFhb-2DLThe study identified polymorphic sites in the QTL region and developed novel KASP markers based on flanking sequences. Using Yangmai 4 as the donor and Yanzhan 1 as the recipient, a backcross was performed to BC3F3. Molecular marker screening was used to eliminate interference from other Fusarium head blight resistance sites in the background varieties Yanzhan 1 and Yangmai 4, creating a fine-mapping population of 3409 individual plants. The novel KASP markers were used to screen for homozygotes and key recombinants in this population, identifying 10 key recombinants. Combined with two years of Fusarium head blight resistance phenotype identification results, [the study concluded that...]. QFhb-2DL Locked in the 1108.70kb physical range ( Figure 3 Then, using five molecular markers (2D-8 to 2D-12) from the candidate region to scan the Yangmai 4 / Yanzhan 1 RIL population, combined with the identification of Fusarium head blight resistance phenotypes in six environments, the assay was repeated. QFhb-2DL Genetic linkage map construction and localization were performed to locate new Fusarium head blight resistance loci closer to the target gene. The flanking sequence of the linkage marker at this locus, SEQ ID NO. 5: TGGGTGGGGCTAAATGTGTAGAGTG[C / G]CTTTTCCAGGATCCACCGTGAGAATTAGCACTTTTTAGTGTCCGGACCAAAATAGTTGGTCTGGCCTTCTCTTTTTTTTTTTTTTCTTTGGATCCAACTCCCTCCGTCCCCTAAGGGCATGAGCAATGGGGGCAGCGGTAGCTGCCGCCCCCGATGCATCCAGCTAGGTATGGGAAAATTGATTTCT, was analyzed to develop dcaps markers. After reviewing literature and comparing with the wheat reference genome, newly developed dcaps markers were discovered. QFhb- The 2D-dcaps marker is unlike any previously reported molecular marker for resistance to Fusarium head blight. The specific primer sequence for QFhb-2D-dcaps is shown in Table 5.
[0053] Table 5. QFhb-2D-dcaps marker primer sequence information
[0054]
[0055] QFhb-2D-dcaps were detected by PCR amplification. The PCR amplification method was as follows: the PCR amplification system contained 5 μL of pure water + 5 μL of 2XTaq Mix + 0.2 μL each of upstream and downstream primers + 1 μL of DNA. The first step of the PCR amplification program was as follows: (1) 94℃ pre-denaturation for 3 min; (2) 94℃ denaturation for 30 s, 60℃ annealing for 45 s, 72℃ extension for 30 s, for a total of 34 cycles; (3) 72℃ extension for 10 min, and storage at 4℃. The second step was enzyme digestion of a 10 μL system containing 7.8 μL of pure water + 2 μL of buffer + 0.2 μL of enzyme, reacted at 37°C for 30 min. The fourth step was agarose gel: 3% agarose gel + 500 bp marker + 200V voltage and 220V current for 30 min. The target genotype was a band that could be digested with enzymes, identical to that of Yangmai 39, Yangmai 46, and Yangmai 53, and was selected as the chosen material. The susceptible genotype was not digestible with enzymes and showed the same bands as the susceptible varieties. The effectiveness of the QFhb-2D-dcaps marker was subsequently verified. Figure 4 The effectiveness of the QFhb-2D-dcaps test on the RIL population of Yangmai 5 / Yanzhan 1 was verified by combining the average diseased spikelet rate after Fusarium head blight inoculation over many years. The results showed that families carrying the resistant genotype had a 31.61% lower average diseased spikelet rate than families carrying the susceptible genotype. Table 6 shows the genotypic results of the breeding materials from the bio-breeding project and the Fusarium head blight resistance phenotype identification results for that year, and Table 7 shows the t-test results of the corresponding phenotypic values.
[0056] Table 6. Identification results of QFhb-2D-dcaps genotype and Fusarium head blight resistance phenotype of breeding materials.
[0057]
[0058] Note: R represents the disease-resistant genotype, namely Yangmai 4 genotype, and S represents the disease-susceptible genotype, namely Yanzhan 1 genotype.
[0059] Table 7. t-test results of phenotypic values corresponding to QFhb-2D-dcaps
[0060]
[0061] Note: R represents the disease-resistant genotype, namely Yangmai 4 genotype, and S represents the disease-susceptible genotype, namely Yanzhan 1 genotype.
[0062] As shown in Tables 6 and 7, after QFhb-2D-dcaps marker testing, 29 varieties (lines) did not carry disease resistance allelic variation, while 22 varieties (lines) carried disease resistance allelic variation. The average disease incidence of spikelets with disease resistance allelic variation was 58.78% lower in the varieties (lines) carrying disease resistance allelic variation than in those without. p <0.01), which clearly distinguishes between resistant and susceptible materials. This indicates that the QFhb-2D-dcaps primer set and genotype detection system can be applied to molecular marker-assisted breeding of wheat for resistance to Fusarium head blight, and can be further used for the detection and screening of breeding materials.
[0063] Genomic DNA was extracted from candidate parental materials, single plant leaves, or mixed plant leaves involved in Example 3 using the CTAB method. The DNA was diluted to obtain a template solution with a concentration of approximately 30 ng / μL, and the wheat resistance loci were detected. QFhb- 2D-dcaps tags.
[0064] Figure 5 For development QFhb-2DL A schematic diagram of the amplification results of the site molecular marker in the parents and offspring. The arrows indicate the bands that can be cleaved by enzymes, which represent the disease-resistant genotype, while the bands that cannot be cleaved by enzymes represent the disease-susceptible genotype.
[0065] Example 3: Molecular breeding method for creating new wheat germplasm highly resistant to Fusarium head blight, stripe rust, and leaf rust.
[0066] according to Figure 6 The breeding method, as shown in the diagram, includes the following steps:
[0067] Step S1: Collect 255 wheat varieties from the upper and lower reaches of the Yangtze River, and analyze them using grain weight / grain length / grain width loci. QTGW / KL / KW-1A and QFhb-2DL Molecular marker detection of candidate genes for resistance to Fusarium head blight revealed that Yangmai 39, Yangmai 46, and Yangmai 53 all carry grain weight / grain length / grain width loci. QTGW / KL / KW-1A Synergistic allelic variation and QFhb-2DL Candidate genes for resistance to Fusarium head blight can be used as a chassis variety in wheat genetic breeding.
[0068] In Wantou, Yangzhou, Jiangsu Province, 127 jointed wheat germplasm (DD) were introduced and subjected to three years of Fusarium head blight resistance identification. Jointed wheat 18 was found to be resistant to Fusarium head blight, stripe rust, and leaf rust, and to have strong tillering. Jointed wheat 462 was found to be resistant to stripe rust and leaf rust, and to have large ears and large grains. Therefore, in Pixian County, Sichuan Province, two artificially synthesized wheat varieties, LM / Jointed Wheat 462 and LM / Jointed Wheat 18, were independently created using tetraploid durum wheat LM (AABB) and Jointed Wheat 462 and Jointed Wheat 18. Inoculation identification in Yangzhou, Jiangsu Province and Pixian County, Sichuan Province showed that LM / Jointed Wheat 18 was resistant to Fusarium head blight, indicating that the Fusarium head blight resistance gene of Jointed Wheat 18 can be stably expressed in hexaploid wheat. Therefore, a (LM / Jointly Grain 18) × (LM / Jointly Grain 462) recombinant inbred line population was constructed. After generations in an artificial climate chamber, F8 (372 families) was created. After two years and two locations for Fusarium head blight single flower drip phenotypic identification, stripe rust and leaf rust identification, and agronomic trait investigation, six families in (LM / Jointly Grain 18) × (LM / Jointly Grain 462) RIL that were resistant to Fusarium head blight, stripe rust and leaf rust, had strong tillering, large ears and large grains, and excellent agronomic traits were identified. Using these excellent families as donors, they were crossed with the core parents Yangmai 39, Yangmai 46 and Yangmai 53 to obtain hybrid F0 with at least 500 grains per combination.
[0069] Step S2: F0 plants are planted in a field in Kunming, Yunnan to grow into F1 plants, and corn pollen is induced (wheat and corn can flower at the same time during summer breeding). Haploid plants are rescued from the embryos, and chromosome doubling is performed using colchicine. The plants are then cultured in an artificial climate chamber to obtain DH line seeds. Each combination yields 500-600 DH lines.
[0070] Step S3: DH strains were planted in a greenhouse in Pixian County, Chengdu, Sichuan Province. Once seedlings emerged, they were tagged, and DNA was extracted from leaves using loci of grain weight / length / width. QTGW / KL / KW-1A and QFhb-2DL Linkage marker detection of candidate genes for resistance to Fusarium head blight was performed on DH plants. DH plants that were positive (homozygous) at both loci were selected, and seeds from the positive plants were harvested.
[0071] Step S4: Select DH series seeds for planting in large fields in Pixian County, Chengdu, Sichuan Province and Wantou, Yangzhou, Jiangsu Province. Plant each series in 3 rows. During the seedling stage, assess tillering ability, resistance to stripe rust, and resistance to leaf rust. DH series with poorer tillering ability than Yangmai 25 and poorer resistance to stripe rust and leaf rust than Chuannong 32 are eliminated. During the mature plant stage, assess resistance to heading, flowering, and Fusarium head blight infection. DH series with later heading and flowering stages than Yangmai 25 are eliminated. At the flowering stage, spray the rows of DH series with Fusarium head blight spore suspension to assess Fusarium head blight resistance. Specifically, prepare a Fusarium head blight spore suspension of 2×10⁻⁶. 5 ~4×10 5At the flowering stage, for DH plants, 50 healthy panicles per row were selected and marked. Each panicle was then sprayed evenly from top to bottom with Fusarium graminearum spore solution, twice, with a 5-minute interval. After 25 days, the marked panicles were surveyed to determine the number of diseased panicles and calculate the disease rate. DH lines with a Fusarium graminearum disease rate ≥5% were culled. During the flowering stage, single-flower drip inoculation with the Fusarium graminearum pathogen was performed, inoculating 20 panicles per row. The incidence of Fusarium graminearum on panicles 21 days after inoculation was recorded. DH lines with an identification result of "highly resistant" (average diseased panicle rate ≤10%) were retained. Specifically, a Fusarium graminearum spore suspension of 4 × 10⁻⁶ was prepared. 5 ~5×10 5 Spores / mL, in the field, during the wheat flowering period, inoculate using the single-flower drip method. Randomly select 20 ears per row or line, inoculate at the open florets in the middle of each ear, and mark them. After inoculation, spray water on the inoculated ears every 2 hours from 8:00 to 18:00 daily, spraying evenly and thoroughly onto the wheat ears for 10 minutes each time. Stop spraying immediately 20 days after wheat flowering. 21 days after inoculation, investigate the disease incidence of the inoculated ears, counting the number of diseased spikelets per ear and the total number of spikelets. Fusarium head blight severity (average diseased spikelet rate, PSS) = number of diseased spikelets / total number of spikelets × 100%. Retain rows or lines with PSS ≤ 10% and a level close to the "high resistance" of Sumai 3. Sumai 3 and Anong 8455 are used as high resistance and high susceptibility controls, respectively, Yangmai 25 as a moderately resistant control, and Yangmai 13 as a moderately susceptible control. Select DH series seeds for harvest.
[0072] Step S5: DH lines selected in Chengdu and Yangzhou the previous year were planted in large fields in Pixian County, Chengdu, Sichuan Province, and Wantou, Yangzhou, Jiangsu Province, with each line planted in 10 rows. During the seedling stage, tillering ability, resistance to stripe rust, and resistance to leaf rust were assessed, and DH lines with poorer tillering ability than Yangmai 25 and poorer resistance to stripe rust and leaf rust than Chuannong 32 were eliminated. During the mature plant stage, resistance to heading, flowering, and Fusarium head blight was assessed, and DH lines with later heading and flowering stages than Yangmai 25 were eliminated. At the flowering stage, Fusarium head blight resistance was assessed by spraying the rows of DH lines with Fusarium head blight spores, specifically by preparing a Fusarium head blight spore suspension of 2×10⁻⁶. 5 ~4×10 5 At the flowering stage, for DH plants, 50 healthy panicles per row were selected and marked. Each panicle was then sprayed evenly from top to bottom with Fusarium graminearum spore solution, twice, with a 5-minute interval. After 25 days, the marked panicles were surveyed to determine the number of diseased panicles and calculate the disease rate. DH lines with a Fusarium graminearum disease rate ≥5% were culled. During the flowering stage, single-flower drip inoculation with the Fusarium graminearum pathogen was performed, inoculating 20 panicles per row. The incidence of Fusarium graminearum on panicles 21 days after inoculation was recorded. DH lines with an identification result of "highly resistant" (average diseased panicle rate ≤10%) were retained. Specifically, a Fusarium graminearum spore suspension of 4 × 10⁻⁶ was prepared.5 ~5×10 5 Spores / mL, in the field, during the wheat flowering period, the single-flower drip inoculation method was used. 20 ears were randomly selected from each row or line, and inoculated at the open florets in the middle of each ear, and marked. After inoculation, water was sprayed on the inoculated ears every 2 hours from 8:00 to 18:00 every day, spraying evenly and thoroughly onto the wheat ears for 10 minutes each time. Watering was stopped immediately 20 days after wheat flowering. 21 days after inoculation, the disease incidence of the inoculated ears was investigated, counting the number of diseased spikelets per ear and the total number of spikelets. The severity of Fusarium head blight (average diseased spikelet rate, PSS) = number of diseased spikelets / total number of spikelets × 100%. Rows or lines with PSS ≤ 10% and close to the "high resistance" level of Sumai 3 were retained. Sumai 3 and Anong 8455 were used as high resistance and high susceptibility controls, respectively. Yangmai 25 was used as a moderately resistant control, and Yangmai 13 was used as a moderately susceptible control. Then, based on the breeding objectives, a comprehensive agronomical trait of the selected DH lines in 10 rows was examined. Specifically, the following criteria were used to select superior DH lines: plant height less than 90cm, good stem toughness and lodging resistance, number of ears per plant greater than or equal to 8, and number of grains per ear greater than or equal to 50. After harvest, grain weight and yield were assessed, and DH lines with higher grain weight and yield levels in Chengdu than the control Chuanong 32 and in Yangzhou than the control Yangmai 46 were selected.
[0073] Step S6: Continue planting the DH lines selected in Chengdu and Yangzhou in the previous year in 2-centimeter plots in Pixian County, Chengdu, Sichuan Province, and Wantou County, Yangzhou, Jiangsu Province, respectively, to conduct Fusarium head blight resistance and spread assessment. Based on the breeding objectives, comprehensively examine the agronomic traits of the plot lines, specifically: plant height less than 90cm, good stem toughness and lodging resistance, 8 or more ears per plant, and 50 or more grains per ear. After harvesting the superior plots, conduct yield assessments. The plot in Yangzhou with a yield level 6.91% higher than the control variety Yangmai 25 in the Yangtze River mid-lower reaches regional trials was named Yang 991 (Table 8), and the plot in Chengdu with a yield level 6.89% higher than the control variety Chuannong 32 in the upper Yangtze River regional trials was named Chuan 989. These plots will proceed to multi-point yield assessments the following year (Table 9).
[0074] After inoculating the developed varieties Yang 991 and Chuan 989 with the control varieties Yangmai 25 and Sumai 3 at the Yangzhou and Chengdu sites for 21 days, the average diseased spikelet rates of Yang 991 and Chuan 989 were 9.23% and 9.67%, respectively. The average diseased spikelet rates of the moderately resistant control Yangmai 25 and the highly resistant control Sumai 3 were 23.72% / 26.25% and 9.54% / 10.76%, respectively. The average diseased spikelet rates of the susceptible control Anong 8455 were 78.36% and 75.33% at the two sites, respectively. The yield identification results in step S6 showed that the plot where the yield level of Yang 991 was 6.91% higher than that of the control variety Yangmai 25 in the middle and lower reaches of the Yangtze River was named (Table 8). Chuan 989's yield was 6.89% higher than that of the control variety Chuanong 32 in the upper reaches of the Yangtze River. This indicates that the yield of Yang 991 was higher than that of Chuanong 32 in the upper reaches of the Yangtze River. QTGW / KL / KW-1A and QFhb-2DL Marker-assisted selection of candidate genes for resistance to Fusarium head blight, combining favorable allelic variations of these two genes / locus with phenotypic screening, can produce wheat varieties with resistance levels comparable to Sumai 3 and yields significantly higher than local yield control varieties (see Tables 8 and 9). Figure 7 (As shown)
[0075] Table 8. Average incidence of Fusarium head blight and yield of Yang 991 spikelet.
[0076]
[0077] Table 9. Average incidence and yield of Fusarium head blight in Sichuan 989 spikelet.
[0078]
[0079] It is evident that the method of this invention enables the breeding of high-yielding wheat varieties (lines) with high resistance to Fusarium head blight and high yield through molecular design and precise phenotypic identification of traits related to Fusarium head blight and yield, thereby significantly improving breeding efficiency and the precision of trait improvement.
[0080] The donors used in the above method, which are resistant to stripe rust, leaf rust, and Fusarium head blight, and have large ears and large grains and strong tillering, are superior artificially synthesized wheat families. The artificially synthesized wheat parents are LM (AABB), Jointed Wheat 18 (DD), and Jointed Wheat 462 (DD). Among them, Jointed Wheat 18 (DD) and Jointed Wheat 462 (DD) belong to the same subspecies of Tauschii, which are different from the modern wheat D group donor species Straglata. Using artificially synthesized wheat as a bridge can not only introduce new genes for resistance to Fusarium head blight from Jointed Wheat, but also enrich the diversity of the modern wheat D genome, thereby alleviating the homogenization problem in modern wheat breeding.
[0081] The above method first ensures that the DH strain carries Yangmai. QFhb-2DL Candidate genes for resistance to Fusarium head blight and loci for grain weight / length / width QTGW / KL / KW-1A The enhanced allelic variation ensures the basic resistance and yield traits of the bred germplasm or materials. This method of fixing the superior traits of the base variety and introducing the excellent and outstanding traits of foreign materials is a reliable molecular design breeding method for creating new germplasm and new materials. It is expected to achieve a breakthrough in disease resistance breeding of wheat in the middle and lower reaches of the Yangtze River and the upper reaches of the Yangtze River using the method of this invention.
[0082] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.
[0083] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.
[0084] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.
Claims
1. A molecular breeding method for creating new wheat germplasm highly resistant to Fusarium wilt, stripe rust, and leaf rust, characterized in that, Includes the following steps: Step S1: Collect wheat varieties from the upper and lower reaches of the Yangtze River, using grain weight / grain length / grain width loci. QTGW / KL / KW-1A and QFhb-2DL Molecular marker detection of candidate genes for resistance to Fusarium head blight revealed loci carrying grain weight / grain length / grain width. QTGW / KL / KW-1A Synergistic allelic variation and QFhb-2DL Varieties with candidate genes for resistance to Fusarium head blight, serving as chassis varieties, are Yangmai 39, Yangmai 46, and Yangmai 53; Three years of Fusarium head blight resistance identification was conducted on jointed wheat germplasm. Jointed wheat 18 was found to be resistant to Fusarium head blight, stripe rust, and leaf rust, and exhibited strong tillering; jointed wheat 462 was found to be resistant to stripe rust and leaf rust, and exhibited large ears and large grains. Two synthetic wheat varieties, LM / Jointed Wheat 462 and LM / Jointed Wheat 18, were created using tetraploid durum wheat LM, Jointed Wheat 18, and Jointed Wheat 462. Inoculation identification showed that LM / Jointed Wheat 18 exhibited resistance to Fusarium head blight, indicating that the Fusarium head blight resistance gene of Jointed Wheat 18 can be found in hexaploid wheat. Stable expression was achieved; therefore, a recombinant inbred line population F8 of (LM / Jointed Wheat 18) × (LM / Jointed Wheat 462) was constructed. After identification of Fusarium head blight single flower drip phenotype, stripe rust and leaf rust identification, and agronomic trait investigation, the families in (LM / Jointed Wheat 18) × (LM / Jointed Wheat 462) RIL that were resistant to Fusarium head blight, stripe rust and leaf rust, had strong tillering, large ears and large grains and excellent agronomic traits were identified. These excellent families were used as donors and crossed with the core parent chassis variety to obtain hybrid F0. Step S2: F0 is planted into F1, corn pollen is induced, haploid plants are rescued from the embryos, chromosome doubling is performed using colchicine, and the plants are cultured in an artificial climate chamber to obtain DH line seeds the following year. Step S3: Cultivate DH line in greenhouse. When seedlings emerge, extract DNA from leaves and utilize grain weight / grain length / grain width loci. QTGW / KL / KW-1A and QFhb-2DL Linkage marker detection of candidate genes for resistance to Fusarium head blight was performed on DH individual plants. DH individual plants that were positive at both loci were selected, and seeds from these positive plants were harvested. Grain weight / length / width were recorded at each locus. QTGW / KL / KW-1A The specific detection primer sequences are shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.
4. QFhb-2DL The specific detection primer sequences for candidate genes against Fusarium head blight are shown in SEQ ID NO.6 and SEQ ID NO.7; Step S4: Select DH series seeds by planting in large fields in Pixian County, Chengdu, Sichuan Province and Wantou, Yangzhou, Jiangsu Province. Each series is planted in 3 rows. During the seedling stage, tillering ability, resistance to stripe rust, and resistance to leaf rust are assessed. DH series with poor tillering ability compared to Yangmai 25 and poor resistance to stripe rust and leaf rust compared to Chuannong 32 are eliminated. During the mature plant stage, resistance to Fusarium head blight is assessed at the heading, flowering, and Fusarium head blight infection stages. DH series with later heading and flowering stages than Yangmai 25 are eliminated. During the flowering stage, Fusarium head blight resistance is assessed by spraying the rows of DH series with Fusarium head blight spore solution. DH series with Fusarium head blight infection rate ≥5% are eliminated. During the flowering stage, single flowers are inoculated with Fusarium head blight pathogen by drip inoculation. DH series with the assessment result of "high resistance" are retained, and DH series seeds are harvested. Step S5: Plant the DH lines selected in Chengdu and Yangzhou the previous year in large fields in Pixian County, Chengdu, Sichuan Province and Wantou, Yangzhou, Jiangsu Province. Each line is planted in 10 rows. During the seedling stage, tillering ability, resistance to stripe rust, and resistance to leaf rust are assessed. DH lines with poorer tillering ability than Yangmai 25 and poorer resistance to stripe rust and leaf rust than Chuannong 32 are eliminated. During the mature plant stage, resistance to heading, flowering, and Fusarium head blight is assessed. DH lines with later heading and flowering stages than Yangmai 25 are eliminated. At the flowering stage, spray the rows of DH lines with Fusarium head blight fungus. Spore liquid was used to identify resistance to Fusarium head blight infection, and DH lines with a Fusarium head blight infection rate of ≥5% were eliminated. During the flowering period, single flowers were inoculated with Fusarium head blight pathogen by drip inoculation, and DH lines with the identification result of "high resistance" were retained. Then, the comprehensive agronomic traits of the selected DH lines were comprehensively evaluated. Among the yield factors, the number of ears per plant greater than or equal to 8 and the number of grains per ear greater than or equal to 50 were the criteria for excellence. Superior DH lines were selected. After harvest, grain weight and yield were identified, and DH lines with grain weight and yield levels higher than the control were selected. Step S6: Continue planting the DH line 2-centimeter plots selected in Chengdu and Yangzhou respectively last year in the fields of Pixian County, Chengdu, Sichuan and Wantou, Yangzhou, Jiangsu. Based on the breeding objectives, comprehensively examine the integrated agronomic traits of the plots. After harvesting the superior plots, conduct yield assessment and select plots with a yield level 6% higher than the control variety to enter the multi-point yield assessment in the following year.
2. The molecular breeding method according to claim 1, characterized in that, In steps S4 and S5, the method for identifying the resistance of the DH line to Fusarium head blight during the flowering period is as follows: prepare a Fusarium head blight spore suspension of 2×10⁻⁶. 5 ~4×10 5 Spores / mL: During the flowering period, select 50 normal panicles from each row of DH plants, mark them, and spray each panicle evenly from top to bottom with Fusarium wilt spore solution, spraying twice with a 5-minute interval; 25 days later, investigate the marked panicles, count the number of diseased panicles, calculate the disease rate, and cull DH lines with a Fusarium wilt disease rate ≥5%.
3. The molecular breeding method according to claim 1, characterized in that, In steps S4 and S5, the method for retaining the DH strain with "highly resistant" results after single-flower drip inoculation of the Fusarium head blight pathogen onto the labeled plants during the flowering period is as follows: Prepare a Fusarium head blight spore suspension of 4×10⁻⁶. 5 ~5×10 5 Spores / mL, in the field, during the wheat flowering period, the single-flower drip inoculation method was used. 20 ears of wheat were randomly selected from each row or line, and inoculated at the open florets in the middle of each ear, and marked. After inoculation, water was sprayed on the inoculated ears every 2 hours from 8:00 to 18:00 every day, spraying evenly and thoroughly onto the wheat ears for 10 minutes each time. Watering was stopped immediately 20 days after the wheat flowering. 21 days after inoculation, the disease incidence of the inoculated ears was investigated, counting the number of diseased spikelets per ear and the total number of spikelets. Rows or lines with PSS ≤ 10% and a level close to the "high resistance" level of Sumai 3 were retained. Sumai 3 and Anong 8455 were used as high resistance and high susceptibility controls, respectively. Yangmai 25 was used as a moderately resistant control, and Yangmai 13 was used as a moderately susceptible control.
4. The molecular breeding method according to claim 1, characterized in that, In steps S5 and S6, the method for comprehensively examining the integrated agronomic traits of the selected DH line and the integrated agronomic traits of the plot lines is as follows: plant height less than 90cm, good stem toughness and lodging resistance, number of ears per plant greater than or equal to 8, and number of grains per ear greater than or equal to 50.
5. The molecular breeding method according to claim 1, characterized in that, In steps S5 and S6, the yield control is Yangmai 25 and / or Chuannong 32.
6. Grain weight / grain length / grain width sites QTGW / KL / KW-1A Specific detection primers and QFhb-2DL The application of specific detection primers for candidate genes for resistance to Fusarium head blight in the creation of new wheat germplasm highly resistant to Fusarium head blight, stripe rust, and leaf rust is characterized by the following: Grain weight / grain length / grain width sites QTGW / KL / KW-1A The specific detection primer sequences are shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.
4. QFhb-2DL The specific detection primer sequences for the candidate gene against Fusarium head blight are shown in SEQ ID NO.6 and SEQ ID NO.7.
Citation Information
Patent Citations
KASP molecular marker of wheat scab resistance major QTL and applications of KASP molecular marker
CN107988411A
Molecular marker-assisted breeding method of fusarium head blight (FHB)-resistant multi-fruiting spikelet number wheat
CN113475392A