Application of specific DNA molecule in identifying genuine quality of dendrobium and identification method

By using specific DNA molecules and quantitative real-time PCR technology, the problem of identifying the growth environment of Dendrobium officinale in Huoshan has been solved, enabling rapid and accurate identification of its authentic quality and improving the standardized management of the Dendrobium officinale industry.

CN119979756BActive Publication Date: 2026-07-03ARTIFICIAL INTELLIGENCE RES INST OF HEFEI COMPREHENSIVE NAT SCI CENT (ANHUI ARTIFICIAL INTELLIGENCE LAB)
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510183328.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-19
Publication Date
2026-07-03
Estimated Expiration
2045-02-19

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively distinguish the growth environment of Dendrobium huoshanense, which makes it difficult to identify its authentic quality and affects the standardization of the Dendrobium industry and market management.

Method used

Specific DNA molecules, especially those located in the promoter region (42078801~42089000bp) upstream of the serine kinase coding site on chromosome 9 of Dendrobium huoshanense, were used in combination with quantitative real-time PCR to identify the authentic quality of Dendrobium huoshanense through fluorescence signal analysis.

Benefits of technology

It enables rapid and accurate differentiation of the growth environment of Dendrobium within one day, provides an objective method for detecting the quality of authentic products, simplifies the operation process, controls costs, and ensures the reliability of Dendrobium quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

This invention provides an application of a specific DNA molecule in identifying the authentic quality of Dendrobium officinale. The specific DNA molecule includes the sequence shown in SEQ ID NO.1. Based on the principles of epigenetics, this invention identifies environment-associated molecular markers in Dendrobium officinale grown under different environments. Using these markers for quantitative real-time PCR, the growth environment of Dendrobium officinale materials can be distinguished within one day. The procedure is simplified, easy to operate, and cost-effective, providing an objective and qualitative detection method for the authentic quality of Dendrobium officinale.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and genetic engineering, and in particular to the application and identification method of a specific DNA molecule in identifying the authentic quality of Dendrobium officinale. Background Technology

[0002] Dendrobium huoshanense CZ Tang et SJ Cheng, also known as rice dendrobium, is a perennial herb belonging to the Dendrobium genus of the Orchidaceae family. It has the effects of strengthening yin and nourishing body fluids, tonifying the kidneys and boosting energy, improving eyesight and prolonging life. Related studies have shown that the main chemical components of Dendrobium huoshanense include alkaloids, polysaccharides, flavonoids and amino acids, which can fight viruses, tumors, antioxidants, lower blood sugar and regulate immunity.

[0003] The cultivation of Dendrobium huoshanense mainly falls into two categories: greenhouse cultivation and semi-wild cultivation. Greenhouse cultivation typically takes place in greenhouses, resulting in high survival rates and rapid growth, but it can affect the authentic quality of the Dendrobium. Semi-wild cultivation, on the other hand, simulates the natural growing environment of Dendrobium, usually taking place under forest canopies or on rocks. This method more closely resembles the natural growing conditions of Dendrobium, helping to maintain its authentic quality, but it results in slower growth and greater management difficulty. While Dendrobium huoshanense obtained through different cultivation methods may be difficult to distinguish visually, their authentic quality is clearly differentiated.

[0004] Therefore, establishing a standardized quality standard system for Dendrobium huoshanense products provides a theoretical basis for the use of Dendrobium huoshanense in accordance with quality, ensuring premium prices for superior products, and promoting scientific management. It is of great significance for regulating the market and promoting the healthy development of Dendrobium huoshanense. Summary of the Invention

[0005] In view of this, in order to at least partially solve at least one of the aforementioned technical problems, the present invention provides the application and identification method of specific DNA molecules in identifying the authentic quality of Dendrobium officinale.

[0006] According to one embodiment of the present invention, an application of a specific DNA molecule in identifying the authentic quality of Dendrobium officinale is provided, wherein...

[0007] The specific DNA molecule includes the sequence shown in SEQ ID NO.1.

[0008] According to embodiments of the present invention, the authentic quality includes Dendrobium officinale of superior authentic quality grown under semi-wild cultivation conditions and Dendrobium officinale of secondary authentic quality grown without semi-wild cultivation conditions.

[0009] According to an embodiment of the present invention, the Dendrobium is Dendrobium huoshanense;

[0010] The specific DNA molecule associated with the authentic quality of Dendrobium huoshanense is the upstream promoter region 42078801~42089000bp located at the serine kinase coding site on chromosome 9 of Dendrobium huoshanense.

[0011] According to embodiments of the present invention, identifying the authentic quality of Dendrobium includes identifying the quality of fresh Dendrobium stems, dried stems, Dendrobium capsules, or powder.

[0012] According to another embodiment of the present invention, a primer for identifying the authentic quality of Dendrobium officinale is provided, wherein,

[0013] Identification primers include forward and reverse primer pairs;

[0014] The nucleotide sequence of the forward primer is shown in SEQ ID No. 2, and the nucleotide sequence of the reverse primer is shown in SEQ ID No. 3.

[0015] According to another embodiment of the present invention, a molecular identification method for the authentic quality of Dendrobium officinale is provided, comprising:

[0016] RNA was extracted from the Dendrobium nobile specimens to be tested, and genomic DNA was removed.

[0017] RNA is reverse transcribed to obtain cDNA;

[0018] Using quantitative real-time PCR, cDNA was used as a template, the 18S site was used as an internal reference gene, and primers shown in SEQ ID No. 2 and SEQ ID No. 3 were used for amplification to obtain fluorescent signals.

[0019] The authentic quality of the Dendrobium officinale to be tested was determined based on the fluorescence signal.

[0020] According to an embodiment of the present invention, when the ΔCt value obtained from the fluorescence signal is below a first preset value, the Dendrobium to be tested is determined to be a Dendrobium under semi-wild cultivation conditions of superior quality.

[0021] If the ΔCt value obtained from the fluorescence signal is above the second preset value, the Dendrobium to be tested is determined to be a secondary-grade, non-wild-cultivated Dendrobium huoshanense.

[0022] Preferably, when the 18S site is used as the internal reference gene, the first preset value is 15.5 and the second preset value is 16.

[0023] According to an embodiment of the present invention, the Dendrobium species to be tested is Dendrobium huoshanense, other Dendrobium species, or a hybrid of Dendrobium huoshanense and other Dendrobium species; other Dendrobium species are any one of the following: Dendrobium officinale, Dendrobium huangshanense, Dendrobium slender stem, Dendrobium nanheense, Dendrobium chrysanthum, Dendrobium chrysanthum, Dendrobium chrysanthum, Dendrobium sparse flower, and Dendrobium cups.

[0024] According to another aspect of the present invention, an identification kit is provided, comprising primers shown in SEQ ID No. 2 and SEQ ID No. 3, the identification kit being used to identify the quality of Dendrobium officinale.

[0025] According to embodiments of the present invention, the identification kit further includes a fluorescent dye, DNA polymerase, and dNTPs.

[0026] According to embodiments of the present invention, based on the principles of epigenetics, environmentally relevant molecular markers were discovered in Dendrobium growing in different environments. Using these markers for quantitative real-time PCR, the growth environment of Dendrobium materials can be distinguished within one day. The procedure is simplified, easy to operate, and cost-controllable, providing an objective and qualitative detection method for the authentic quality of Dendrobium. Attached Figure Description

[0027] The above and other objects, features and advantages of the present invention will become more apparent from the following description of embodiments of the invention with reference to the accompanying drawings, in which:

[0028] Figure 1 This is a comparison chart showing the results of fluorescence quantitative PCR detection of the quality of Dendrobium officinale from Huoshan in an embodiment of the present invention. Detailed Implementation

[0029] Hereinafter, embodiments of the present invention will be described with reference to the accompanying drawings. However, it should be understood that these descriptions are exemplary only and are not intended to limit the scope of the invention. In the following detailed description, numerous specific details are set forth to provide a thorough understanding of the embodiments of the invention for ease of explanation. However, it will be apparent that one or more embodiments may be practiced without these specific details. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concept of the invention.

[0030] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "comprising" as used herein indicates the presence of features, steps, or operations, but does not exclude the presence or addition of one or more other features.

[0031] When using expressions such as "at least one of A, B, and C," the expression should generally be interpreted in accordance with the meaning commonly understood by a person skilled in the art (e.g., "a system having at least one of A, B, and C" should include, but is not limited to, systems having A alone, having B alone, having C alone, having A and B, having A and C, having B and C, and / or having A, B, and C, etc.). When using expressions such as "at least one of A, B, or C," the expression should generally be interpreted in accordance with the meaning commonly understood by a person skilled in the art (e.g., "a system having at least one of A, B, or C" should include, but is not limited to, systems having A alone, having B alone, having C alone, having A and B, having A and C, having B and C, and / or having A, B, and C, etc.).

[0032] In the process of realizing the concept of this invention, it was discovered that 15 local standards have been established for the quality testing methods of Dendrobium huoshanense, including morphological identification and molecular identification of Dendrobium huoshanense. Among them, "DB34 / T 486-2016 Dendrobium huoshanense" provides a detailed description of the plant morphology of Dendrobium huoshanense, and "DB34 / T 2938-2017 Technical Specification for Quality Testing of Dendrobium huoshanense" specifies in detail the sensory and physicochemical indicators of Dendrobium huoshanense. "DB34 / T 3244~2018 Technical Specification for Molecular Identification of Dendrobium huoshanense" uses molecular methods to identify Dendrobium huoshanense and can be used for qualitative molecular identification between Dendrobium huoshanense and Dendrobium nobile, Dendrobium slender stem, Dendrobium officinale, and Dendrobium chrysanthum. This method uses three pairs of primers for species identification of *Dendrobium huoshanense*. Primers TY2s and TY2a are used to detect template quality, while CP2s and CP2a are specific primers that amplify *Dendrobium huoshanense*, although *Dendrobium slender-stemmed* can also be amplified. Sequencing of the PCR fragments amplified by HuoS and HuoA reveals *Dendrobium huoshanense* with a G at position 56. *Dendrobium huoshanense* was included for the first time in the 2020 edition of the Chinese Pharmacopoeia. PCR-RFLP technology was used for identification of *Dendrobium huoshanense*. The sample DNA template was amplified using the identification primers, and the PCR product was digested with Alu I restriction enzyme at 37°C for 30 minutes. Standard *Dendrobium huoshanense* and sterile ultrapure water were used as positive and blank controls, respectively. The digestion products were subjected to agarose gel electrophoresis, and the electrophoresis results were examined using a gel imaging system. In the gel electrophoresis pattern of Dendrobium huoshanense, a single DNA band should appear at approximately 100-200 bp at the corresponding position as in the control drug's gel electrophoresis pattern, and the PCR product and enzyme digestion product bands should be in the same position. The blank control should show no band. Besides the techniques used in the two standards mentioned above, molecular marker techniques for Dendrobium identification include Random Amplified Polymorphic DNA (RAPD), Sequence Related Amplified Polymorphism (SRAP), Simple Sequence Repeat (SSR), Target Start Codon Polymorphism (SCoT), and gene chips. Identification can also be achieved using introns in the matK, rbcL, and rpoC genes of the Dendrobium chloroplast genome and the nad1 gene in the mitochondria.

[0033] The molecular identification methods in the 2020 edition of the Chinese Pharmacopoeia, as well as molecular techniques such as RAPD, SRAP, and SSR, can distinguish *Dendrobium huoshanense* from other *Dendrobium* varieties, but they cannot be correlated with the growth environment of *Dendrobium huoshanense*. Therefore, the aforementioned molecular identification methods cannot provide information related to the growth environment of *Dendrobium huoshanense*. This invention provides an objective, rapid, and effective method for identifying the authentic quality of *Dendrobium huoshanense*, which is of great significance to the development of the *Dendrobium* industry.

[0034] Specifically, according to one embodiment of the present invention, an application of a specific DNA molecule in identifying the authentic quality of Dendrobium officinale is provided, wherein...

[0035] The specific DNA molecule includes the sequence shown in SEQ ID NO.1.

[0036] The sequence shown in SEQ ID NO.1:

[0037]

[0038] According to embodiments of the present invention, based on the principles of epigenetics, environmentally relevant molecular markers were discovered in Dendrobium growing in different environments. Using these markers for quantitative real-time PCR, the growth environment of Dendrobium materials can be distinguished within one day. The procedure is simplified, easy to operate, and cost-controllable, providing an objective and qualitative detection method for the authentic quality of Dendrobium.

[0039] According to embodiments of the present invention, the authentic quality includes Dendrobium officinale of superior authentic quality grown under semi-wild cultivation conditions and Dendrobium officinale of secondary authentic quality grown without semi-wild cultivation conditions.

[0040] According to an embodiment of the present invention, Dendrobium uses "air roots" to fix free nitrogen in the air to absorb nutrients. It decomposes when buried in soil and is intolerant of water immersion, requiring attachment to rock walls, gravel, and rock crevices for growth. Simulated wild cultivation completely mimics the wild ecological environment of medicinal herbs, without pesticides, chemical fertilizers, or excessive human intervention. Only a certain proportion of weeds are selectively removed, not all of them. Under simulated wild cultivation conditions, light intensity, light duration, diurnal temperature range, air humidity, seasonal changes, and air composition are completely consistent with those in the wild.

[0041] Furthermore, the semi-wild cultivation method has a significant positive impact on the quality of Dendrobium officinale. Semi-wild cultivated Dendrobium officinale is closer in appearance to its wild counterpart, has a higher content of key medicinal components, and offers greater economic benefits and superior efficacy. Dendrobium officinale cultivated using methods other than semi-wild cultivation or greenhouse cultivation shows significant differences compared to purely wild Dendrobium officinale in terms of alcohol-soluble extracts, polyphenols, and flavonoid content, resulting in lower economic benefits and quality. Distinguishing between semi-wild and greenhouse-cultivated Dendrobium officinale is crucial for ensuring the quality of medicinal materials, improving economic benefits, protecting the ecological environment, and meeting consumer demand.

[0042] According to an embodiment of the present invention, the Dendrobium is Dendrobium huoshanense; the specific DNA molecule related to the authentic quality of Dendrobium huoshanense is the upstream promoter region 42078801~42089000bp located at the serine kinase coding site on chromosome 9 of Dendrobium huoshanense.

[0043] According to an embodiment of the present invention, the genome data of *Dendrobium huoshanense* has been assembled and published by NCBI, with the accession number GCA_016618105.1. The omics analysis of the present invention uses this genome as a reference. The specific DNA molecule located upstream of the serine kinase coding site on chromosome 9 of *Dendrobium huoshanense*, from 42078801 to 42089000 bp, is labeled as site 8801.

[0044] According to an embodiment of the present invention, identifying the authentic quality of Dendrobium includes identifying fresh Dendrobium stems, dried stems, Dendrobium capsules, or powder.

[0045] According to embodiments of the present invention, since the identification of the authentic quality of Dendrobium is carried out through specific DNA molecules, it is not limited by the morphological characteristics and developmental stage of the species, and can efficiently and accurately identify its authentic quality.

[0046] According to another aspect of the present invention, a primer for identifying the authentic quality of Dendrobium officinale is provided. The primer includes a forward primer pair and a reverse primer pair. The target sequence of the primer pair is shown in SEQ ID NO.1; the nucleotide sequence of the forward primer is shown in SEQ ID No.2; and the nucleotide sequence of the reverse primer is shown in SEQ ID No.3.

[0047] Forward primer SEQ ID No. 2: TTGCTGAAGCTGCTGATTCATC;

[0048] Reverse primer SEQ ID No. 3: CTTCCTCTACACCATCTTTGTTTGTT.

[0049] In some specific embodiments of the present invention, primer pairs can be designed based on the target sequence shown in SEQ ID NO.1 to achieve the purpose of amplifying the target sequence shown in SEQ ID NO.1.

[0050] According to another aspect of the present invention, a molecular identification method for the authentic quality of Dendrobium officinale is provided, comprising:

[0051] Step S1: Extract RNA from the Dendrobium nobile to be tested and remove genomic DNA;

[0052] Step S2: Reverse transcribe the RNA to obtain cDNA;

[0053] Step S3: Using quantitative real-time PCR, cDNA was used as a template, the 18S site was used as an internal reference gene, and primers shown in SEQ ID No. 2 and SEQ ID No. 3 were used for amplification to obtain a fluorescent signal.

[0054] Step S4: Determine the authentic quality of the Dendrobium to be tested based on the fluorescence signal.

[0055] According to an embodiment of the present invention, in step S1, the RNA of the Dendrobium nobile to be tested can be extracted using a commercially available kit, and genomic DNA and polysaccharides and polyphenols are removed, reducing the influence of polysaccharides and polyphenols on subsequent steps. The RNA extraction method uses a phenol- and chloroform-free reagent, which effectively removes polysaccharides, polyphenols, and other substances, reducing the influence of residual organic matter on subsequent experiments. The amount of RNA extracted per tube is between 50 mg and 150 mg.

[0056] According to an embodiment of the present invention, in step S2, a one-step reverse transcription method can be used to complete the first-strand DNA and cDNA reactions in the same reaction system, which is simple to operate and has a low contamination rate. A micro spectrophotometer can also be used to detect the quality of the cDNA template and determine its concentration.

[0057] According to an embodiment of the present invention, in step S3, a two-step method is used to perform quantitative real-time PCR, which is collected during annealing, using SYBR Green dye and ROX as a fluorescent reference dye.

[0058] Furthermore, specific fluorescent quantitative primers for the 8801ORF1 site can be used, along with SYBR Green fluorescent dye, and the 18S site can be used as an internal reference gene for a three-step fluorescent quantitative PCR.

[0059] According to an embodiment of the present invention, when the ΔCt value obtained from the fluorescence signal is below a first preset value, the Dendrobium to be tested is determined to be a Dendrobium under semi-wild cultivation conditions of superior quality.

[0060] If the ΔCt value obtained from the fluorescence signal is above the second preset value, the Dendrobium to be tested is determined to be a secondary-grade, non-wild-cultivated Dendrobium huoshanense.

[0061] In some specific embodiments of the present invention, when the 18S site is used as an internal reference gene, the first preset value is 15.5 and the second preset value is 16.

[0062] According to embodiments of the present invention, the internal reference gene can be selected from 18S rRNA, β-actin, and GAPDH, etc., and the present invention does not limit this. The first preset value and the second preset value can be determined based on the selected internal reference gene and the actual detection results of the sample.

[0063] According to an embodiment of the present invention, based on the 8801 locus obtained using methylomics differential analysis, and with the 18S gene as an internal reference gene, the expression level of this gene is low in *Dendrobium huoshanense* under non-wild-simulated cultivation conditions such as greenhouse cultivation. In *Dendrobium huoshanense* under semi-wild cultivation conditions, the expression level of this gene is high. Based on this characteristic, quantitative real-time PCR was performed on samples collected in greenhouses and under semi-wild cultivation methods. According to the PCR results, *Dendrobium huoshanense* with a gene expression pattern ΔCt(8801-18s) below 15.5 was identified as having better authentic quality under semi-wild cultivation conditions. *Dendrobium huoshanense* with a gene expression pattern ΔCt(8801-18s) above 16 was identified as having slightly lower authentic quality under non-wild cultivation conditions. The molecular markers provided by this invention are associated with growth environment factors, are screened based on omics data, and require no sequencing, enabling rapid and low-cost detection of the authentic quality of *Dendrobium huoshanense*.

[0064] According to an embodiment of the present invention, the Dendrobium species to be tested is Dendrobium huoshanense, other Dendrobium species, or a hybrid of Dendrobium huoshanense and other Dendrobium species; other Dendrobium species are any one of the following: Dendrobium officinale, Dendrobium huangshanense, Dendrobium slender stem, Dendrobium nanheense, Dendrobium chrysanthum, Dendrobium chrysanthum, Dendrobium chrysanthum, Dendrobium sparse flower, and Dendrobium cups.

[0065] According to an embodiment of the present invention, the specific DNA molecular sequence shown in SEQ ID No.1 belongs to the common sequence of Dendrobium population, and the authenticity and quality of multiple varieties of Dendrobium can be identified based on this specific DNA molecular site.

[0066] According to another aspect of the present invention, an identification kit is provided, comprising primers shown in SEQ ID No. 2 and SEQ ID No. 3, the identification kit being used to identify the quality of Dendrobium officinale.

[0067] According to embodiments of the present invention, by using specific primers, PCR amplification can be performed on specific DNA molecular sites of Dendrobium, thereby accurately identifying the authentic quality of Dendrobium. It can quickly distinguish the authentic quality of different varieties and different forms of Dendrobium, ensuring its quality and medicinal value.

[0068] According to embodiments of the present invention, the identification kit further includes a fluorescent dye, DNA polymerase, and dNTPs.

[0069] The present invention will be further explained in conjunction with specific embodiments below. Unless otherwise stated, all reagents used in the following embodiments are commercially available reagents.

[0070] Example 1: RNA extraction and purification from Dendrobium huoshanense

[0071] Step 1: Sample collection and pretreatment: Remove surface dust from the Dendrobium huoshanense samples, wrap them in aluminum foil and seal them in self-sealing bags, then label them and quickly immerse them in liquid nitrogen for flash freezing. Transport them with dry ice or liquid nitrogen.

[0072] Step 2: After grinding the plant leaves with liquid nitrogen, collect ≤100mg of plant sample into a centrifuge tube. Add 500µl of lysis buffer / 10µl of β-mercaptoethanol mixture and vortex immediately. Note: Add 20µl of β-mercaptoethanol per 1ml of lysis buffer. Pre-mix by incubating in a 55℃ water bath for 1-3 minutes and centrifuging at 10,000×g at room temperature for 5 minutes.

[0073] Step 3: Insert the DNA adsorption filter column into the 2ml collection tube to adsorb and remove transgenic DNA. Transfer the supernatant to the DNA adsorption column and centrifuge at 14,000×g for 2 minutes at room temperature.

[0074] Step 4: Add an equal volume of isopropanol buffer to the filtrate and vortex to mix for 20 seconds.

[0075] Step 5: Insert the RNA adsorption column into a 2ml collection tube, transfer half of the mixture (<700µl) onto the RNA adsorption column, centrifuge at 12,000×g at room temperature for 1 min, and discard the filtrate.

[0076] Step 6: Repeat step 5 until all the mixture has been transferred through the column.

[0077] Step 7: Insert the RNA adsorption column into the same 2ml collection tube, add 400µl of ethanol washing buffer to the RNA adsorption column, centrifuge at 10,000×g at room temperature for 30s, and discard the filtrate.

[0078] Step 8: Insert the RNA adsorption column into the same 2ml collection tube, add 500µl of ethanol washing buffer to the RNA adsorption column, centrifuge at 10,000×g at room temperature for 30s, and discard the filtrate.

[0079] Step 9: Repeat step 8.

[0080] Step 10: Insert the RNA adsorption column into the same 2ml collection tube, centrifuge at 10,000xg for 2min at room temperature, and then spin dry the RNA adsorption column matrix.

[0081] Step 11: Place the RNA adsorption column into a new 1.5ml centrifuge tube, take 50~100µl of DEPC water (preheat the DEPC water to 65℃ before use), accurately add it to the center of the RNA adsorption column membrane, incubate the column at 65℃ for 2 min, centrifuge at 10,000×g at room temperature for 1 min, and use fresh DEPC water to elute the RNA a second time.

[0082] Example 2: Detection of the quality of Dendrobium officinale from Huoshan using real-origin fluorescent quantitative PCR

[0083] The template RNA obtained by the method in Example 1 was added to the reverse transcription system from Dendrobium huoshanense samples collected in a semi-wild planting environment and Dendrobium huoshanense samples grown in a greenhouse, respectively, and the first-strand cDNA was synthesized using random reverse primers and OligodT.

[0084] After incubating at 45°C for 15 minutes, the mixture was incubated at 37°C for 30 minutes, and then at 85°C for 5 seconds. The synthesized cDNA template was then added to the forward primer (SEQ ID No. 2), reverse primer (SEQ ID No. 3), and other reaction components, including dNTPs and DNase. The mixture was then centrifuged and loaded into the instrument.

[0085] The qPCR steps are: 94℃ for 30s; (94℃ for 5s, 55℃ for 15s, 72℃ for 15s) for 40 cycles.

[0086] The results are shown in the table below:

[0087]

[0088] To verify the quality of the primers, a melting curve experiment was performed after the PCR stage.

[0089] Figure 1 This is a comparison chart showing the results of fluorescence quantitative PCR detection of the quality of Dendrobium officinale from Huoshan in an embodiment of the present invention.

[0090] according to Figure 1 It can be seen that by using primers designed for the specific DNA molecule of this invention for fluorescence quantitative PCR, there is a clear distinction between Dendrobium huoshanense grown in a semi-wild environment and Dendrobium huoshanense grown in a greenhouse. Therefore, the specific DNA molecule of this invention can be used to identify the authentic quality of Dendrobium huoshanense.

[0091] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of a specific DNA molecule in identifying the authentic quality of Dendrobium officinale from Huoshan, wherein, The specific DNA molecule is the sequence shown in SEQ ID NO.

1.

2. The application according to claim 1, wherein, The term "authentic quality" includes Dendrobium huoshanense of superior quality grown under semi-wild cultivation conditions and Dendrobium huoshanense of secondary quality grown without semi-wild cultivation conditions.

3. The application according to claim 1, wherein, The specific DNA molecule associated with the authentic quality of Dendrobium huoshanense is the upstream promoter region 42078801~42089000bp located at the serine kinase coding site on chromosome 9 of Dendrobium huoshanense.

4. The application according to claim 1 or 2, wherein, The identification of the authentic quality of Dendrobium huoshanense includes the identification of the quality of fresh stems, dried stems, granules, or powder of Dendrobium huoshanense.

5. A molecular identification method for the authentic quality of Dendrobium huoshanense, comprising: RNA was extracted from the Dendrobium huoshanense specimens and genomic DNA was removed. RNA is reverse transcribed to obtain cDNA; Fluorescent signals were obtained by amplification using real-time PCR with cDNA as a template and the primers shown in SEQ ID No. 2 and SEQ ID No.

3. The authentic quality of the Dendrobium huoshanense to be tested was determined based on the fluorescence signal. If the ΔCt value obtained from the fluorescence signal is below a first preset value, the Dendrobium huoshanense to be tested is determined to be Dendrobium huoshanense of superior quality under semi-wild cultivation conditions; If the ΔCt value obtained based on the fluorescence signal is above the second preset value, the Dendrobium huoshanense to be tested is determined to be a secondary-grade, non-wild-cultivated Dendrobium huoshanense of authentic quality. as well as When using the 18S site as an internal reference gene, the first preset value is 15.5 and the second preset value is 16.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) marker for identifying dendrobium huoshanense C.Z. Tang et S.J.Cheng and molecular detection method for SNP marker

    CN105779628A

  • Rapid soybean DNA obtaining method for PCR amplification and PCR amplification method

    CN111455025A