Construction and application of L-malic acid producing issatchenkia orientalis strain
Through metabolic engineering, the Oriental Issa yeast strain is transformed, and the cytoplasmic rTCA cycle synthesis pathway is strengthened, which solves the problems of complex L-malic acid production process, high cost and environmental pollution, and achieves efficient and low-pollution L-malic acid production, with significantly improved output and conversion rate.
Patent Information
- Application Number
- CN202510256836.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-05
- Publication Date
- 2025-05-30
AI Technical Summary
Traditional L-malic acid production process is complex, costly and environmentally polluted, and existing microbial fermentation technology is difficult to achieve efficient and low-pollution production.
Through metabolic engineering, the Oriental Issa yeast strain was modified, the genes related to ethanol and lactic acid production were knocked out, pyruvate carboxylase, malate dehydrogenase and phosphoenol pyruvate carboxylase gene were introduced to strengthen the cytoplasmic rTCA cycle synthesis pathway, and the L-malic acid production was optimized through CRISPR-Cas9 gene editing technology.
The yeast strain that achieved high yield of L-malic acid was achieved. The L-malic acid yield in the 5L fermenter reached 140.16g/L, the glucose conversion rate was 87.82%, and the optical purity of the product reached more than 99%.
Smart Images

Figure CN120059987A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the construction and application of a strain of Issatchenkia orientalis producing L-malic acid, and belongs to the field of microbial technology. Background Art
[0002] L-malic acid (C4H6O5) is an important organic acid, also known as 2-hydroxybutanedioic acid, which is a white crystal or powder and is widely used in the fields of food, beverage, medicine, and cosmetics. As a key intermediate in the citric acid cycle (TCA cycle), L-malic acid plays an important role in energy and carbon source metabolism. In addition, L-malic acid is also a potential bio-based chemical, which can be used to synthesize biodegradable materials, green plastics and other alternative petroleum-based products, and has significant industrial and environmental protection value.
[0003] Traditional production of L-malic acid mainly relies on chemical synthesis or extraction, but its process is complex, costly and prone to environmental pollution. Microbial fermentation, due to its green, sustainable and low-pollution characteristics, has gradually become an emerging production method. Currently, a variety of microorganisms have been studied for the production of L-malic acid, such as fungi (Aspergillus), bacteria (Escherichia coli) and yeast (Saccharomyces cerevisiae). Issatchenkia orientalis, as a non-traditional yeast, shows industrial fermentation potential due to its strong acid resistance and good environmental adaptability, and is particularly suitable for the production of various organic acids. In addition, Issatchenkia orientalis can be metabolically engineered through CRISPR-Cas9 gene editing to further improve the production efficiency of L-malic acid. Summary of the Invention
[0004] The present invention provides a strain of Issatchenkia orientalis producing L-malic acid, named Issatchenkia orientalis FIO-10. Through metabolic engineering transformation, the cytoplasmic rTCA metabolic pathway of the Issatchenkia orientalis strain is modified, the pyruvate decarboxylase encoding gene PDC1 is knocked out to reduce ethanol accumulation, the glycerol dehydrogenase GPD1 is knocked out to reduce glycerol accumulation, and the lactate dehydrogenase D-LDH 3 、D-LDH 2 and L-LDH 2To reduce lactic acid production; screened and integrated the pyruvate carboxylase gene AfPYC from Aspergillus flavus, the malate dehydrogenase gene CgMDH from Corynebacterium glutamicum, and the phosphoenolpyruvate carboxylase EcPPC from Escherichia coli, thereby enhancing the cytosolic rTCA cycle synthesis pathway; during gene editing, the number of the same gRNA in the genome was increased by pre-integrating a landing pad in the genome, and through one gene editing, the genomic copy numbers of AfPYC, CgMDH, and EcPPC were increased to 2, 3, and 1 respectively to optimize L-malate production.
[0005] The present invention also provides a genetically engineered L-malate-producing yeast strain, which uses a yeast strain as a chassis cell, and has or has enhanced malate transporter activity such as SpMAE1 protein activity; and has or has enhanced malate dehydrogenase activity; and has or has enhanced pyruvate decarboxylase activity;
[0006] Optionally, it also has reduced or inactivated at least one of the following:
[0007] (i) The URA3 gene on the genome with reduced or inactivated activity to obtain a uracil auxotrophic strain, (ii) the pyruvate decarboxylase gene PDC1 on the genome with reduced or inactivated activity, (iii) the endogenous dicarboxylate inner transporter JEN2-1 on the genome with reduced or inactivated activity, (iv) the glycerol dehydrogenase-encoding gene GPD1 on the genome with reduced or inactivated activity;
[0008] Preferably, the malate transporter is selected from the SpMAE1 protein;
[0009] Preferably, the pyruvate decarboxylase is from Aspergillus flavus;
[0010] Preferably, the malate dehydrogenase is from Corynebacterium glutamicum.
[0011] The present invention provides a recombinant yeast strain using a yeast strain as a chassis cell, which overexpresses the native pyruvate carboxylase and malate dehydrogenase, and expresses the malate dehydrogenase from Corynebacterium glutamicum, the pyruvate carboxylase from Aspergillus flavus, and the dicarboxylate exporter from Schizosaccharomyces pombe; or the recombinant yeast strain uses a yeast strain as a chassis cell, which overexpresses the native pyruvate carboxylase and malate dehydrogenase, and expresses the malate dehydrogenase from Corynebacterium glutamicum, the pyruvate carboxylase from Aspergillus flavus, the dicarboxylate exporter from Schizosaccharomyces pombe, and the phosphoenolpyruvate carboxylase from Escherichia coli;
[0012] Meanwhile, the recombinant yeast strain also contains the following modifications:
[0013] Insert landing pad 1 shown in SEQ ID NO.1 and landing pad 2 shown in SEQ ID NO.3 into the yeast genome; and have the following genes with reduced activity or inactivated:
[0014] (i) Reduce the activity or inactivate the URA3 gene on the genome to obtain a uracil auxotrophic strain, (ii) reduce the activity or inactivate the pyruvate decarboxylase gene PDC1 on the genome, (iii) reduce the activity or inactivate the endogenous dicarboxylic acid inner transporter JEN2-1 on the genome, (iv) reduce the activity or inactivate the glycerol dehydrogenase-encoding gene GPD1 on the genome.
[0015] In one embodiment of the present invention, overexpressing the native pyruvate carboxylase means overexpressing the native pyruvate carboxylase IoPYC on the yeast genome, and the integrated copy number is 2 or more;
[0016] In one embodiment of the present invention, when the native pyruvate carboxylase IoPYC is overexpressed on the yeast genome, the native pyruvate carboxylase IoPYC is integrated into the EG4 site and / or the pyruvate decarboxylase gene PDC1 site on the genome;
[0017] In one embodiment of the present invention, overexpressing the native malate dehydrogenase means overexpressing the native malate dehydrogenase IoMDH 3 On the yeast genome, and the integrated copy number is 1 or more; further, the native malate dehydrogenase IoMDH 3 When overexpressed on the yeast genome, the native malate dehydrogenase is integrated into the EG14 site on the genome;
[0018] In one embodiment of the present invention, expressing the malate dehydrogenase derived from Corynebacterium glutamicum means integrating the malate dehydrogenase CgMDH derived from Corynebacterium glutamicum into the yeast genome, and the integrated copy number is 3 or more; further, when the malate dehydrogenase CgMDH derived from Corynebacterium glutamicum is integrated into the yeast genome, the malate dehydrogenase CgMDH derived from Corynebacterium glutamicum is integrated into the lactate dehydrogenase D-LDH 2 、GPD1 and JEN2-1 sites;
[0019] In one embodiment of the present invention, expressing the pyruvate carboxylase derived from Aspergillus flavus means integrating the pyruvate carboxylase AfPYC derived from Aspergillus flavus into the yeast genome, and the integrated copy number is 2 or more; further, when the pyruvate carboxylase AfPYC derived from Aspergillus flavus is integrated into the yeast genome, the pyruvate carboxylase AfPYC derived from Aspergillus flavus is integrated into the GD5 site on the genome;
[0020] In one embodiment of the present invention, the expression of the dicarboxylic acid exporter derived from Schizosaccharomyces pombe is achieved by integrating the dicarboxylic acid exporter SpMae1 derived from Schizosaccharomyces pombe into the genome of the yeast, and the number of integrated copies is 1 or more; further, the integration of the dicarboxylic acid exporter SpMae1 derived from Schizosaccharomyces pombe into the genome of the yeast is to integrate the dicarboxylic acid exporter SpMae1 derived from Schizosaccharomyces pombe into the GD21 locus on the genome;
[0021] In one embodiment of the present invention, the expression of the phosphoenolpyruvate carboxylase derived from Escherichia coli is achieved by integrating the phosphoenolpyruvate carboxylase EcPPC derived from Escherichia coli into the genome of the yeast, and the number of integrated copies is 1 or more; further, the integration of the phosphoenolpyruvate carboxylase derived from Escherichia coli into the genome of the yeast is to integrate the phosphoenolpyruvate carboxylase derived from Escherichia coli into the lactate dehydrogenase L-LDH 2 locus;
[0022] In one embodiment of the present invention, the insertion site of the landing pad 1 is the lactate dehydrogenase D-LDH on the genome 3 locus;
[0023] In one embodiment of the present invention, the insertion site of the landing pad 2 is the endogenous dicarboxylic acid importer JEN2-1 locus and / or the glycerol dehydrogenase encoding gene GPD1 locus on the genome.
[0024] In one embodiment of the present invention, the Uniprot number of the native pyruvate carboxylase IoPYC is: A0A099P575; the Uniprot number of the native malate dehydrogenase IoMDH 3 is: A0A099NXM1;
[0025] The Uniprot number of the malate dehydrogenase CgMDH derived from Corynebacterium glutamicum is: Q8NN33 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with it and having malate dehydrogenase activity;
[0026] The Uniprot number of the pyruvate carboxylase AoPYC derived from Aspergillus flavus is: I8TVE3 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with it and having pyruvate decarboxylase activity;
[0027] The Uniprot number of the dicarboxylic acid exporter derived from Schizosaccharomyces pombe is: P50537 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity thereto and having exporter activity.
[0028] The Uniprot number of the phosphoenolpyruvate carboxylase EcPPC derived from Escherichia coli is: P0ABQ0 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity thereto and having phosphoenolpyruvate carboxylase activity.
[0029] In one embodiment of the present invention, the yeast uses Issatchenkia orientalis, Pichia pastoris, Candida sp. or Rhodotorula sp. as host cells;
[0030] In one embodiment of the present invention, the host cell is Issatchenkia orientalis; further, the host cells include, but are not limited to, Issatchenkia orientalis CICC 33427, Issatchenkia orientalis CICC 32694, Issatchenkia orientalis CICC1934.
[0031] In one embodiment of the present invention, the lactate dehydrogenase gene D-LDH 3 (Uniprot: A0A1V2LTZ5)
[0032] The sequence of the EG4 site is: gtcgctgtcacgggatcacg; the sequence of the GD5 site on the genome is: ctccgtatggctaagagtgcagg, the sequence of the GD21 site is: ccatacgcaacaggtattaaaga; the sequence of the EG14 site is: cgtgtagtggttagac; the D-LDH 2 site sequence is cctcattccagctatgcaagaat; the L-LDH 2 site sequence is gaattcctggtgcaacacaatgg;
[0033] The NCBI number at the PDC1 locus of the pyruvate decarboxylase gene is: XM_029463167.1;
[0034] The lactate dehydrogenase D-LDH 3Uniprot of the locus: A0A1V2LTZ5; the NCBI number of the endogenous dicarboxylic acid inner transporter JEN2-1 locus is: XM_029463385.1; the NCBI number of the glycerol dehydrogenase encoding gene GPD1 locus is: XM_029463167.1;
[0035] The nucleotide sequence of CgMDH is shown in SEQ ID NO.5; the nucleotide sequence of SpMae1 is shown in SEQ ID NO.2, the nucleotide sequence of AfPYC is shown in SEQ ID NO.4, and the nucleotide sequence of EcPPC is shown in SEQ ID NO.6.
[0036] In one embodiment of the present invention, in the present invention, the above-expressed enzymes can all be expressed using a conventional strong promoter. For example, the native pyruvate carboxylase IoPYC uses the strong promoter P TEF 、P TDH3 for expression; the native malate dehydrogenase IoMDH 3 uses the strong promoter P FBA for expression; the dicarboxylic acid outer transporter SpMae1 from Schizosaccharomyces pombe uses the promoter P shown in SEQ ID NO.7 GMP1 for expression; the malate dehydrogenase CgMDH from Corynebacterium glutamicum uses the promoter P shown in SEQ ID NO.8 IPDC for expression; the pyruvate carboxylase AfPYC from Aspergillus flavus uses the promoter P shown in SEQ ID NO.8 IPDC for expression; the phosphoenolpyruvate carboxylase EcPPC from Escherichia coli uses the promoter P shown in SEQ ID NO.9 SED for expression.
[0037] The present invention also provides a method for constructing a yeast strain with high-yield L-malic acid. The method is to use a yeast strain as the chassis cell, overexpress the native pyruvate carboxylase and malate dehydrogenase, and express the malate dehydrogenase from Corynebacterium glutamicum, the pyruvate carboxylase from Aspergillus flavus, and the dicarboxylic acid outer transporter from Schizosaccharomyces pombe; or the recombinant yeast strain uses a yeast strain as the chassis cell, which overexpresses the native pyruvate carboxylase and malate dehydrogenase, and expresses the malate dehydrogenase from Corynebacterium glutamicum, the pyruvate carboxylase from Aspergillus flavus, the dicarboxylic acid outer transporter from Schizosaccharomyces pombe, and the phosphoenolpyruvate carboxylase from Escherichia coli;
[0038] Meanwhile, the recombinant yeast strain also contains the following modifications:
[0039] Insert landing pad 1 shown in SEQ ID NO.1 and landing pad 2 shown in SEQ ID NO.3 into the yeast genome; and have the following genes with reduced activity or inactivated:
[0040] (i) Reduce the activity or inactivate the URA3 gene on the genome to obtain a uracil auxotrophic strain, (ii) reduce the activity or inactivate the pyruvate decarboxylase gene PDC1 on the genome, (iii) reduce the activity or inactivate the endogenous dicarboxylate transporter JEN2-1 on the genome, (iv) reduce the activity or inactivate the glycerol dehydrogenase-encoding gene GPD1 on the genome.
[0041] In one embodiment of the present invention, overexpressing the native pyruvate carboxylase means overexpressing the native pyruvate carboxylase IoPYC in the yeast genome, and the integrated copy number is 2 or more;
[0042] Preferably, overexpressing the native pyruvate carboxylase IoPYC in the yeast genome means integrating the native pyruvate carboxylase IoPYC into the EG4 locus and / or the pyruvate decarboxylase gene PDC1 locus on the genome;
[0043] Preferably, overexpressing the native malate dehydrogenase means overexpressing the native malate dehydrogenase IoMDH 3 in the yeast genome, and the integrated copy number is 1 or more; further, the native malate dehydrogenase IoMDH 3 is overexpressed in the yeast genome by integrating the native malate dehydrogenase into the EG14 locus on the genome;
[0044] Preferably, expressing the malate dehydrogenase derived from Corynebacterium glutamicum means integrating the malate dehydrogenase CgMDH derived from Corynebacterium glutamicum into the yeast genome, and the integrated copy number is 3 or more; further, integrating the malate dehydrogenase CgMDH derived from Corynebacterium glutamicum into the yeast genome means integrating the malate dehydrogenase CgMDH derived from Corynebacterium glutamicum into the lactate dehydrogenase D-LDH 2 locus;
[0045] Preferably, expressing the pyruvate carboxylase derived from Aspergillus flavus means integrating the pyruvate carboxylase AfPYC derived from Aspergillus flavus into the yeast genome, and the integrated copy number is 2 or more; further, integrating the pyruvate carboxylase AfPYC derived from Aspergillus flavus into the yeast genome means integrating the pyruvate carboxylase AfPYC derived from Aspergillus flavus into the GD5 locus on the genome;
[0046] Preferably, the expressed dicarboxylic acid exporter derived from Schizosaccharomyces pombe is obtained by integrating the dicarboxylic acid exporter SpMae1 derived from Schizosaccharomyces pombe into the genome of yeast, and the number of integrated copies is 1 or more; further, the integration of the dicarboxylic acid exporter SpMae1 derived from Schizosaccharomyces pombe into the genome of yeast is achieved by integrating the dicarboxylic acid exporter SpMae1 derived from Schizosaccharomyces pombe into the GD21 locus on the genome;
[0047] Preferably, the expressed phosphoenolpyruvate carboxylase derived from Escherichia coli is obtained by integrating the phosphoenolpyruvate carboxylase EcPPC derived from Escherichia coli into the genome of yeast, and the number of integrated copies is 1 or more; further, the integration of the phosphoenolpyruvate carboxylase derived from Escherichia coli into the genome of yeast is achieved by integrating the phosphoenolpyruvate carboxylase derived from Escherichia coli into the lactate dehydrogenase L-LDH 2 locus;
[0048] Preferably, the locus where the landing pad 1 is inserted is the lactate dehydrogenase D-LDH on the genome 3 locus;
[0049] Preferably, the locus where the landing pad 2 is inserted is the endogenous dicarboxylic acid transporter JEN2-1 locus and / or the glycerol dehydrogenase encoding gene GPD1 locus on the genome.
[0050] In one embodiment of the present invention, the Uniprot number of the native pyruvate carboxylase IoPYC is: A0A099P575; the Uniprot number of the native malate dehydrogenase IoMDH 3 is: A0A099NXM1;
[0051] The Uniprot number of the malate dehydrogenase CgMDH derived from Corynebacterium glutamicum is: Q8NN33 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity thereto and having malate dehydrogenase activity;
[0052] The Uniprot number of the pyruvate carboxylase AoPYC derived from Aspergillus flavus is: I8TVE3 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity thereto and having pyruvate decarboxylase activity;
[0053] The Uniprot number of the dicarboxylic acid exporter derived from Schizosaccharomyces pombe is: P50537 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity thereto and having exporter activity.
[0054] The Uniprot number of the phosphoenolpyruvate carboxylase EcPPC derived from Escherichia coli is: P0ABQ0 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity thereto and having phosphoenolpyruvate carboxylase activity.
[0055] Preferably, the yeast uses Issatchenkia orientalis, Pichia pastoris, Candida sp. or Rhodotorula sp. as host cells;
[0056] Preferably, the host cell is Issatchenkia orientalis; further, the host cells include but are not limited to Issatchenkia orientalis CICC 33427, Issatchenkia orientalis CICC 32694, Issatchenkia orientalis CICC 1934.
[0057] In one embodiment of the present invention, the strain FIO-09 prepared in the present invention is: FIOΔEG4::P TEF -IoPYCΔEG14::P FBA -IoMDH 3 ΔPDC1::P TDH3 -IoPYCΔD-LDH 3 ::landing pad 1ΔGD21::P GMP1 -SpMae1ΔGD21::P GMP1 -SpMae1ΔJEN2-1::landing pad 2ΔGPD1::landing pad 2ΔD-LDH 2 ::P IPDC -CgMDHΔD-LDH 2 ::P IPDC -CgMDHΔD-LDH 2 ::P IPDC -CgMDHΔGD5::P IPDC -AfPYCΔGD5::P IPDC -AfPYC.
[0058] The FIO may be any one of Issatchenkia orientalis CICC 33427, Issatchenkia orientalis CICC 32694, Issatchenkia orientalis CICC 1934.
[0059] In one embodiment of the present invention, the obtained strain FIO-10 is: FIOΔEG4::P TEF -IoPYCΔEG14::P FBA -IoMDH 3 ΔPDC1::P TDH3 -IoPYCΔD-LDH 3 ::landing pad 1ΔGD21::P GMP1 -SpMae1ΔGD21::P GMP1 -SpMae1ΔJEN2-1::landing pad 2ΔGPD1::landing pad 2ΔD-LDH 2 ::P IPDC -CgMDHΔD-LDH 2 ::P IPDC -CgMDHΔD-LDH 2 ::P IPDC -CgMDHΔGD5::P IPDC -AfPYCΔGD5::P IPDC -AfPYCΔL-LDH 2 ::P SED -EcPPC.
[0060] The FIO may be any one of Issatchenkia orientalis CICC 33427, Issatchenkia orientalis CICC 32694, and Issatchenkia orientalis CICC 1934.
[0061] The present invention also provides a method for producing L-malic acid, which includes culturing the genetically modified L-malic acid-producing yeast strain or the genetically modified malic acid-producing yeast strain prepared according to the above method, and fermenting to prepare L-malic acid.
[0062] In one embodiment of the present invention, the method is to inoculate the recombinant yeast strain or the malic acid-producing yeast strain seed solution into a fermentation medium, add 30-150 g / L of calcium carbonate, and react for 48-72 h under the conditions of a temperature of 25-35 °C, a rotation speed of 250-350 rpm, and a pH of 5-6.
[0063] In one embodiment of the present invention, the malic acid-producing yeast strain seed solution is inoculated into a fermentation medium, 30 g / L of calcium carbonate is added, and the reaction is carried out for 72 h under the conditions of a temperature of 30 °C, a rotation speed of 300 rpm, aeration of 0.67 vvm, and a fermentation pH of maintaining pH 5-6 by supplementing calcium carbonate to prepare L-malic acid.
[0064] In one embodiment of the present invention, the method for preparing the seed solution is:
[0065] Pick out well-grown single colonies from the plate and inoculate them into a flask containing YPD medium. Incubate at 300 rpm and 30 °C for about 24 h until the OD 600 value is around 1.0;
[0066] Inoculate the above primary seed liquid into the fermentation medium at an inoculum size of OD 600 = 0.5, and simultaneously add 10 g / L calcium carbonate. Incubate at 200 rpm and 30 °C for about 12 h until the OD 600 value is around 10 - 15;
[0067] The present invention also provides a method for producing L-malic acid, which includes inoculating the above-mentioned Issatchenkia orientalis into a fermentation system and producing L-malic acid through fermentation.
[0068] In one embodiment of the present invention, the fermentation system contains 100 g / L glucose, 5 g / L yeast powder, 2 g / L ammonium sulfate, 1 g / L magnesium sulfate heptahydrate, 0.5 g / L potassium dihydrogen phosphate, 2 g / L uracil, 10 ml / L vitamin solution (inositol 10 g / L, nicotinamide 5 g / L, histidine 5 g / L, threonine 10 g / L, tryptophan 10 g / L, leucine 10 g / L, calcium pantothenate 5 g / L, valine 5 g / L), and 200 μl / L metal ion solution (FeSO 4 7H 2 0 50 g / L, MnSO 4 H 2 O 175 mg / L, CuSO 4 5H 2 O 500 mg / L, CaCl 2 2H 2 0 1 g / L, ZnSO 4 7H 2 0 1 g / L, Na 2 B 4 O 7 10H 2 O 100 mg / L, H 8 MoN 2 O 4 4H 2 O 53.29 mg / L).
[0069] In one embodiment of the present invention, the inoculum size is 1 OD / ml, the fermentation temperature is 30 °C, the fermentation period is 72 hours, the stirring speed is 300 rpm, and the aeration rate is 0.67 vvm.
[0070] During the fermentation process, calcium carbonate is added to maintain the pH at 5.0 to 6.0. When the glucose concentration drops below 10 g / L, glucose with a concentration of 800 g / L is added to make the glucose concentration in the fermentation broth reach approximately 40 g / L.
[0071] The present invention also provides a gene editing technology for rapidly integrating multiple target genes or simultaneously editing multiple gene loci in Issatchenkia orientalis.
[0072] In one embodiment, recognizable gRNA landing pad sequences are pre-integrated into the yeast genome, and through one-time lithium acetate transformation and the CRISPR-Cas9 system, synchronous editing of multiple gene loci can be achieved.
[0073] The present invention also includes the yeast strains, microbial inoculants, method for producing L-malic acid described in claims 1 to 3, and the application of the gene editing technology in Issatchenkia orientalis.
[0074] The present invention also provides the application of the above genetically modified L-malic acid-producing yeast strain or the above method in the preparation of L-malic acid or products containing L-malic acid.
[0075] Beneficial effects
[0076] Using Issatchenkia orientalis FIO as the starting strain, through metabolic engineering transformation, a strain of Issatchenkia orientalis with high-yield L-malic acid production was obtained and named FIO-10. The yield of L-malic acid in a 5 L fermenter can reach 140.16 g / L, and the glucose conversion rate is 87.82%. Brief description of the drawings
[0077] Figure 1 : Determination of the specific activity of pyruvate carboxylase PYC enzyme;
[0078] Figure 2 : In vivo evaluation of malate dehydrogenase MDH (left); Determination of the specific activity of malate dehydrogenase MDH enzyme (right). Detailed implementation manners
[0079] Issatchenkia orientalis FIO involved in the following examples was purchased from: China Center for Industrial Culture Collection, with the original number: CICC 33427. In this article, it is named Issatchenkia orientalis FIO;
[0080] At the same time, other host cells of the present invention can also be Issatchenkia orientalis CICC 32694 and Issatchenkia orientalis CICC 1934, purchased from: China Center for Industrial Culture Collection.
[0081] It should be noted that the following examples only list one or several host cells for the purpose of illustrating that the present invention can be implemented. The host cells of the present invention can be Issatchenkia orientalis CICC 33427, Issatchenkia orientalis 32694 or Issatchenkia orientalis 1934; they can also be Pichia pastoris, Candida sp., Rhodotorula sp.; as long as they are yeast cells, the technical solutions of the present invention can be implemented, and it is not limited to one or several host cells of the present invention. In one embodiment, the yeast strain for producing L-malic acid can be Issatchenkia orientalis, Pichia pastoris, Candida sp., Rhodotorula sp.
[0082] The present invention provides a genetically engineered yeast strain for producing L-malic acid, which is a yeast strain for producing L-malic acid modified by metabolic engineering, and has or has enhanced malate transporter activity such as SpMAE1 protein activity; and has or has enhanced malate dehydrogenase (EC 1.1.1.37) activity; and has or has enhanced pyruvate decarboxylase activity;
[0083] Optionally, it also has at least one of the following with reduced activity or inactivated:
[0084] (i) Reducing the activity or inactivating the URA3 gene on the genome to obtain a uracil auxotrophic strain, (ii) reducing the activity or inactivating the pyruvate decarboxylase gene PDC1 on the genome, (iii) reducing the activity or inactivating the endogenous dicarboxylate inner transporter JEN2-1 on the genome, (iv) reducing the activity or inactivating the glycerol dehydrogenase-encoding gene GPD1 on the genome. The "at least one" includes any 1, 2, 3 or all 3 of the modifications selected therefrom.
[0085] In one embodiment, Issatchenkia orientalis FIO strain is selected as the starting strain, and the yield of L-malic acid is improved by metabolic engineering transformation, which specifically includes the following steps: Initial transformation: First, knockout the URA3 gene to obtain a uracil auxotrophic strain. Reduce ethanol accumulation: Integrate the pyruvate decarboxylase AfPYC from Aspergillus flavus at the pyruvate decarboxylase gene PDC1 locus to reduce ethanol accumulation and enhance the malic acid synthesis pathway. Strengthen the synthesis pathway: By inserting a landing pad sequence into the genome in advance, integrate AfPYC at the neutral sites EG6 and GD5, and integrate the malate dehydrogenase CgMDH from Corynebacterium glutamicum at the neutral site EG14 to further strengthen the synthesis pathway and enhance malic acid synthesis. Improve extracellular transport: Integrate the dicarboxylate exporter SpMae1 of Schizosaccharomyces pombe at the neutral site GD21, and knockout the endogenous dicarboxylate inner transporter JEN2-1 to enhance the extracellular transport of L-malic acid. Optimize the metabolic pathway: Further knockout the glycerol dehydrogenase-encoding gene GPD1 to optimize the malic acid synthesis efficiency.
[0086] In one embodiment, the landing pad sequence rapidly integrates the target gene. (1) Construction of the landing pad sequence: The gRNA sequences of GD5, GD6, and GD21 and their upstream and downstream homologous arms are combined into an expression cassette and inserted into the lactate dehydrogenase D-LDH 3 locus. (2) Yeast transformation: The CRISPR-Cas9 plasmid and the knockout cassette sequence are transformed into the cells by the lithium acetate transformation method. Then, it is spread on the YNB plate, and single colonies are picked for verification after 2-3 days. (3) Screening of positive strains: The single colonies grown on the YNB plate are inoculated into 1 ml of YPD medium, the genomic DNA is extracted, and the gene integration is verified by PCR using specific primers.
[0087] In one aspect, the present invention provides a method for producing L-malic acid, which includes culturing the genetically modified malic acid-producing yeast strain of the present invention or the genetically modified malic acid-producing yeast strain prepared by the method for producing the genetically modified malic acid-producing yeast strain of the present invention under conditions suitable for fermentative production of L-malic acid, optionally including isolating and purifying the produced L-malic acid. Conditions for fermentatively culturing malic acid-producing yeast strains for the production of L-malic acid are known in the art, including, for example, but not limited to, pH, temperature, culture medium components, fermentation time, etc.
[0088] Culture media for fermentatively producing L-malic acid by malic acid-producing yeast strains are known in the art, including, for example, but not limited to, the following fermentation medium: peptone 20 g / L, yeast extract 10 g / L, glucose 20 g / L, adenine 100 mg / L.
[0089] Temperatures for fermentatively producing L-malic acid by malic acid-producing yeast strains are known in the art, such as about 25-37 °C, such as 25 °C, 26 °C, 27 °C, 28 °C, 29 °C, 30 °C, 31 °C, 32 °C, 33 °C, 34 °C, 35 °C, 36 °C, 37 °C. In one embodiment, the malic acid-producing yeast strain of the present invention ferments at 30 °C to produce L-malic acid.
[0090] The malic acid-producing yeast strain of the present invention can ferment at a suitable pH value known in the art.
[0091] In one embodiment, the malic acid-producing yeast strain of the present invention ferments at a pH of 5-6 to produce L-malic acid.
[0092] For the production of L-malic acid, the malic acid-producing yeast strain of the present invention can be fermented for a suitable time, such as about 12 - 96 hours, such as 12 hours, 24 hours, 36 hours, 48 hours, 60 hours, 72 hours, 96 hours. In one embodiment, for the production of L-malic acid, the malic acid-producing yeast strain of the present invention is fermented for about 24 - 72 hours, such as about 30 hours.
[0093] The malic acid-producing yeast strain of the present invention can be fermented under shaking conditions (such as about 100 - 300 rpm, such as 150 rpm, about 200 rpm, about 250 rpm, 250 rpm) to produce L-malic acid. The content of L-malic acid in the fermentation broth can be determined by suitable methods known in the art, such as HPLC.
[0094] The present invention will be further illustrated by the following non-limiting examples. It is well known to those skilled in the art that many modifications can be made to the present invention, and such modifications also fall within the scope of the present invention.
[0095] Unless otherwise specified, the following experimental methods are all conventional methods, and the experimental materials used can be easily obtained from commercial companies unless otherwise specified. The promoter TEF sequence involved in the following examples can directly use the sequence of promoter P TEF already disclosed in the prior art, or the primers in the table can be used to obtain the sequence of promoter P TEF based on the NCBI accession number: ASM305444v1 genomic sequence; the promoter FBAp sequence can directly use the sequence of promoter FBAp already disclosed in the prior art, or the primers in the table can be used to obtain the sequence of promoter FBAp based on the NCBI accession number: ASM305444v1 genomic sequence; the promoter TDH3 sequence can directly use the sequence of promoter TDH3 already disclosed in the prior art, or the primers in the table can be used to obtain the sequence of promoter TDH3 based on the NCBI accession number: ASM305444v1 genomic sequence.
[0096] The media involved in the following examples are as follows:
[0097] YPD medium: peptone 20 g / L, yeast extract 10 g / L, glucose 100 g / L.
[0098] Seed and fermentation medium: 100 g / L glucose, 5 g / L yeast powder, 2 g / L ammonium sulfate, 1 g / L magnesium sulfate heptahydrate, 0.5 g / L potassium dihydrogen phosphate, 2 g / L uracil, 10 ml / L vitamin solution (inositol 10 g / L, nicotinamide 5 g / L, histidine 5 g / L, threonine 10 g / L, tryptophan 10 g / L, leucine 10 g / L, calcium pantothenate 5 g / L, valine 5 g / L), 200 μl / L metal ion solution (FeSO 4 7H 2 O 50 g / L, MnSO 4 H 2 O 175 mg / L, CuSO 4 5H 2 O 500 mg / L, CaCl 2 2H 2 O 1 g / L, ZnSO 4 7H 2 O 1 g / L, Na 2 B 4 O 7 10H 2 O 100 mg / L, H 8 MoN 2 O 4 4H 2 O 53.29 mg / L).
[0099] The detection methods involved in the following examples
[0100] Determination of L-malic acid:
[0101] Standard curve drawing: Prepare an L-malic acid solution with a concentration of 10 g / L, dilute it to 0.2, 0.4, 0.6, 0.8, and 1.0 g / L, and then detect it by high performance liquid chromatography (HPLC). Record the peak area and draw the standard curve. Use the L-malic acid concentration as the abscissa and the peak area as the ordinate to obtain the linear regression equation, and the regression coefficient should reach more than 0.99. Pretreatment of the fermentation broth: Centrifuge the fermentation broth at 12000 r / min for 10 min and take the supernatant. After diluting by an appropriate multiple, filter the sample through a membrane, detect it using HPLC, substitute the obtained peak area into the linear regression equation, and multiply the obtained result by the dilution factor to obtain the L-malic acid concentration in the fermentation broth.
[0102] Chromatographic conditions: The instrument uses a Thermo Fisher high performance liquid chromatograph, and a ChromCore AQ C18 reverse phase chromatographic column (3 μm, 4.6×250 mm) is used; the mobile phase is 0.1 M potassium dihydrogen phosphate, and the pH is adjusted to 2.8 with phosphoric acid; the flow rate is 0.4 mL / min; the detection wavelength is 215 nm; the column temperature is 20 °C to effectively separate malic acid and pyruvic acid.
[0103] Fermentation broth pretreatment: Take the fermentation broth, centrifuge it at 12,000 r / min for 10 minutes, take the supernatant, dilute it to an appropriate multiple and filter it through a membrane, then detect it by HPLC, substitute it into the linear regression equation of the standard curve, and multiply the obtained result by the dilution multiple to obtain the L-malic acid concentration in the fermentation broth.
[0104] Determination of glucose:
[0105] Fermentation broth pretreatment: Take the fermentation broth and centrifuge it at 12,000 r / min for 10 min to obtain the supernatant. Dilute it to an appropriate multiple and detect the glucose concentration in the fermentation broth with an M-100 biosensor analyzer.
[0106] The method for fermenting the strains involved in the following examples is as follows:
[0107] Evaluation of engineering strains in a 5L fermenter
[0108] The specific steps are as follows:
[0109] 1. Seed activation and culture
[0110] Plate activation: Inoculate a loop of the strain from the preservation tube onto a solid YPD plate, incubate at a constant temperature of 30 °C for 30 h;
[0111] Primary seed culture: Pick a well-grown single colony from the plate and inoculate it into a 250 mL baffled Erlenmeyer flask containing 50 mL of YPD medium, shake it on a reciprocating shaker at 200 rpm, incubate at a constant temperature of 30 °C for about 22 h until the OD of the primary seed liquid 600 value is about 10.
[0112] Secondary seed culture: Inoculate the primary seed liquid at an inoculum size of OD 600 = 0.5 into a 500 mL baffled Erlenmeyer flask containing 100 mL of fermentation medium, and simultaneously add 10 g / L calcium carbonate, shake it on a reciprocating shaker at 200 rpm, incubate at a constant temperature of 30 °C for about 12 h until the OD of the secondary seed liquid 600 value is about 10.
[0113] 2. Fermentation culture
[0114] Ferment and culture the recombinant strain in a 5L fermenter. The specific fermentation conditions are as follows: Sterilize the fermentation medium at 115 °C for 15 min. After sterilization, install it on the console, turn on the temperature automatic control, and wait until the temperature cools down to 30 °C before preparing for inoculation.
[0115] With an inoculum size of 1 OD / ml (i.e., the amount of bacteria per ml: OD600 = 1), inoculate the secondary seed solution obtained in step 1 into a fermenter added with a fermentation medium. At the same time, add 30 g / L of calcium carbonate to the fermenter, set the fermentation temperature at 30 °C, and use calcium carbonate to adjust the pH between 5 and 6; the dissolved oxygen condition during fermentation: the ventilation rate is 1 vvm, and the rotation speed is 300 rpm; during fermentation, when the initial glucose in the fermentation medium is reduced to 10 g / L, add a glucose solution of 800 g / L at one time, and control the glucose concentration at 40 g / L.
[0116] The total fermentation time is 72 h.
[0117] The CRISPR-Cas9 gene editing system involved in the following examples:
[0118] In this patent, the CRISPR-Cas9 gene editing system is used to perform gene editing on engineering strains. The plasmids of the used CRISPR-Cas9 gene editing system are all constructed from the plasmid pVT36b-PDC in the article by Teacher Zhao Huimin (An end-to-end pipeline for succinic acid production at an industrially relevant scale using Issatchenkia orientalis). By designing primers to replace the gRNA sequence in this plasmid, this plasmid is enabled to have the ability to cut different gRNA sites in the genome.
[0119] The lithium acetate transformation method involved in the following examples:
[0120] In this study, the CRISPR-Cas9 plasmid and knockout box fragment were transformed into the Yarrowia lipolytica strain using the lithium acetate transformation method, and the transformed strain was verified. The specific operation methods are as follows: (1) Streak the bacterial solution in the glycerol tube on a YPD agar plate and incubate it upside down at 30 °C for 24 h. (2) Inoculate the single colony grown in (1) into 30 ml of YPD liquid medium and culture it for about 20 h. (3) Inoculate the bacterial solution in (2) into 50 ml of YPD liquid at 0.2 OD / ml and wait for the OD to reach 0.8. (4) Centrifuge the bacterial solution in (3) at 2000 rpm for 2 min in a 50 ml centrifuge tube, discard the supernatant, add 50 ml of sterile water to wash the cells, and centrifuge again at 2000 rpm for 2 min, then discard the supernatant. (5) Add 10 ml of sterile water to the cell pellet obtained by centrifugation in (4), aliquot 1 ml into each 1.5 ml hollow tube, centrifuge at 2000 rpm for 2 min, and completely aspirate the supernatant using a pipette. (6) Sequentially add the following reagents (360 μl system): 240 μl of 50% PEG3350; 36 μl of 1 M lithium acetate (adjust the pH to 7.5 with acetic acid); 5 μl of ssDNA (salmon sperm DNA, boil in a water bath for 10 min before use and ice-bath for 10 min), 2 μg of pVT36b plasmid, 8 μg of knockout box fragment; (7) Gently pipette and mix the mixture in (6) using a pipette, and then place it in a 42 °C water bath for heat shock for 1 h; (8) Centrifuge at 2000 rpm for 2 min, discard the supernatant, add 1 ml of YPDplus (purchased from Shanghai Maokang Biotechnology Co., Ltd.), and culture it on a shaking incubator at 200 rpm at 30 °C for 1 h. (9) Centrifuge the post-cultured bacterial solution in (8) at 2000 rpm for 2 min, and spread the cells on a YNB plate. (10) After incubating upside down at 30 °C for 3 - 4 days, pick a single colony and inoculate it into 10 μl of 20 mM NaOH, and perform PCR at 99 °C for 15 min. (11) Pipette 1 μl of the PCR reaction solution in (10) into the Novizan 520 enzyme reaction system, and perform PCR verification using the upstream and downstream primers at the corresponding sites. (12) Extract the genome of the single colony verified correctly in (11) using the yeast genomic DNA extraction kit from Tiangen Biochemical Technology (Beijing) Co., Ltd., amplify the extracted genome using the upstream and downstream primers at the corresponding sites, and send it to Tianlin Biotechnology Co., Ltd. for sequencing. (13) Select the single colony with correct sequencing in (12) and inoculate it into YPD liquid medium, and after overnight culture, streak it on a YNB + 5-FOA plate. (14) Pick the single colonies grown on the plate in (13) and streak them on YNB-URA and YNB+URA plates respectively. The strain that grows on the YNB+URA plate and does not grow on the YNB-URA plate is the strain that has successfully lost the plasmid. (15) Preserve the bacteria that have successfully lost the plasmid in (14), or conduct fermentation evaluation.
[0121] Construction of the gRNA plasmid involved in the following examples:
[0122] (1) Amplify plasmid pVT36b-PDC using primer gRNA-U and the corresponding gRNA primer. (2) Recover the PCR product amplified in (1) by gel extraction. (3) Digest the product recovered by gel extraction in (2) using DPN1 digestion enzyme (purchased from Takara). (4) Perform homologous recombination on the product digested in (3). (5) Transform the product after homologous recombination in (4) into competent E. coli DH5α cells (purchased from Shanghai Sangon Biotech Co., Ltd.) and spread it on an LB + Amp plate. (6) Select a single colony grown after transformation in (5) and send it to Tianlin Biotechnology Co., Ltd. for sequencing. (7) If the colony sequencing result in (6) is correct, the gRNA plasmid can be preserved or plasmid extraction can be performed.
[0123] Plasmid extraction involved in the following examples: Extract using the 201 Plasmid Extraction Kit from Nanjing Novoprotein Scientific Inc. Homologous recombination involved in the following examples: Perform homologous recombination using the homologous recombination enzyme from Nanjing Novoprotein Scientific Inc.
[0124] Fragment amplification involved in the following examples: Perform fragment amplification and fusion PCR using the 520 High-Fidelity Enzyme from Nanjing Novoprotein Scientific Inc.
[0125] PCR product recovery involved in the following examples: First, perform agarose gel electrophoresis on the PCR product, and then recover it using the 301 Gel Extraction Kit from Nanjing Novoprotein Scientific Inc.
[0126] Example 1: Preliminary construction of L-malic acid-producing strain (taking strain CICC 33427 as an example, which was named FIO after purchase)
[0127] I. Construction and genomic integration of the IoPYC gene expression cassette
[0128] 1. Construction of the expression cassette:
[0129] According to the whole-genome sequencing results of wild-type Issatchenkia orientalis FIO, design primers EG4-IoPYC-U and TEFp-D to amplify the promoter TEF sequence, design primers IoPYC-U and IoPYC-D to amplify the native pyruvate carboxylase IoPYC (Uniprot: A0A099P575) sequence of Issatchenkia orientalis, design primers TRP 3 t-U and EG4-IoPYC-D to amplify the terminator TRP 3 t sequence, and then use TEFp, IoPYC, and TRP 3Using three fragments as templates, EG4-IoPYC-U and EG4-IoPYC-D as upstream and downstream primers, the IoPYC gene expression cassette: TEFp-IoPYC-TRP was amplified by fusion PCR. 3 t.
[0130] 2. Construction of pVT36b-EG4 plasmid:
[0131] The pVT36b-PDC plasmid was amplified using the primers gRNA-EG4 and gRNA-U. The PCR reaction solution was subjected to agarose gel electrophoresis and gel extraction successively. Then, the product after gel extraction was digested and subjected to homologous recombination successively. After that, the product after homologous recombination was transformed into competent Escherichia coli DH5α cells, and strains were selected for sequencing verification. Finally, the plasmids of the bacteria with correct sequencing results were extracted to obtain the pVT36b-EG4 plasmid.
[0132] 3. Genome integration:
[0133] The wild-type Issatchenkia orientalis FIO was transformed using the lithium acetate transformation method, and the gene expression cassette TEF-IoPYC-TRP obtained in step 1 3 and the pVT36b-EG4 plasmid obtained in step 2 were introduced. PCR verification was performed using the primers EG4-YZ-U and EG4-YZ-D, and the fragments amplified by the above two primers were sent to Tianlin Biotechnology Co., Ltd. for sequencing. Strains with correct sequencing results were selected for plasmid loss, preservation, and evaluation.
[0134] The results showed that:
[0135] The strain with the native pyruvate carboxylase IoPYC (Uniprot: A0A099P575) successfully integrated at the EG4 locus using the wild-type Issatchenkia orientalis strain FIO as the chassis was named FIO-1 (FIOΔEG4::P TEF -IoPYC). After evaluation in a 5 L fermenter, this strain could produce 3.41 g / L of L-malic acid with a conversion rate of 1.00%.
[0136] Table 1: Primer sequences involved in the construction of the IoPYC gene expression cassette and genome integration
[0137]
[0138]
[0139] II. IoMDH 3 Construction and genome integration of the gene expression cassette
[0140] 1. Construction of the expression cassette:
[0141] Based on the whole-genome sequencing results of wild-type Issatchenkia orientalis FIO, primers EG14-IoMDH 3 -U and FBAp-D were designed to amplify the promoter FBAp sequence. Primers IoMDH 3- U and IoMDH 3 -D were designed to amplify the native malate dehydrogenase IoMDH 3 (Uniprot: A0A099NXM1) sequence of Issatchenkia orientalis. Primers TEFt-U and EG14-IoMDH 3 -D were designed to amplify the terminator TEFt sequence. Then, using FBAp, IoMDH 3 and TEFt as three templates, and EG14-IoMDH 3 -U and EG14-IoMDH 3 -D as upstream and downstream primers, the IoMDH 3 gene expression cassette: FBAp-IoMDH 3 -TEFt was amplified by fusion PCR.
[0142] 2. Construction of pVT36b-EG14 plasmid:
[0143] The pVT36b-PDC plasmid was amplified using primers gRNA-EG14 and gRNA-U. The PCR reaction solution was subjected to agarose gel electrophoresis and gel extraction successively. Then, the products after gel extraction were digested and subjected to homologous recombination successively. After that, the products after homologous recombination were transformed into competent Escherichia coli DH5α cells, and strains were selected for sequencing verification. Finally, the plasmids of the bacteria with correct sequencing results were extracted to obtain the pVT36b-EG14 plasmid.
[0144] 3. Genome integration:
[0145] The Issatchenkia orientalis engineering strain FIO-1 was transformed using the lithium acetate transformation method, and the gene expression cassette FBAp-IoMDH 3 -TEFt obtained in step 1 and the pVT36b-EG14 plasmid obtained in step 2 were introduced. PCR verification was performed using primers EG14-YZ-U and EG14-YZ-D, and the fragments amplified by the above two primers were sent to Tianlin Biotechnology Co., Ltd. for sequencing. Strains with correct sequencing results were selected to lose the plasmid, preserved, and evaluated.
[0146] The results showed that:
[0147] The strain with the native malate dehydrogenase IoMDH 3 (Uniprot: A0A099NXM1) successfully integrated at the EG14 locus with the Issatchenkia orientalis engineering strain FIO-1 as the chassis was named FIO-2 (FIOΔEG4::P TEF-IoPYCΔEG14::P FBA -IoMDH 3 ) After evaluation in a 5 L fermenter, this strain can produce 6.01 g / L of L-malic acid with a conversion rate of 1.40%.
[0148] Table 2: Primers
[0149] Primer sequence <![CDATA[EG14-IoMDH 3 -U]]> ttataacttatattcacaatgattattttctacatgtatagatggacctaatgccatattgtatgtgtattgtattaagt <![CDATA[EG14-IoMDH 3 -D]]> tttccaaaatgatacgcggtcgtgctattatggtttccaaaagtttaatgaaaagtttgtatatgagtagaagtcaaaagc FBAp-D caattccaccggcagcgcctaaaatagtcaccttgaccattgtgtttgtgttgggggtg <![CDATA[IoMDH 3 -U]]> ctactactattactaccacccccaacacaaacacaatggtcaaggtgactattttaggc TEFt-U cccaaaactgtaagtatagccatatagtttaattcctttatactttttataactatttc <![CDATA[IoMDH 3 -D]]> tataaaaagtataaaggaattaaactatatggctatacttacagttttgggccatggac E14-YZ-U ttgaatcacaatcagtcagacatttatagc EG14-YZ-D tggttaagttttgattcttcggattgg gRNA-EG14 cttgctatttctagctctaaaacgtctaaccactacacgctactgcataagacagggttcgaacc gRNA-U gttttagagctagaaatagcaagttaaaataagg gRNA sequence EG14 cgtgtagtggttagac
[0150] III. Construction of the PDC1 gene knockout cassette and knockout of the PDC1 gene.
[0151] 1. Expression cassette construction:
[0152] According to the whole-genome sequencing results of wild-type Issatchenkia orientalis FIO, primers PDC1-IoPYC-U and TDH3-D were designed to amplify the promoter TDH3 sequence, primers IoPYC-2-U and IoPYC-2-D were designed to amplify the IoPYC sequence (Uniprot: A0A099P575), and primers INO1t-U and PDC1-IoPYC-D were designed to amplify the terminator INO1t sequence. Then, using the three fragments of TDH3, IoPYC, and INO1t as templates and PDC1-IoPYC-U and PDC1-IoPYC-D as upstream and downstream primers, the IoPYC gene expression cassette TDH3-IoPYC-INO1t was amplified by fusion PCR.
[0153] 2. Genome integration:
[0154] The engineered strain FIO-2 of Issatchenkia orientalis was transformed using the lithium acetate transformation method, and the gene expression cassette TDH3-IoPYC-INO1t and the plasmid pVT36b-PDC were introduced. PCR verification was performed using primers PDC1-YZ-U and PDC1-YZ-D, and the fragments amplified by the above two primers were sent to Tianlin Biotechnology Co., Ltd. for sequencing. Strains with correct sequencing results were selected to lose the plasmid, preserved, and evaluated.
[0155] The results showed that:
[0156] The strain with the native IoPYC sequence (Uniprot: A0A099P575) successfully integrated at the PDC1 locus using the engineered strain FIO-2 of Issatchenkia orientalis as the chassis was named FIO-3 (FIOΔEG4::P TEF -IoPYCΔEG14::P FBA -IoMDH 3 ΔPDC1::P TDH3 -IoPYC). After evaluation in a 5 L fermenter, this strain can produce 0.93 g / L of L-malic acid with a conversion rate of 0.63%.
[0157] Table 3: Primers
[0158] Primer sequence PDC1-IoPYC-U attttcttcccaataaaacaaaataaaacaaaacacagcaaaacacaaaaattatggatatggagatgaatttgaatttagatttgg IoPYC-2-U atgtcaactgtggaagatcactc TDH3-D gagtgatcttccacagttgacattttttgtaattgtgtttgtttgtgtgtt IoPYC-2-D ccccttgaacaaacatcttgttgtattaagctggcgcttcatctt INO1t-U tacaacaagatgtttgttcaagggg PDC1-IoPYC-D aaagtttagtaattcattttaatgttcattttacattcagatgtcatatctgtcaacaacgtactggaaaat PDC1-YZ-D tcgtagcgtatcgtagcgtac PDC1-YZ-U ccaccaagatgtatggagcaaag
[0159] IV. D-LDH 3 Construction of gene knockout cassette and D-LDH 3 gene knockout.
[0160] 1. Construction of D-LDH 3 gene knockout cassette:
[0161] Tianlin Biotechnology Co., Ltd. synthesized the landing pad 1 sequence and integrated it into the commercial plasmid pUC (purchased from: Tianlin Biotechnology Co., Ltd.). This plasmid was named pUC-landing pad 1. Landing pad 1 contains neutral sites GD5, GD21, EG6 and their 50 bp homologous arms upstream and downstream. Primers D-LDH 3 -U and D-LDH 3 -D were designed to amplify the plasmid pUC-landing pad 1, and the knockout cassette D-LDH 3 ::landing pad 1 was obtained for knocking out the lactate dehydrogenase D-LDH 3 (Uniprot: A0A1Z8JT96).
[0162] 2. Construction of pVT36b-D-LDH 3 Plasmid construction:
[0163] Primers gRNA-D-LDH 3 and gRNA-U were used to amplify the pVT36b-PDC plasmid. The PCR reaction solution was subjected to agarose gel electrophoresis and gel extraction successively. Then, the products after gel extraction were digested and subjected to homologous recombination successively. After that, the products after homologous recombination were transformed into Escherichia coli DH5α competent cells, and strains were selected for sequencing verification. Finally, the plasmids of the bacteria with correct sequencing results were extracted to obtain the pVT36b-D-LDH 3 plasmid.
[0164] 3. Gene knockout:
[0165] The engineered strain FIO-3 of Issatchenkia orientalis was transformed using the lithium acetate transformation method, and the knockout cassette D-LDH 3 ::landing pad 1 and the pVT36b-D-LDH 3 plasmid were introduced. Primers D-LDH 3 -YZ-U and D-LDH 3 -YZ-D were used for PCR verification, and the fragments amplified by the above two primers were sent to Tianlin Biotechnology Co., Ltd. for sequencing. Strains with correct sequencing results were selected to discard the plasmids, and were preserved and evaluated. The detailed experimental procedures can refer to the lithium acetate transformation method in Example 2.
[0166] 4. Using the engineered strain of Yarrowia orientalis FIO-3 as the chassis, the lactate dehydrogenase D-LDH was successfully knocked out 3 (Uniprot: A0A1Z8JT96), and the strain with the landing pad 1 sequence inserted at the original locus was named FIO-4 (FIOΔEG4::P TEF -IoPYCΔEG14::P FBA -IoMDH 3 ΔPDC1::P TDH3 -IoPYCΔD-LDH 3 ::landing pad 1). Evaluated in a 5 L fermenter, this strain can produce 1.68 g / L of L-malic acid with a conversion rate of 0.99%.
[0167] Table 4: Primers
[0168]
[0169]
[0170] V. Construction of the SpMae1 expression cassette and gene integration
[0171] 1. Expression cassette construction:
[0172] The expression cassette of the dicarboxylic acid exporter SpMae1 (Uniprot: P50537) from Schizosaccharomyces pombe was synthesized by Tianlin Biotechnology Co., Ltd. The promoter GMP1p (Table 5), the codon-optimized gene sequence SpMae1 (Table 5), and the terminator INO1t (Table 5) were synthesized and constructed into the GMP1p-SpMae1-INO1t expression cassette, which was then integrated into the commercial plasmid pUC and named plasmid pUC-SpMae1. Primers GD21-SpMae1-U and GD21-SpMae1-D were designed to amplify plasmid pUC-SpMae1 to obtain the GMP1p-SpMae1-INO1t expression cassette.
[0173] 2. Construction of the pVT36b-GD21 plasmid:
[0174] The pVT36b-PDC plasmid was amplified using primers gRNA-GD21 and gRNA-U. The PCR reaction solution was subjected to agarose gel electrophoresis and gel extraction successively. Then, the product after gel extraction was digested and subjected to homologous recombination successively. After that, the product after homologous recombination was transformed into competent Escherichia coli DH5α cells, and strains were selected for sequencing verification. Finally, the plasmid of the bacteria with correct sequencing results was extracted to obtain the pVT36b-GD21 plasmid.
[0175] 3. Genome integration:
[0176] The engineered strain of Issatchenkia orientalis FIO-4 was transformed using the lithium acetate transformation method, and the gene expression cassette GMP1p-SpMae1-INO1t and the plasmid pVT36b-GD21 were introduced. PCR verification was performed using the primers GD21-YZ-U and GD21-YZ-D, PDC1-YZ-U and PDC1-YZ-D, and strains were screened that had integrated the SpMae1 expression cassette at the original GD21 locus in the genome and at the GD21 locus contained in the inserted landing pad 1 sequence after that, that is, strains that had integrally integrated a double-copy SpMae1 expression cassette on the genome were screened. The fragments amplified by the above two pairs of primers were sent to Tianlin Biotechnology Co., Ltd. for sequencing, and the strains with correct sequencing results were plasmid-lost, preserved, and evaluated. 3 Strains in which the SpMae1 expression cassette was integrated at both the GD21 locus in the genome and the GD21 locus contained in the inserted landing pad 1 sequence were selected, that is, strains that had integrally integrated a double-copy SpMae1 expression cassette on the genome were selected, and the fragments amplified by the above two pairs of primers were sent to Tianlin Biotechnology Co., Ltd. for sequencing, and the strains with correct sequencing results were plasmid-lost, preserved, and evaluated.
[0177] The results showed that:
[0178] The strain with the codon-optimized dicarboxylic acid exporter SpMae1 (Uniprot: P50537) from Schizosaccharomyces pombe successfully inserted at two GD21 loci in the genome using the engineered strain of Issatchenkia orientalis FIO-4 as the chassis was named FIO-5 (FIOΔEG4::P TEF -IoPYCΔEG14::P FBA -IoMDH 3 ΔPDC1::P TDH3 -IoPYCΔD-LDH 3 ::landing pad 1ΔGD21::P GMP1 -SpMae1ΔGD21::P GMP1 -SpMae1). This strain had two SpMae1 copy numbers at the genomic level. After evaluation in a 5 L fermenter, this strain could produce 18.44 g / L of L-malic acid with a conversion rate of 10.24%.
[0179] Table 5: Primers
[0180]
[0181]
[0182] VI. Construction of the JEN2-1 knockout cassette and gene knockout
[0183] 1. Construction of the JEN2-1 gene knockout cassette:
[0184] Tianlin Biotechnology Co., Ltd. synthesized the landing pad 2 sequence and integrated it into the commercial plasmid pUC, which was named pUC-landing pad 2. The landing pad 2 contained lactate dehydrogenase D-LDH 2 、D-LDH 4 、L-LDH 2, L-LDH 3 , L-LDH 5 And its upstream and downstream 50 bp homologous arms, primers JEN2-1-U and JEN2-1-D were designed to amplify plasmid pUC-Landing Pad 2, and the knockout cassette JEN2-1::Landing Pad 2 was obtained.
[0185] 2. Construction of pVT36b-JEN2-1 plasmid:
[0186] Primers gRNA-JEN2-1 and gRNA-U were used to amplify pVT36b-PDC plasmid. The PCR reaction solution was subjected to agarose gel electrophoresis and gel extraction successively. Then, the products after gel extraction were digested and subjected to homologous recombination successively. After that, the products after homologous recombination were transformed into Escherichia coli DH5α competent cells, and strains were selected for sequencing verification. Finally, the plasmids of the bacteria with correct sequencing results were extracted to obtain pVT36b-JEN2-1 plasmid.
[0187] 3. Gene knockout:
[0188] The engineered strain of Issatchenkia orientalis FIO-5 was transformed by the lithium acetate transformation method, and the knockout cassette JEN2-1::Landing Pad 2 and pVT36b-JEN2-1 plasmid were introduced. PCR verification was carried out using primers JEN2-1-YZ-U and JEN2-1-YZ-D, and the fragments amplified by the above two primers were sent to Tianlin Biotechnology Co., Ltd. for sequencing. Strains with correct sequencing results were selected for plasmid loss, preservation and evaluation.
[0189] The results showed that the strain with the engineered strain of Issatchenkia orientalis FIO-5 as the chassis, in which the dicarboxylic acid transporter JEN2-1 (Uniprot: A0A099NZE8) was knocked out and the Landing Pad 2 sequence was inserted at this site, was named FIO-6 (FIOΔEG4::P TEF -IoPYCΔEG14::P FBA -IoMDH 3 ΔPDC1::P TDH3 -IoPYCΔD-LDH 3 : Landing Pad 1ΔGD21::P GMP1 -SpMae1ΔGD21::P GMP1 -SpMae1ΔJEN2-1::Landing Pad 2). After evaluation in a 5 L fermenter, this strain could produce 20.80 g / L of L-malic acid with a conversion rate of 11.63%.
[0190] Table 6: Primers
[0191]
[0192] VII. Construction of GPD1 knockout cassette and gene knockout
[0193] 1. Construction of GPD1 gene knockout cassette:
[0194] Tianlin Biotechnology Co., Ltd. synthesized the landing pad 2 sequence and integrated it into the commercial plasmid pUC, which was named pUC-landing pad 2. The landing pad 2 contains lactate dehydrogenase D-LDH 2 , D-LDH 4 , L-LDH 2 , L-LDH 3 , L-LDH 5 and its 50 bp homologous arms upstream and downstream. Primers GPD1-U and GPD1-D were designed to amplify the plasmid pUC-landing pad 2, and the knockout cassette GPD1::landing pad 2 was obtained.
[0195] 2. Construction of pVT36b-GPD1 plasmid:
[0196] The pVT36b-PDC plasmid was amplified using primers gRNA-GPD1 and gRNA-U. The PCR reaction solution was subjected to agarose gel electrophoresis and gel extraction successively. Then, the products after gel extraction were digested and subjected to homologous recombination successively. After that, the products after homologous recombination were transformed into Escherichia coli DH5α competent cells, and strains were selected for sequencing verification. Finally, the plasmids of the bacteria with correct sequencing results were extracted to obtain the pVT36b-GPD1 plasmid.
[0197] 3. Gene knockout:
[0198] The engineered strain of Issatchenkia orientalis FIO-6 was transformed by the lithium acetate transformation method in Example 2, and the knockout cassette GPD1::landing pad 2 and the pVT36b-GPD1 plasmid were introduced. PCR verification was performed using primers GPD1-YZ-U and GPD1-YZ-D, and the fragments amplified by the above two primers were sent to Tianlin Biotechnology Co., Ltd. for sequencing. Strains with correct sequencing results were selected to lose the plasmid, preserved, and evaluated.
[0199] The results showed that the strain with the glycerol dehydrogenase GPD1 (Uniprot: A8W1U0) knocked out and the landing pad 2 sequence inserted at this site using the engineered strain of Issatchenkia orientalis FIO-6 as the chassis was named FIO-7 (FIOΔEG4::P TEF -IoPYCΔEG14::P FBA -IoMDH 3 ΔPDC1::P TDH3 -IoPYCΔD-LDH 3 ::landing pad 1ΔGD21::P GMP1 -SpMae1ΔGD21::P GMP1-SpMae1ΔJEN2-1::landing pad 2ΔGPD1::landing pad 2), evaluated in a 5 L fermenter, this strain can produce 20.30 g / L of L-malic acid with a conversion rate of 19.87%.
[0200] Table 7: Primers
[0201]
[0202] Example 2: Screening of pyruvate carboxylase PYC
[0203] I. Selection of pyruvate carboxylase PYC and plasmid construction
[0204] Pyruvate carboxylases from Issatchenkia orientalis IoPYC, Rhizopus oryzae RoPYC (Uniprot: A0A9P7CFW1), Aspergillus oryzae AoPYC (Uniprot: I8TVE3), Aspergillus flavus AfPYC (Uniprot: B8N9R6), Saccharomyces cerevisiae-derived ScPYC (Unipro: P11154), and Mycobacterium smegmatis-derived MsPYC (Uniprot: Q9F843) were selected respectively. Except for IoPYC from Issatchenkia orientalis which was obtained by amplifying the genome, the remaining PYC were all synthesized by Tianlin Biotechnology Co., Ltd. and codon-optimized. Each IPDCp-PYC-INO1t expression cassette was constructed by connecting with the promoter IPDCp and the terminator INO1t, and this expression cassette was linked to the pVT36b-PDC plasmid vector deleted of the Cas protein to construct plasmids PIOU-IoPYC, PIOU-AoPYC, PIOU-AfPYC, PIOU-RoPYC, PIOU-ScPYC, and PIOU-MsPYC. The 3' ends of the above genes carried 7*his tags.
[0205] II. Purification of pyruvate carboxylase PYC protein:
[0206] 1. Transform each PYC plasmid in (1) into the Issatchenkia orientalis engineering strain FIO-7 using the lithium acetate transformation method to obtain strains carrying each PYC plasmid, named FIO-7-IoPYC, FIO-7-AoPYC, FIO-7-AfPYC, FIO-7-RoPYC, FIO-7-ScPYC, and FIO-7-MsPYC respectively.
[0207] 2. Streak each strain in 1 from the glycerol tube onto a YNB solid agar plate;
[0208] 3. After visible single colonies grow, inoculate the single colonies on the plate into 30 ml of YNB liquid medium and culture at 30 °C in a shaking water bath for 24 h;
[0209] 4. Inoculate the bacterial liquid in step 3 at a concentration of 0.2 OD / ml (i.e., the amount of bacteria per ml: OD600 = 0.2) into 1 L of liquid YNB medium and culture it at 30 °C on a shaking incubator for 12 h;
[0210] 5. Centrifuge the bacterial liquid in step 4 to collect the bacteria, break the cells with a homogenizer and purify the protein.
[0211] III. Determination of specific activity of each PYC protease:
[0212] Reaction system (200 μl), pH 6.00, temperature 30 °C, containing 100 mM Tris-HCl, 120 mM sodium bicarbonate, 1 mM NADH, 50 mM potassium chloride, 500 mM magnesium chloride, 15 mM ATP, 15 U of commercial malate dehydrogenase MDH (purchased from Shanghai Aladdin), 15 mM pyruvate, 1 mg of purified PYC protein. The definition of specific enzyme activity: 1 U is the amount of 1 mg of PYC protein that can consume 1 μmol of pyruvate per second through a cascade reaction with MDH.
[0213] IV. Comparison of specific activities of PYC enzymes ( Figure 1 ):
[0214] By measuring the specific enzyme activity, pyruvate carboxylase AfPYC from Aspergillus flavus has the highest specific enzyme activity (71 U), which is 4.18 times that of the endogenous IoPYC.
[0215] Table 8: Sequences
[0216]
[0217] Example 3: Screening of malate dehydrogenase MDH
[0218] I. Selection of MDH and plasmid construction
[0219] Respectively select the origin IoMDH 3, Bacillus subtilis BsMDH (Uniprot: P49814), AoMDH (Uniprot: Q2U9I9), Aspergillus flavus AfMDH (Uniprot: A0A7U2MIG7), Streptomyces coelicolor ScMDH (Unipro: Q9K3J3), Corynebacterium glutamicum - derived CgMDH (Uniprot: Q8NN33), Arabidopsis thaliana AtMDH. Among the above, except for the IoMDH of Issatchenkia orientalis which was obtained by amplifying the genome, the remaining MDHs were all synthesized by Tianlin Biotechnology Co., Ltd. and codon - optimized. Each IPDCp - MDH - INO1t expression cassette was constructed by combining with the promoter IPDCp and the terminator INO1t, and this expression cassette was ligated to the pVT36b - PDC plasmid vector with the Cas protein deleted to construct plasmids PIOU - IoMDH, PIOU - AoMDH, PIOU - AfMDH, PIOU - CgMDH, PIOU - BsMDH, PIOU - AtMDH and PIOU - ScMDH. The 3' ends of the above - mentioned genes carry 7*his tags.
[0220] II. Purification of malate dehydrogenase MDH protein:
[0221] 1. Transform each MDH plasmid in (1) into the Issatchenkia orientalis engineering strain FIO - 7 using the lithium acetate transformation method to obtain strains carrying the PYC plasmid, named FIO - 7 - IoMDH, FIO - 7 - AoMDH, FIO - 7 - AfMDH, FIO - 7 - CgMDH, FIO - 7 - BsMDH, FIO - 7 - AtMDH and FIO - 7 - ScMDH respectively.
[0222] 2. Streak each strain in 1 on a YNB solid agar plate from the glycerol tube;
[0223] 3. After visible single colonies grow, inoculate the single colonies on the plate into 30 ml of YNB liquid medium and culture at 30 °C on a shaking incubator for 24 h;
[0224] 4. Inoculate the bacterial liquid in 3 at 0.2 OD / ml (i.e., the amount of bacteria per ml: OD600 = 0.2) into 1 L of liquid YNB medium and culture at 30 °C on a shaking incubator for 12 h;
[0225] 5. Centrifuge the bacterial liquid in 4 to collect the bacteria, break the cells with a homogenizer and purify the protein.
[0226] III. Determination of specific enzyme activity:
[0227] Reaction system (200 μl), pH 6.0, temperature 30°C, containing 5 mM oxaloacetic acid, 1 mM NADH, 1 μg of purified MDH protein. The definition of enzyme specific activity: 1 U is the amount of 1 μg of MDH protein that can consume 1 mmol of pyruvate in 1 minute.
[0228] IV. Shake flask fermentation evaluation:
[0229] 1. Streak the strains FIO-7-IoMDH, FIO-7-AoMDH, FIO-7-AfMDH, FIO-7-CgMDH, FIO-7-BsMDH, FIO-7-AtMDH, and FIO-7-ScMDH from glycerol tubes onto YNB agar plates and culture for 1 - 2 days.
[0230] 2. Inoculate the colonies grown on the plates in step 1 into 30 ml of YNB liquid medium and culture at 30°C on a shaking shaker at 200 rpm for 24 h.
[0231] 3. Inoculate the seed culture after culturing in step 2 into 100 ml of YNB medium at a density of 1 OD / ml (i.e., the cell density per ml: OD600 = 1), and simultaneously add 60 g / L calcium carbonate. Culture at 30°C on a shaking shaker at 200 rpm for 72 h. Monitor the glucose concentration in the fermentation broth during the process to ensure that there is always glucose in the fermentation broth. After fermentation, measure the enzyme activity of malate dehydrogenase and the yield of malic acid in the solution respectively.
[0232] V. Comparison of enzyme specific activity and shake flask fermentation evaluation data ( Figure 2 ):
[0233] By comparing the enzyme specific activity and in vivo evaluation data, CgMDH from Corynebacterium glutamicum has the highest enzyme specific activity (140 U) and the yield of shake flask malic acid (47 g / L), so this enzyme was selected as the pathway enzyme.
[0234] Table 9: Sequences
[0235]
[0236]
[0237] Example 4: Genomic level integration of pathway enzyme
[0238] I. Genomic integration of CgMDH from Corynebacterium glutamicum
[0239] 1. Construction of the CgMDH gene knockout cassette:
[0240] Use primers 2D-CgMDH-U and 2D-CgMDH-D to amplify plasmid PIOU-CgMDH in Example 3 to obtain the fragment for replacing lactate dehydrogenase D-LDH2 The knockout cassette IPDCp-CgMDH-INO1t (abbreviation: 2D).
[0241] 2. Construction of pVT36b-2D plasmid:
[0242] Use primers gRNA-2D and gRNA-U to amplify the pVT36b-PDC plasmid. Perform agarose gel electrophoresis and gel extraction on the PCR reaction solution successively. Then, digest and perform homologous recombination on the product after gel extraction. After that, transform the product after homologous recombination into competent Escherichia coli DH5α cells, select strains for sequencing verification, and finally extract the plasmids of the bacteria with correct sequencing results to obtain the pVT36b-2D plasmid.
[0243] 3. Gene knockout:
[0244] Use the lithium acetate transformation method to transform the engineered strain FIO-7 of Issatchenkia orientalis, introduce the knockout cassette IPDCp-CgMDH-INO1t and the pVT36b-2D plasmid, and perform PCR verification using primers 2D-YZ-U and 2D-YZ-D, JEN2-1-YZ-U and JEN2-1-YZ-U, GPD1-YZ-U and GPD1-YZ-D. Screen to obtain the D-LDH 2 -gRNA site in the original lactate dehydrogenase D-LDH in the genome and the D-LDH contained in the landing pad sequence 2 inserted at the JEN2-1 and GPD1 sites later 2 -gRNA sites that have integrated the CgMDH expression cassette, that is, screen the strains that have integrated three copies of the CgMDH expression cassette in the genome at one time, and send the fragments amplified by the above three pairs of primers to Tianlin Biotechnology Co., Ltd. for sequencing. Select the strains with correct sequencing results to lose the plasmid, preserve, and evaluate.
[0245] The results show that:
[0246] Using the engineered strain FIO-7 of Issatchenkia orientalis as the chassis, the lactate dehydrogenase gene D-LDH 2 (Uniprot: A0A1V2LTZ5) was successfully knocked out and the CgMDH gene expression cassette was inserted at the original site. The strain was named FIO-8 (FIOΔEG4::P TEF -IoPYCΔEG14::P FBA -IoMDH 3 ΔPDC1::P TDH3 -IoPYCΔD-LDH 3 ::landing pad 1ΔGD21::P GMP1 -SpMae1ΔGD21::P GMP1 -SpMae1ΔJEN2-1::landing pad 2ΔGPD1::landing pad 2ΔD-LDH2 ::P IPDC -CgMDHΔD-LDH 2 ::P IPDC -CgMDHΔD-LDH 2 ::P IPDC -CgMDH), this strain has three copies of CgMDH. Evaluated in a 5 L fermenter, this strain can produce 90.97 g / L of L-malic acid with a conversion rate of 57.87%.
[0247] Table 10: Primers
[0248] Primer sequence 2D-CgMDH-U acttcctctttgagaaagaggcattttatatagagatggagggggggtgttccatatgaattctccacaaaatgtttctaca 2D-CgMDH-D attatggtcgttaattttttactttttttctcccttcccctcgaactaaatggtgatggtgatggtgatgcaa 2D-YZ-U tttcttttcaaccatcccactcc 2D-YZ-D tttactttttttctcccttcccctc gRNA-2D cttgctatttctagctctaaaaccattccagctatgcaagaattgcataagacagggttcgaac gRNA-U gttttagagctagaaatagcaagttaaaataagg
[0249] II. Genomic integration of AfPYC
[0250] 1. Construction of the AfPYC gene knockout cassette:
[0251] Use primers GD5-AfPYC-U and GD5-AfPYC-D to amplify plasmid PIOU-AfPYC in Example 3, obtaining the gene expression cassette IPDCp-AfPYC-INO1t for integrating AfPYC at the neutral locus GD5.
[0252] 2. Construction of the pVT36b-GD5 plasmid:
[0253] Use primers gRNA-GD5 and gRNA-U to amplify the pVT36b-PDC plasmid. Perform agarose gel electrophoresis and gel extraction on the PCR reaction solution in sequence, then perform digestion and homologous recombination on the product after gel extraction. Subsequently, transform the product after homologous recombination into competent Escherichia coli DH5α cells, select strains for sequencing verification, and finally extract the plasmid of the bacteria with correct sequencing results to obtain the pVT36b-GD5 plasmid.
[0254] 3. Gene knockout:
[0255] Use the lithium acetate transformation method to transform the engineered strain FIO-8 of Issatchenkia orientalis, introducing the knockout cassette IPDCp-AfPYC-INO1t and the pVT36b-GD5 plasmid. Use primers D-LDH 3 -YZ-U and D-LDH 3 -YZ-D, GD5-YZ-U and GD5-YZ-D for PCR verification, and screen to obtain at the original GD5 locus in the genome and then at D-LDH 3Strains in which the GD5 sites contained in the inserted landing pad sequence 1 were all integrated with the AfPYC expression cassette, that is, strains in which two copies of the AfPYC expression cassette were integrated into the genome at one time were screened, and the fragments amplified by the above two pairs of primers were sent to Tianlin Biotechnology Co., Ltd. for sequencing. Strains with correct sequencing results were selected to lose the plasmid, preserved, and evaluated.
[0256] The results showed that:
[0257] Using the engineered strain of Issatchenkia orientalis FIO-8 as the chassis, the lactate dehydrogenase gene D-LDH was successfully knocked out 3 (Uniprot: A0A1V2LTZ5) and the strain with the AfPYC gene expression cassette inserted at the original site was named FIO-9 (FIOΔEG4::P TEF -IoPYCΔEG14::P FBA -IoMDH 3 ΔPDC1::P TDH3 -IoPYCΔD-LDH 3 :: Landing pad 1ΔGD21::P GMP1 -SpMae1ΔGD21::P GMP1 -SpMae1ΔJEN2-1:: Landing pad 2ΔGPD1:: Landing pad 2ΔD-LDH 2 ::P IPDC -CgMDHΔD-LDH 2 ::P IPDC -CgMDHΔD-LDH 2 ::P IPDC -CgMDHΔGD5::P IPDC -AfPYCΔGD5::P IPDC -AfPYC), this strain has two AfPYC copy numbers. After evaluation in a 5 L fermenter, this strain can produce 127.70 g / L of L-malic acid, with a conversion rate of 76.98%, and a production intensity of: 1.77 g / L / h.
[0258] Table 11: Sequence
[0259] Primer sequence GD5-AfPYC-U taagcgtataggtggaatccagttgatttctatcaggttaaccacaatggcggctccgtttcgtcag GD5-AfPYC-D cacggaaactctgtatgtcgaaagttttaccttactgttacacaaagcgctttgacgatcttgcagacga GD5-YZ-U gaaactctgtatgtcgaaagttttacc GD5-YZ-D ggaatccagttgatttctatcaggt gRNA-GD5 cttgctatttctagctctaaaacgcactcttagccatacggagtgcataagacagggttcgaac gRNA-U gttttagagctagaaatagcaagttaaaataagg
[0260] III. Genomic integration of phosphoenolpyruvate carboxylase EcPPC
[0261] 1. Construction of the EcPPC gene expression cassette:
[0262] Tianlin Biotechnology Co., Ltd. synthesized and codon-optimized phosphoenolpyruvate carboxylase EcPPC from Escherichia coli, constructed an expression cassette SEDp-EcPPC-FBA1t with promoter SEDp and terminator FBA1t, and integrated it into the commercial plasmid pUC. This plasmid was named pUC-EcPPC, and primers L-LDH 2 -EcPPC-U and L-LDH 2 -EcPPC-D were designed to amplify plasmid pUC-EcPPC to obtain the expression cassette SEDp-EcPPC-FBA1t for replacing lactate dehydrogenase L-LDH 2 (Uniprot: A0A099P3F2).
[0263] 2. pVT36b-L-LDH 2 Plasmid construction:
[0264] Primers gRNA-L-LDH 2 and gRNA-U were used to amplify pVT36b-PDC plasmid. The PCR reaction solution was subjected to agarose gel electrophoresis and gel extraction successively, and then the products after gel extraction were digested and recombinated homologously. After that, the products after homologous recombination were transformed into competent Escherichia coli DH5α cells, and strains were selected for sequencing verification. Finally, the plasmids of the bacteria with correct sequencing results were extracted to obtain pVT36b-L-LDH 2 plasmid.
[0265] 3. Genome integration:
[0266] The engineered strain FIO-9 of Issatchenkia orientalis was transformed using the lithium acetate transformation method to introduce the gene expression cassette SEDp-EcPPC-FBA1t and pVT36b-L-LDH 2 plasmid. Primers L-LDH 2 -YZ-U and L-LDH 2 -YZ-D were used for PCR verification, and the fragments amplified by the above two primers were sent to Tianlin Biotechnology Co., Ltd. for sequencing. Strains with correct sequencing results were selected for plasmid loss, preservation, and evaluation.
[0267] The results showed that the strain with the engineered strain FIO-9 of Issatchenkia orientalis as the chassis and using EcPPC (Uniprot: P0ABQ0) to replace lactate dehydrogenase L-LDH 2 (Uniprot: A0A099P3F2) was named FIO-10 (FIOΔEG4::P TEF -IoPYCΔEG14::P FBA -IoMDH 3 ΔPDC1::P TDH3 -IoPYCΔD-LDH3 ::Landing pad 1ΔGD21::P GMP1 -SpMae1ΔGD21::P GMP1 -SpMae1ΔJEN2-1::Landing pad 2ΔGPD1::Landing pad 2ΔD-LDH 2 ::P IPDC -CgMDHΔD-LDH 2 ::P IPDC -CgMDHΔD-LDH 2 ::P IPDC -CgMDHΔGD5::P IPDC -AfPYCΔGD5::P IPDC -AfPYCΔL-LDH 2 ::P SED -EcPPC), evaluated in a 5 L fermenter, this strain can produce 140.10 g / L of L-malic acid, with a conversion rate of 87.82%, a production intensity of: 1.95 g / L / h; the yield is 0.87 g / L of L-malic acid per g of glucose, and the optical purity of the product reaches over 99%.
[0268] Table 12: Sequences
[0269]
[0270]
[0271] Example 5: Effects of different host cells
[0272] The specific implementation method is the same as that of Examples 1 to 4, except that the host cells are adjusted to CICC 32694 and CICC1934 respectively, and the strains: CICC 32694-MA and CICC 1934-MA are prepared according to the above method.
[0273] At the same time, CICC 33427-MA (renamed FIO-10), CICC32694-MA and CICC 1934-MA prepared in the above examples are used to prepare L-malic acid in a 5 L fermenter.
[0274] The results show that:
[0275] Evaluated in a 5 L fermenter, the strain CICC 33427-MA can produce 140.10 g / L of L-malic acid, with a conversion rate of 87.92%, and a production intensity of: 1.95 g / L / h.
[0276] The strain CICC 32694-MA can produce 120.11 g / L of L-malic acid, with a conversion rate of 83.2%, and a production intensity of: 1.69 g / L / h.
[0277] The strain CICC 1934-MA can produce 126.71 g / L of L-malic acid, with a conversion rate of 80.3%, and a production intensity of 1.76 g / L / h.
[0278] Although the present invention has been disclosed above in preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.
Claims
1. A recombinant yeast strain, characterized in that: The recombinant yeast strain uses a yeast strain as a chassis cell, overexpresses native pyruvate carboxylase and malate dehydrogenase, and expresses malate dehydrogenase from Corynebacterium glutamicum, pyruvate carboxylase from Aspergillus flavus, and dicarboxylic acid ectotransporter from Schizosaccharomyces pombe; or the recombinant yeast strain uses a yeast strain as a chassis cell, overexpresses native pyruvate carboxylase and malate dehydrogenase, and expresses malate dehydrogenase from Corynebacterium glutamicum, pyruvate carboxylase from Aspergillus flavus, dicarboxylic acid ectotransporter from Schizosaccharomyces pombe, and phosphoenolpyruvate carboxylase from Escherichia coli; At the same time, the recombinant yeast strain also contains the following modifications: The landing pad 1 shown in SEQ ID NO.1 and the landing pad 2 shown in SEQ ID NO.3 are inserted into the genome of the yeast; and the following genes have reduced activity or are inactivated: (i) reduce the activity of or inactivate the URA3 gene on the genome to obtain a uracil auxotrophic strain, (ii) reduce the activity of or inactivate the pyruvate decarboxylase gene PDC1 on the genome, (iii) reduce the activity of or inactivate the endogenous dicarboxylate transporter JEN2-1 on the genome, (iv) reduce the activity of or inactivate the glycerol dehydrogenase encoding gene GPD1 on the genome.
2. The recombinant yeast strain according to claim 1, characterized in that Overexpressing the native pyruvate carboxylase is to overexpress the native pyruvate carboxylase IoPYC in the genome of yeast, and the number of integrated copies is 2 or more; Preferably, the native pyruvate carboxylase IoPYC is overexpressed on the yeast genome by integrating the native pyruvate carboxylase IoPYC into the EG4 site and / or the pyruvate decarboxylase gene PDC1 site on the genome; Preferably, overexpressing the native malate dehydrogenase is to overexpress the native malate dehydrogenase IoMDH3 on the genome of yeast, and the number of integrated copies is 1 or more; further, the native malate dehydrogenase IoMDH3 is overexpressed on the genome of yeast, and the native malate dehydrogenase is integrated into the EG14 site on the genome; Preferably, the malate dehydrogenase derived from Corynebacterium glutamicum is expressed by integrating the malate dehydrogenase CgMDH derived from Corynebacterium glutamicum into the genome of yeast, and the number of integrated copies is 3 or more; further, the malate dehydrogenase CgMDH derived from Corynebacterium glutamicum is integrated into the genome of yeast by integrating the malate dehydrogenase CgMDH derived from Corynebacterium glutamicum into the lactate dehydrogenase D-LDH2, GPD1 and JEN2-1 sites on the genome; Preferably, the expression of the pyruvate carboxylase derived from Aspergillus flavus is performed by integrating the pyruvate carboxylase AfPYC derived from Aspergillus flavus into the genome of yeast, and the number of integrated copies is 2 or more; further, the pyruvate carboxylase AfPYC derived from Aspergillus flavus is integrated into the genome of yeast, and the pyruvate carboxylase AfPYC derived from Aspergillus flavus is integrated into the GD5 site on the genome; Preferably, the expression of the dicarboxylic acid ectotransporter derived from Schizosaccharomyces pombe is achieved by integrating the dicarboxylic acid ectotransporter SpMae1 derived from Schizosaccharomyces pombe into the genome of the yeast, and the number of integrated copies is 1 or more; further, the integration of the dicarboxylic acid ectotransporter SpMae1 derived from Schizosaccharomyces pombe into the genome of the yeast is achieved by integrating the dicarboxylic acid ectotransporter SpMae1 derived from Schizosaccharomyces pombe into the GD21 site on the genome; Preferably, the expression of the phosphoenolpyruvate carboxylase from Escherichia coli is achieved by integrating the phosphoenolpyruvate carboxylase EcPPC from Escherichia coli into the genome of yeast, and the number of integrated copies is 1 or more; further, the phosphoenolpyruvate carboxylase from Escherichia coli is integrated into the genome of yeast by integrating the phosphoenolpyruvate carboxylase from Escherichia coli into the lactate dehydrogenase L-LDH2 site on the genome; Preferably, the insertion site of the landing pad 1 is the lactate dehydrogenase D-LDH3 site on the genome; Preferably, the landing pad 2 is inserted into the site of the endogenous dicarboxylic acid transporter JEN2-1 and / or the glycerol dehydrogenase encoding gene GPD1 on the genome.
3. The recombinant yeast strain according to claim 2, characterized in that The Uniprot number of the native pyruvate carboxylase IoPY C is: A0A099P575; the Uniprot number of the native malate dehydrogenase IoMDH3 is: A0A099NXM1; The Uniprot number of the malate dehydrogenase CgMDH derived from Corynebacterium glutamicum is: Q8NN33 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and having malate dehydrogenase activity; The Uniprot number of the pyruvate carboxylase AoPYC derived from Aspergillus flavus is: I8TVE3 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and having pyruvate decarboxylase activity; The Uniprot number of the dicarboxylic acid ectotransporter derived from Schizosaccharomyces pombe is: P50537 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and having ectotransporter activity; The Uniprot number of the Escherichia coli-derived phosphoenolpyruvate carboxylase EcPPC is: P0ABQ0 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity thereto and having phosphoenolpyruvate carboxylase activity.
4. The recombinant yeast strain according to claims 1 to 3, characterized in that: The yeast is based on Issatchenia orientalis, Pichia pastoris, Candida or Rhodotorula as host cells; Preferably, the host cell is I. orientalis; further, the host cell includes but is not limited to I. orientalis CICC 33427, I. orientalis CICC 32694, and I. orientalis CICC 1934.
5. A method for constructing a yeast strain producing L-malic acid, characterized in that: The method comprises the following steps: using yeast cells as chassis cells, overexpressing native pyruvate carboxylase and malate dehydrogenase, and expressing malate dehydrogenase from Corynebacterium glutamicum, pyruvate carboxylase from Aspergillus flavus, and dicarboxylic acid ectotransporter from Schizosaccharomyces pombe; or the recombinant yeast strain uses yeast strain as chassis cells, overexpressing native pyruvate carboxylase and malate dehydrogenase, and expressing malate dehydrogenase from Corynebacterium glutamicum, pyruvate carboxylase from Aspergillus flavus, dicarboxylic acid ectotransporter from Schizosaccharomyces pombe, and phosphoenolpyruvate carboxylase from Escherichia coli; At the same time, the recombinant yeast strain also contains the following modifications: The landing pad 1 shown in SEQ ID NO.1 and the landing pad 2 shown in SEQ ID NO.3 are inserted into the genome of the yeast; and the following genes have reduced activity or are inactivated: (i) reduce the activity of or inactivate the URA3 gene on the genome to obtain a uracil auxotrophic strain, (ii) reduce the activity of or inactivate the pyruvate decarboxylase gene PDC1 on the genome, (iii) reduce the activity of or inactivate the endogenous dicarboxylate transporter JEN2-1 on the genome, (iv) reduce the activity of or inactivate the glycerol dehydrogenase encoding gene GPD1 on the genome.
6. The construction method according to claim 5, characterized in that: Overexpressing the native pyruvate carboxylase is to overexpress the native pyruvate carboxylase IoPYC on the genome of yeast, and the number of integrated copies is 2 or more; Preferably, the native pyruvate carboxylase IoPYC is overexpressed on the yeast genome by integrating the native pyruvate carboxylase IoPYC into the EG4 site and / or the pyruvate decarboxylase gene PDC1 site on the genome; Preferably, overexpressing the native malate dehydrogenase is to overexpress the native malate dehydrogenase IoMDH3 on the genome of yeast, and the number of integrated copies is 1 or more; further, the native malate dehydrogenase IoMDH3 is overexpressed on the genome of yeast, and the native malate dehydrogenase is integrated into the EG14 site on the genome; Preferably, the malate dehydrogenase derived from Corynebacterium glutamicum is expressed by integrating the malate dehydrogenase CgMDH derived from Corynebacterium glutamicum into the genome of yeast, and the number of integrated copies is 3 or more; further, the malate dehydrogenase CgMDH derived from Corynebacterium glutamicum is integrated into the genome of yeast by integrating the malate dehydrogenase CgMDH derived from Corynebacterium glutamicum into the lactate dehydrogenase D-LDH2, GPD1 and JEN2-1 sites on the genome; Preferably, the expression of the pyruvate carboxylase derived from Aspergillus flavus is performed by integrating the pyruvate carboxylase AfPYC derived from Aspergillus flavus into the genome of yeast, and the number of integrated copies is 2 or more; further, the pyruvate carboxylase AfPYC derived from Aspergillus flavus is integrated into the genome of yeast, and the pyruvate carboxylase AfPYC derived from Aspergillus flavus is integrated into the GD5 site on the genome; Preferably, the expression of the dicarboxylic acid ectotransporter derived from Schizosaccharomyces pombe is achieved by integrating the dicarboxylic acid ectotransporter SpMae1 derived from Schizosaccharomyces pombe into the genome of the yeast, and the number of integrated copies is 1 or more; further, the integration of the dicarboxylic acid ectotransporter SpMae1 derived from Schizosaccharomyces pombe into the genome of the yeast is achieved by integrating the dicarboxylic acid ectotransporter SpMae1 derived from Schizosaccharomyces pombe into the GD21 site on the genome; Preferably, the expression of the phosphoenolpyruvate carboxylase from Escherichia coli is achieved by integrating the phosphoenolpyruvate carboxylase EcPPC from Escherichia coli into the genome of yeast, and the number of integrated copies is 1 or more; further, the phosphoenolpyruvate carboxylase from Escherichia coli is integrated into the genome of yeast by integrating the phosphoenolpyruvate carboxylase from Escherichia coli into the lactate dehydrogenase L-LDH2 site on the genome; Preferably, the insertion site of the landing pad 1 is the lactate dehydrogenase D-LDH3 site on the genome; Preferably, the landing pad 2 is inserted into the site of the endogenous dicarboxylic acid transporter JEN2-1 and / or the glycerol dehydrogenase encoding gene GPD1 on the genome.
7. The construction method according to claim 6, characterized in that: The Uniprot number of the native pyruvate carboxylase IoPYC is: A0A099P575; the Uniprot number of the native malate dehydrogenase IoMDH3 is: A0A099NXM1; The Uniprot number of the malate dehydrogenase CgMDH derived from Corynebacterium glutamicum is: Q8NN33 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and having malate dehydrogenase activity; The Uniprot number of the pyruvate carboxylase AoPYC derived from Aspergillus flavus is: I8TVE3 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and having pyruvate decarboxylase activity; The Uniprot number of the dicarboxylic acid ectotransporter derived from Schizosaccharomyces pombe is: P50537 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and having ectotransporter activity; The Uniprot number of the Escherichia coli-derived phosphoenolpyruvate carboxylase EcPPC is: P0ABQ0 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity thereto and having phosphoenolpyruvate carboxylase activity.
8. The construction method according to claim 7, characterized in that: The yeast is based on Issatchenia orientalis, Pichia pastoris, Candida or Rhodotorula as host cells; Preferably, the host cell is I. orientalis; further, the host cell includes but is not limited to I. orientalis CICC 33427, I. orientalis CICC 32694, and I. orientalis CICC 1934.
9. A method for producing L-malic acid, characterized in that: The method comprises culturing the recombinant yeast strain according to any one of claims 1 to 4 or the genetically modified malic acid-producing yeast strain prepared according to the method according to any one of claims 5 to 8, and fermenting to prepare L-malic acid; Preferably, the method comprises inoculating the seed solution of the recombinant yeast strain or malic acid producing yeast strain into a fermentation medium, adding 30 to 150 g / L of calcium carbonate, and reacting for 48 to 72 hours at a temperature of 25 to 35° C., a rotation speed of 250 to 350 rpm, and a pH of 5 to 6.
10. Use of the recombinant yeast strain according to any one of claims 1 to 4 or the method according to any one of claims 5 to 8 in the preparation of L-malic acid or a product containing L-malic acid.
Citation Information
Patent Citations
Malic acid-production gene engineering bacteria and its construction and use
CN104046577A
Acid-resistant yeast strain with high yield of L-malic acid as well as construction method and application of acid-resistant yeast strain
CN117467551A
Acid-resistant yeast strain with high yield of L-malic acid as well as construction method and application of acid-resistant yeast strain
CN118302514A
Succinic acid production using issatchenkia
US20230365998A1
Cited By
Pichia kudriavzevii capable of producing L-malic acid at high yield, construction method and application of pichia kudriavzevii
CN120866101A
Screening and expression platform construction method for non-essential gene loci of corynebacterium glutamicum
CN121271966A
Isatchenkia orientalis for efficiently synthesizing L-malic acid and application thereof
CN121592511A
Engineering pichia kudriavzevii and application thereof
CN121801724A