A method for identifying interacting proteins in rice endosperm based on TurboID proximity labeling technology

Abstract

The application discloses a method for identifying endochalazal interacting proteins in rice based on a TurboID proximity labeling technology, and belongs to the technical field of biology. The method comprises the following steps: firstly, forming a fusion protein by connecting a target protein with a TurboID biotin ligase, and constructing a transgenic rice plant for stably expressing the fusion protein; secondly, mixing a developing seed of the transgenic plant 7-9 days after flowering with a biotin solution with a concentration of 100-400 muM, performing vacuum treatment for 10-30 min, and then placing the seed for 8-36 h; and thirdly, taking a rice endochalazal sample treated by the biotin to perform protein extraction, enrichment and mass spectrometry identification on the biotin-labeled interacting proteins in the rice endochalazal. The application provides a method for performing proximity space labeling on a target protein in the rice endochalazal based on a TurboID system, and the method can be used for analyzing possible protein-protein interactions.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, and in particular to a method for identifying interacting proteins in rice endosperm based on TurboID proximity labeling technology. BACKGROUND

[0002] As one of the main food crops, the yield and quality of rice is directly related to the people's living standards. Endosperm is the main component of rice. In-depth study of the metabolism and molecular regulation mechanism of storage substances in endosperm is crucial to improve rice yield and quality. In the past, through the use of GPC separation, chemical cross-linking, affinity purification and immunoprecipitation, it is difficult to identify transient or weakly interacting proteins in the study of starch synthesis related enzyme protein complex components or interacting proteins in endosperm. In recent years, the development of biotin proximity labeling technology can better solve the problem of mining interacting proteins in protoplasts.

[0003] Proximity labeling (PL) is a method of linking a catalytic enzyme to a target protein to form a fusion protein, and adding an exogenous substrate to activate the catalytic enzyme to label the adjacent protein. The basic principle is to fuse a certain enzyme (such as peroxidase or biotinylated enzyme) with the target protein, and when the target protein interacts with the target protein, the enzyme triggers a chemical reaction to connect the active label molecule (such as biotin or fluorescent molecule) to the protein nearby. In recent years, PL has achieved in vivo detection of weak interaction, transient interaction and hydrophobic protein-protein interaction. At present, the commonly used PL catalytic enzymes include ascorbate peroxidase (APEX), BioID, BioID2, TurboID and miniTurboID, etc. Although APEX has high catalytic activity, it needs toxic substrate hydrogen peroxide and biotin phenol for work. In contrast, BioID and BioID2 use biotin as a substrate and have no toxic effects on cells, but have lower catalytic activity and require longer processing time. TurboID and miniTurboID combine the advantages of APEX and BioID, with high catalytic efficiency and no toxic effects on cells, and the optimal working temperature is reduced from 37°C to 25°C, which is suitable for plant growth environment.

[0004] In animal systems, PL is widely used to construct protein-protein interaction networks, study organelle proteomics and cell communication, analyze protein topology and surface groups, study protein-nucleic acid interactions and subcellular transcriptomes, etc. In plant systems, PL technology has been used to identify interacting proteins of toxic proteins and new component proteins of nuclear pore complexes in tobacco and Arabidopsis leaf tissues. In particular, using TurboID technology, the key factor regulating tobacco resistance to TMV virus has been successfully identified (Zhang Y, et al. TurboID-based proximity labeling reveals that UBR7 is a regulator ofN NLR immune receptor-mediated immunity. Nat Commun, 2019, 10:3252)and Arabidopsis nuclear transport receptor substrate transport map (Xu F, et al . Exportin-4 coordinates nuclear shuttling ofTOPLESS family transcription corepressors to regulate plant immunity. Plant Cell, 2021,33:697-713)。

[0005] In the plant system, the past researches treat the transient or stable transgenic strain leaves or protoplasts by low concentration biotin soaking method, and then use streptavidin magnetic beads to purify the biotin-labeled interaction proteins. However, due to the existence of seed coat and pericarp, it is difficult for low concentration biotin to enter the inside of the endosperm in a short time, resulting in low biotinylation degree, and at present, there is no application of biotin labeling in the endosperm tissue of rice.

[0006] Therefore, how to use the TurboID proximity labeling technology to identify the interaction proteome in the endosperm of rice is a technical problem to be solved by those skilled in the art. SUMMARY

[0007] The purpose of the present application is to explore the TurboID proximity labeling technology to identify the interaction proteome of the expressed proteins in the endosperm, and to provide a feasible method for the research on the interaction proteins in the endosperm of rice.

[0008] In order to achieve the above purpose, the technical scheme adopted by the present application is as follows:

[0009] The present application provides a method for identifying the interaction proteins in the endosperm of rice based on TurboID proximity labeling technology, comprising the following steps:

[0010] (1) The coding gene of the fusion protein of the target protein and TurboID biotin ligase is cloned into a plant expression vector to construct a recombinant plasmid; then the genetic transformation method mediated by Agrobacterium is used to transgenically transform the rice receptor, and a transgenic plant with successfully expressed fusion protein is obtained;

[0011] (2) 7-9 days after the transgenic plants bloom, the developing seeds are mixed with a biotin solution with a concentration of 100-400 μM, vacuum treatment is performed for 10-30 min, and then the seeds are placed for 8-36 h;

[0012] (3) The biotin-treated rice endosperm samples are taken to perform protein extraction, enrichment, and mass spectrometry identification of the biotin-labeled interaction proteins in the rice endosperm.

[0013] The present application uses the TurboID proximity labeling technology to label the proteins interacting with the target protein in the rice endosperm with biotin, and then separates and extracts the biotin-labeled proteins from the rice endosperm, which are the candidate proteins interacting with the target protein.

[0014] In step (1), based on the TurboID proximity labeling technology, the target protein to be studied is fused with the TurboID biotin ligase to form a fusion protein, and the fusion protein expression frame is integrated into the rice genome by using genetic engineering technology to obtain a transgenic rice plant in which the fusion protein is successfully expressed.

[0015] Specifically, the fusion protein coding gene is first cloned into a plant expression vector to construct a recombinant expression plasmid, then the target fragment is introduced into the rice receptor by using the agrobacterium-mediated genetic transformation method to obtain T0, and then the T0 transgenic endosperm sample is subjected to positive seedling identification, and the T1 generation is screened to obtain a stably inherited T2 generation transgenic line.

[0016] As a preferred, the plant expression vector is a pCAMBIA1390 vector, and the fusion protein coding gene is cloned after the Ubiquitin promoter of the pCAMBIA1390 vector.

[0017] As a preferred, the N terminal and C terminal of the TurboID biotin ligase are fused with 3×HA tags and 6×His tags. The 3×HA tags and 6×His tags are fused and expressed before and after the TurboID biotin ligase sequence, which is used for subsequent detection of the expression level, purification and positioning of the target protein.

[0018] As a preferred, the target protein is connected with the TurboID biotin ligase by a flexible Linker. The amino acid sequence of the flexible Linker can be but is not limited to GGGSSGGG. By adding a flexible Linker between the two protein sequences, the biological activity of turboID is ensured and the steric hindrance effect that may exist in the fusion expression is avoided.

[0019] As a preferred, the target protein is fused to the N terminal of the TurboID biotin ligase.

[0020] Preferably, the nucleotide sequence of the Linker-3xHA-TurboID-6xHis coding gene in the fusion protein is shown in SEQ ID NO. 3.

[0021] In step (2), the seeds of the transgenic line are mixed with a biotin solution to form a reaction system, vacuum treatment is performed, and then the biotin solution is allowed to enter the interior of the seeds to catalyze the biotin ligation reaction of TurboID and connect biotin to the proteins interacting with the target protein.

[0022] Specifically, the period of 7-9 days after flowering is a period when starch synthesis is relatively fast, and the internal moisture content of the seed is high, and the biotin treatment and protein binding efficiency are high. Therefore, the endosperm tissue at this period is selected to establish the high-efficiency biotin labeling system based on TurboID.

[0023] In the present application, a biotin solution with a concentration of 100-400 μM is mixed with the endosperm tissue of rice, and the biotin solution is prepared by dissolving biotin in dimethyl sulfoxide to obtain a mother liquor with a concentration of 100 mM, and then diluted with pure water. Research shows that this reaction condition has no effect on the activity of the endosperm tissue, and the biotin labeling reaction based on TurboID can be realized.

[0024] Preferably, the concentration of the biotin solution is 200-400 μM. Under this concentration condition, a high-efficiency labeling reaction can be realized.

[0025] In the present application, the seeds are immersed in the biotin solution under vacuum conditions. Research shows that, after controlling the vacuum treatment time to be 10-30 min and then placing for 8-36 h, the biotin can enter the interior of the seeds better to catalyze the biotin ligation reaction of TurboID.

[0026] Preferably, the vacuum treatment time is 15 min, and then the sample is placed at 20-25℃ for 12-24 h.

[0027] The present application finds the optimal incubation conditions to realize a high-efficiency labeling reaction, and avoids the problem of non-specificity caused by too long labeling time. The obtained sample can be used for subsequent researches such as transient interaction protein identification and subcellular organelle protein identification.

[0028] In step (3), the biotin-treated sample is quickly frozen with liquid nitrogen and ground into a fine powder, and then protein extraction is performed by adding a protein extraction solution. After centrifugation and filtration, a biotin-labeled endosperm protein solution is obtained, and free biotin in the endosperm protein solution is removed by purification. Then, the biotin-labeled endosperm protein is enriched to obtain a concentrated sample. The endosperm protein in the concentrated sample is the candidate protein interacting with the target protein.

[0029] As a preference, the endosperm proteins labeled by biotin in the protein extract are enriched by streptavidin magnetic beads.

[0030] As a specific embodiment of the present application, the present application provides a method for identifying the starch branching enzyme I (BEI) interacting proteins in the endosperm of rice based on the TurboID proximity labeling technology, wherein the target protein is the starch branching enzyme I (BEI), and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 6. The method comprises the following steps: forming a fusion protein of the starch branching enzyme I (BEI) and TurboID biotin ligase, constructing a transgenic line stably expressing the fusion protein by using genetic transformation technology, collecting the endosperm tissue of the transgenic line, treating the endosperm tissue according to the above-mentioned biotin treatment method, and then extracting, enriching and mass spectrometrically identifying the biotin-labeled interacting proteins.

[0031] The present application establishes the BEI-TurboID biotin ligase system, and uses the TurboID system to perform proximity space labeling metagenomics research on BEI in the endosperm, so as to analyze the possible protein-protein interactions, and lay a foundation for the subsequent biological function research of BEI.

[0032] The present application has the following beneficial effects:

[0033] The present application firstly uses the high-efficiency biotin labeling system based on TurboID in the research of the interacting proteins in the endosperm of rice, and provides a method for performing proximity space labeling on the target protein in the endosperm of rice based on the TurboID system. The method can be used to analyze the possible protein-protein interactions, and find a variety of proteins interacting with the target protein in the endosperm, including the proteins which are not easily found by the conventional method, such as the proteins of transient interaction and weak interaction in vivo. Specifically, the present application uses the proximity labeling catalyst TurboID to improve the ability of detecting the proteins of transient interaction and weak interaction; the present application explores the optimal biotin treatment condition, and realizes the high-efficiency labeling reaction without adding cell toxic substances. Compared with the traditional co-IP method, the detection rate and sensitivity of the method provided by the present application are obviously improved, which indicates that the method has certain superiority. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 It is the plasmid map of pCAMBIA1390-Linker-3xHA-TurboID-6xHis.

[0035] Figure 2 It is the plasmid map of pCAMBIA1390-BEI-Linker-3xHA-TurboID-6xHis.

[0036] Figure 3Figure for the effect of the optimal concentration of biotin treatment

[0037] Figure 4 Figure for the effect of the optimal time of biotin treatment.

[0038] Figure 5 Figure for the effect of streptavidin enrichment.

[0039] Figure 6 Figure for the volcano plot of BEI-TurboID affinity purification of proteome.

[0040] Figure 7 Figure for the heat map of BEI candidate interacting proteins. DETAILED DESCRIPTION

[0041] The application will be further described below in connection with specific embodiments. The following examples are intended to be illustrative only and not limiting of the scope of the application. Any modification or substitution of the method, steps or conditions of the application, without departing from the spirit and essence of the application, shall fall within the scope of the application.

[0042] The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are commercially available reagents and materials unless otherwise specified.

[0043] Example 1: Identification of proteins interacting with starch branching enzyme I (BEI) based on proximity labeling technology

[0044] 1. Construction of pCAMBIA1390-3xHA-TurboID-6xHis plant binary expression vector

[0045] The linker-3xHA-TurboID sequence was inserted after the Ubiquitin promoter of the pCAMBIA1390 vector; the steps for constructing the expression vector are as follows:

[0046] Step 1: Amplification of the Linker-3xHA-TurboID-6xHis sequence, specific primers were designed, and the specific primer sequences were as follows: TurboID F (5'→3'): GAGTCCACCATGGTAGATCACTAGTGGTGGTGGTTCATCAGGTGG (SEQ ID NO. 1); TurboID R (5'→3'): GTGGTGGCTAGCGTTAACCTGCAGCTTTTCGGCAGACC (SEQ ID NO. 2).

[0047] With pXPO4-XPO4-3xHA-TurboID vector as a template (Xu et al. 2021), the Linker-3xHA-TurboID specific sequence fragment was obtained by PCR method (using 2xKODone Mix high-fidelity enzyme (Toyobo)), and the specific sequence fragment was recovered by gel recovery after electrophoresis verification.

[0048] Step 2: Vector enzyme digestion: the pCAMBIA1390 vector was digested with restriction enzyme SpeI (NEB), and the linearized vector was obtained by gel recovery after electrophoresis verification.

[0049] Step 3: Homologous recombination: Linker-3xHA-TurboID fragment and SpeI-digested pCAMBIA1390 linearized vector fragment were subjected to 2xCE clone mix (Vazyme) homologous recombination, and the connection was completed. The recombinant product was transformed into DH5a E. coli competent cells, and cultured on LB plates containing kanamycin for 12-16 hours.

[0050] Step 4: Single colony was picked and cultured overnight, and the plasmid was extracted and sent for sequencing identification. After identification, it was pCAMBIA1390-Linker-3xHA-TurboID-6xHis plant binary expression vector, and the plasmid map was as shown in Figure 1 , wherein the Linker-3xHA-TurboID-6xHis sequence is shown as SEQ ID NO. 3.

[0051] 2. Construction of pCAMBIA1390-BEI-Linker-3xHA-TurboID-6xHis plant binary expression vector

[0052] The pCAMBIA1390-Linker-3xHA-TurboID-6xHis plasmid correctly identified by sequencing was digested with SpeI, and the gel was recovered by electrophoresis; the primer was designed, and the BEI full-length sequence was amplified by PCR, and the BEI full-length sequence PCR product was obtained by gel recovery; the BEI was inserted into the pCAMBIA1390-Linker-3xHA-TurboID-6xHis plasmid by homologous recombination method; the pCAMBIA1390-BEI-Linker-3xHA-TurboID-6xHis plant binary expression vector was constructed, and the specific steps were as follows:

[0053] Step 1: BEI sequence amplification, BEI specific primers are designed, and the specific primer sequences are as follows: BEI F (5'→3'): GAGTCCACCATGGTAGATCACTAGTATGCTGTGTCTCACCTCCTC (SEQ ID NO. 4), BEI R (5'→3'): CACCTGATGAACCACCACCTTTGCAGTCTTCGTCAGAAGACC (SEQ ID NO. 5).

[0054] The BEI specific sequence was obtained by PCR method (2xKOD one Mix high-fidelity enzyme (Toyobo) was used) using rice endosperm cDNA as template, and the BEI CDS sequence was obtained by gel recovery after electrophoresis verification.

[0055] Step 2: Vector digestion: the pCAMBIA1390-Linker-3xHA-TurboID-6xHis vector obtained above was digested with restriction enzyme SpeI (NEB), and the linearized vector was obtained by gel recovery after electrophoresis verification.

[0056] Step 3: Homologous recombination: the BEI fragment and the SpeI-digested pCAMBIA1390-Linker-3xHA-TurboID linearized vector fragment were subjected to homologous recombination with 2xCE clone mix (Vazyme), and the connection was completed. The recombinant product was transformed into DH5α E. coli competent cells, and cultured on LB plate containing kanamycin for 12-16 hours.

[0057] Step 4: Single colony was picked and cultured overnight, and the plasmid was extracted and sent for sequencing identification. After identification, it was pCAMBIA1390-BEI-Linker-3xHA-TurboID-6xHis plant binary expression vector. The plasmid map is shown in Figure 2 , wherein the BEI CDS sequence is shown as SEQ ID NO. 6.

[0058] 3. Genetic transformation

[0059] The pCAMBIA1390-BEI-3xHA-TurboID plasmid was transgenically introduced into Japanese rice by Agrobacterium transformation method, and Wuhan Boyuan Biotechnology Co., Ltd. was entrusted to perform the transgenic operation. The T0 generation transgenic endosperm sample was subjected to positive seedling identification, and the T1 generation was screened to obtain a stably inherited T2 generation transgenic line.

[0060] 4. Biotin treatment

[0061] (1) The optimal concentration of biotin treatment was determined, and the specific steps were as follows:

[0062] Step 1: Take the seed of the transgenic line stably expressing pCAMBIA1390-BEI-3xHA-TurboID recombinant plasmid after flowering for 7-9 days, mix with 50, 100, 200 and 400 μM biotin solution to form a reaction system, vacuum treatment for 15 minutes, and then place at 25 ℃ for 36 hours. After washing with ddH2O for 5 times, the excess liquid is absorbed, and the sample is detected for biotin treatment effect.

[0063] The preparation method of the biotin solution is as follows: first, dissolve biotin in DMSO to prepare a 100 mM mother liquor, and then dilute with ddH2O to the corresponding concentration when used.

[0064] Step 2: Protein extraction. 100 mg of biotin-treated endosperm sample is quickly frozen in liquid nitrogen and ground into fine powder in a mortar. Add 300 μL of protein extraction buffer (components include 10 mM HEPES-KOH, 100 mM NaCl, 1x cocktail, 4 μM MG132, 1 mM PMSF) for protein extraction, and rotate at 4 ℃ for 30-60 min. The solvent of the protein extraction buffer solution is water, and the pH is 7.5.

[0065] Step 3: Place the above protein solution in a centrifuge, set the rotation speed to 12000 rpm, and centrifuge at 4 ℃ for 15 min, and collect the supernatant. The above operation is repeated twice. Add 5x SDS loading buffer (components are 300 mM Tris-HCl, pH 6.8, 10% SDS, 50% glycerol, 0.05% bromophenol blue, 500 mM DTT or 5% β-mercaptoethanol) to the supernatant, and boil in boiling water for 10 min to obtain denatured protein.

[0066] Step 4: Western blot detection of affinity labeling effect, the specific steps are as follows:

[0067] (1) SDS-PAGE and membrane transfer: separate the above obtained protein sample on a 10% SDS-PAGE gel, and transfer the protein from the PAGE gel to a PVDF membrane using a wet transfer instrument. Three gels of the same sample are prepared, and different antibodies are incubated subsequently.

[0068] (2) Blocking: incubate the above PVDF membrane with 5% BSA (solvent is 1x TBST) at room temperature for 1 hour.

[0069] (3) Primary antibody incubation: three PVDF membranes correspond to Streptavidin-HRP (abcam#ab7403; 1:7500), anti-HA (abcam#ab1424, 1:6000) and anti-BEI (1:3000) antibody respectively, incubate at room temperature for 2 hours;

[0070] (4) Membrane washing: wash the membrane with 1xTBST for 3 times, 5 min each time. At this time, the membrane incubated with Streptavidin-HRP can be directly to step (7).

[0071] (5) Secondary antibody incubation: anti-HA and anti-BEI are incubated with goat anti-mouse-HRP (1:6000) and goat anti-rabbit-HRP (1:6000) respectively at room temperature for 1 hour.

[0072] (6) Membrane washing: wash the membrane with 1xTBST for 3 times, 5 min each time.

[0073] (7) Development: add ECL chemiluminescence solution on the PVDF membrane, and then use Tanon 5200 series automatic chemiluminescence image analysis system to image, get the bands corresponding to Streptavidin-HRP and anti-HA. Figure 3

[0074] The results of biotin labeling effect are shown in Figure 3 From the results of anti-HA part in Figure 3 It can be seen that the recombinant plasmid pCAMBIA1390-BEI-3xHA-TurboID recombinant protein can be better expressed in rice endosperm. From the results of Streptavidin-HRP part in Figure 3 It can be seen that within 36 hours of labeling time, with the increase of biotin concentration, the labeling effect rises significantly, while no significant difference in labeling effect is found in the comparison of 200 and 400 μM. Therefore, it can be determined that the optimal treatment concentration of biotin required for labeling is 200 μM.

[0075] (II) To determine the optimal time of biotin treatment, the specific steps are as follows:

[0076] Step 1: Take the seeds of the transgenic line stably expressing pCAMBIA1390-BEI-3xHA-TurboID recombinant plasmid 7-9 days after flowering and mix with 200 μM biotin solution to form a reaction system. After vacuum treatment for 15 minutes, place it at 25 ℃ for 0-36 hours, and take samples at 0, 8, 12, 24 and 36 hours respectively. After washing with ddH2O for 5 times, absorb the excess liquid, take 100 mg endosperm sample to detect the biotin treatment effect. The remaining sample is frozen with liquid nitrogen and stored at -80 ℃.​

[0077] Steps 2-4 are the same as steps 2-4 in (I).

[0078] Biotin labeling effect results are as follows Figure 4 As shown, from Figure 4 The results of the anti-HA section show that the recombinant protein in the recombinant plasmid pCAMBIA1390-BEI-3×HA-TurboID can be expressed well in rice endosperm; the results of the anti-BEI section show that BEI-3×HA-TurboID-6×His recombinant protein (corresponding to the protein indicated by the arrow above) and endogenous BEI expression protein (corresponding to the protein indicated by the arrow below) can be detected at each reaction time gradient. Figure 4 The Streptavidin-HRP results show that during the 0-8 hour labeling period, the biotinylation level mediated by TurboID was low, but a small number of proteins were successfully biotinylated. Extending the labeling time to 12-24 hours significantly increased the labeling effect, while no significant difference was found in the 24-36 hour comparison. Therefore, the optimal biotin treatment time for labeling can be determined to be 24 hours, at which point the bands are clearly visible. This indicates that over time, the BEI-3×HA-TurboID recombinant protein can gradually biotinylate proteins that interact with it and their neighbors, thereby enriching specific endosperm proteins that interact with BEI. Therefore, applying TurboID's proximity labeling technology to the interproteome mining of rice starch is feasible, and a biotin treatment time of 24 hours is recommended.

[0079] 5. Protein extraction and purification, streptavidin magnetic bead enrichment, and mass spectrometry identification.

[0080] Protein extraction: Take 1.5 g of the sample treated with biotin for 24 hours, freeze it with liquid nitrogen, grind it into a fine powder in a mortar, and extract the protein with 4.5 mL of protein extraction buffer (10 mM HEPES-KOH, 100 mM NaCl, 1×cocktail, 4 μM MMG132, 1 mM PMSF, pH 7.5) at 4 ℃ for 30-60 minutes by rotation extraction.

[0081] Place the above protein solution in a centrifuge, set the speed to 12000 rpm, and centrifuge at 4 ℃ for 15 minutes. Collect the supernatant, which is the biotin-labeled protein solution. Repeat the centrifugation twice.

[0082] After centrifugation, the biotin-labeled protein solution was filtered through a 0.22 μm filter membrane to extract biotin-labeled endosperm proteins.

[0083] Desalting column to remove free biotin: A HiTrap™ desalting column was used to remove free biotin from the embryo protein solution in a AKTA micro protein purification system. The desalting column flow phase solution was composed of 10 mM HEPES-KOH, 100 mM NaCl, pH 7.5. The volume of the embryo protein solution was changed from 4.5 mL to 20 mL after desalting.

[0084] Streptavidin magnetic beads enrichment: 100 μL of the embryo protein solution after removing free biotin was taken as the input to detect the protein expression. The rest of the embryo protein solution was mixed with 50 μL of streptavidin magnetic beads (Invitrogen™ #65605D) and incubated at 4 °C overnight. The streptavidin magnetic beads were washed 3 times with 1 mL of protein extraction buffer (10 mM HEPES-KOH, pH 7.5, 100 mM NaCl) for 5 min each time before adding the embryo protein solution.

[0085] Elution of biotinylated proteins: The streptavidin magnetic beads were collected using a magnetic stand and washed 5 times with 1 mL of protein extraction buffer (10 mM HEPES-KOH, pH 7.5, 100 mM NaCl) for 5 min each time. The supernatant was collected by boiling 70 μL of 2xSDT buffer (components: 100 mM Tris-HCl, pH 7.6, 1 mM DTT, 4% SDS) in boiling water for 10 min. After affinity purification with streptavidin magnetic beads, the high-biotinylated protein solution was concentrated, and the total volume was significantly reduced from 20 mL containing a large amount of non-specific proteins to 70 μL containing a high concentration of specific biotinylated proteins. 12 μL of the affinity-purified protein sample was added to 3 μL of 5xSDS loading buffer, boiled in boiling water for 10 min, and the affinity-purified (AP) protein sample was obtained.

[0086] The labeling and concentration effects were detected using Western blot technology. The obtained Input and AP protein samples were separated on SDS-PAGE gel and then transferred to a PVDF membrane; 5% BSA (solvent: 1xTBST) was blocked for 1 hour, and Streptavidin-HRP (abcam#ab7403; 1:7500) and anti-HA (abcam#ab1424, 1:6000) antibodies were added respectively and incubated for 2 hours; the membrane was washed with 1xTBST for 3 times, each time for 5 min. The anti-HA was incubated with a secondary antibody, goat anti-mouse-HRP (1:6000) for 1 hour, and the membrane was washed with 1xTBST for 3 times, each time for 5 min. After adding the color developing solution, imaging was performed using a Tanon 5200 full-automatic chemiluminescence image analysis system.

[0087] The results are shown in Figure 5 The Western blot results of the AP and Input groups were compared from Figure 5 It can be found that, whether in the Streptavidin-HRP treatment or the anti-HA treatment state, the concentration effect of the Vector and BEI of the AP group is more prominent than that of the Input group. This indicates that the biotinylated protein is successfully concentrated after AP, and the AP is successfully successful, and the interaction system construction effect is good. Therefore, it is feasible to apply the proximity labeling technology of TurboID to the interaction proteome mining work of rice starch synthesis related enzymes.

[0088] The remaining affinity purified protein sample (about 58 μL) was separated on SDS-PAGE gel. After separation, in-gel digestion and label free quantification (LFQ)-MS were performed. Taking the empty transgenic endosperm sample as a control, the change in protein abundance was analyzed, and it was found that the abundance of 119 proteins in BEI was significantly higher than that of the control group (adjust pvalue<0.05, Ratio biotin / mock>3, PSM>2) Figure 6 ). Among them, the interaction protein BEIIb protein abundance in BEI is higher. Other starch synthesis related enzyme genes, such as AGPL1, AGPL2, SSI, SSIIa, AGPS1, ISA2, BT1, Pho1 and DPE1, also have high protein abundance in the BEI interaction proteome Figure 6 ). In addition, there are also some transcriptional regulators and non-enzymatic reaction proteins with high abundance in the BEI proteome Figure 7 , which indicates that this method provides many candidate proteins for discovering BEI interaction proteins.

[0089] In conclusion, in the present application, the adjacent labeling technology of TurboID is successfully applied to the interactome mining of rice starch branching enzyme BEI, thereby greatly expanding the application field of TurboID efficient biotin labeling technology. Compared with traditional technology, the method has obvious advantages, and can effectively identify and identify the interactome in rice endosperm. This innovation provides a basic method and system for the study of functional genes in the rice starch synthesis pathway, especially for the systematic mining and identification of the interacting proteins of rice starch synthesis related enzymes. The present application is not limited to the mining of the interactome of rice starch branching enzyme BEI, but is also applicable to other proteins.

[0090] The present application uses the efficient biotin labeling system based on TurboID for the research of rice endosperm interactome mining, and the obtained sample can be used for the identification and mining of rice endosperm interactome related research, which proves that the efficient biotin labeling system based on TurboID for rice endosperm interactome mining is feasible.

[0091] The present application can be implemented under the same parameters and conditions without changing the core and scope of the present application for related researchers in the field. Although specific examples are provided, improvements and deepening of the present application are still encouraged.

Claims

1. A method for identifying interacting proteins in the endosperm of rice based on TurboID proximity labeling technology, characterized in that, The method comprises the following steps: (1) cloning a gene encoding a fusion protein of a target protein and TurboID biotin ligase into a plant expression vector to construct a recombinant plasmid, wherein the target protein and the TurboID biotin ligase are connected by a flexible linker, the target protein is fused to the N terminus of the TurboID biotin ligase, and the nucleotide sequence of the gene encoding the Linker-3×HA-TurboID-6×His in the fusion protein is shown in SEQ ID NO. 3; then using an Agrobacterium-mediated genetic transformation method to transgenically introduce the fusion protein into a rice recipient to obtain a transgenic plant in which the fusion protein is successfully expressed; (2) mixing the developing seeds of the transgenic plant 7-9 days after flowering with a biotin solution with a concentration of 200-400 μM, performing vacuum treatment for 10-30 min, and then placing for 12-36 h; (3) taking the rice endosperm sample treated with biotin to perform protein extraction, enrichment, and mass spectrometry identification of the biotin-labeled interaction proteins in the rice endosperm.

2. The method of claim 1, wherein, In step (1), the plant expression vector is a pCAMBIA1390 vector, and the fusion protein encoding gene is cloned after the Ubiquitin promoter of the pCAMBIA1390 vector.

3. The method of claim 1, wherein, In step (2), the biotin solution is prepared by dissolving biotin in dimethyl sulfoxide to obtain a mother liquor with a concentration of 100 mM, and then diluting with pure water.

4. The method of claim 1, wherein, In step (2), the vacuum treatment time is 15 min.

5. The method of claim 1 or 4, wherein, In step (2), after vacuum treatment, the sample is placed at 20-25 °C for 12-24 h.

6. The method of claim 1, wherein, In step (3), streptavidin magnetic beads are used to enrich the biotin-labeled endosperm proteins in the protein extraction solution.

7. The method of claim 1, wherein, When the target protein is starch branching enzyme I, the starch branching enzyme I is fused to the N terminus of the TurboID biotin ligase; and the nucleotide sequence of the gene encoding the starch branching enzyme I is shown in SEQ ID NO. 6.

Images