Recombinant bacillus calmette guerin vaccine as well as construction method and application thereof

Abstract

The invention belongs to the technical field of vaccine preparation, and particularly relates to a recombinant bacillus calmette guerin and a construction method and application thereof, and the recombinant bacillus calmette guerin is prepared by transferring a CU / ZN-SOD expression sequence into a bacillus calmette guerin (BCG). The recombinant bacillus calmette-guerin vaccine provided by the invention can induce high-level cellular immune response level and humoral immune response level, which are biased to Th1 type immune response, and in addition, the recombinant bacillus calmette-guerin vaccine is high in immune safety.

Description

Technical Field

[0001] The present invention belongs to the technical field of vaccine preparation, and particularly relates to a recombinant BCG vaccine and its construction method and application. Background Art

[0002] Brucella is a Gram-negative facultative intracellular parasite, which can cause abortion of animal fetuses. In humans, it manifests as common diseases such as undulant fever and osteoarthritis. Vaccination is a key strategy for clearing and purifying brucellosis. In recent decades, attenuated live Brucella vaccines have been considered the most effective vaccines for controlling the spread of brucellosis worldwide. However, problems such as poor safety and serological interference still remain unresolved, which has hindered the purification and clearance of brucellosis. Therefore, developing a safer and more effective brucellosis vaccine is one of the main research directions.

[0003] Bacillus Calmette-Guérin (BCG) is an attenuated strain of Mycobacterium bovis, mainly used for preventing tuberculosis (TB). It is one of the most widely used vaccines globally. It is reported that BCG has a non-specific protective effect against pathogens other than tuberculosis, and can significantly reduce child mortality. In the past few decades, due to the advantages of BCG such as low toxicity, safety, effectiveness, thermal stability, easy large-scale production, low cost, and being unaffected by maternal antibodies, recombinant BCG (rBCG) has been used as a vector to express heterologous antigens, thereby stimulating immune responses against bacterial, viral, and parasitic infections.

[0004] Therefore, developing a recombinant BCG vaccine that can express Brucella antigens is of great significance for the prevention or treatment of Brucella infections. Summary of the Invention

[0005] The present invention develops a recombinant BCG vaccine based on Brucella antigens, which can be used as a vaccine to induce high levels of cellular and humoral immune responses, thereby achieving the prevention or treatment of Brucella.

[0006] To achieve the above object, the present invention can adopt the following technical solutions:

[0007] On the one hand, the present invention provides a recombinant BCG vaccine, which is obtained by transferring the CU / ZN-SOD expression sequence into BCG (Bacillus Calmette-Guérin), and the CU / ZN-SOD expression sequence is as shown in SEQ ID NO:1.

[0008] On the other hand, the present invention provides a construction method of the recombinant BCG vaccine in the present invention, including: transferring the recombinant shuttle vector into BCG to obtain the recombinant BCG vaccine; wherein, the recombinant shuttle vector contains the CU / ZN-SOD expression sequence.

[0009] Preferably, the nucleotide sequence of the above recombinant shuttle vector is as shown in SEQ ID NO:2.

[0010] On the other hand, the present invention provides a Brucella vaccine, which comprises the recombinant BCG of the present invention.

[0011] On the other hand, the present invention provides an application of the recombinant BCG of the present invention in the preparation of a vaccine for preventing or treating Brucella infections.

[0012] Preferably, the above Brucella is Brucella melitensis.

[0013] Preferably, the above application includes: the application of the recombinant BCG in the preparation of a vaccine for inducing a Th1-type immune response.

[0014] On the other hand, the present invention provides an application of BCG in the preparation of a Brucella vaccine vector.

[0015] The beneficial effects of the present invention include: the recombinant BCG provided by the present invention can induce high levels of cellular and humoral immune responses, which tend to be Th1-type immune responses. In addition, the recombinant BCG has high immune safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Shows the PCR verification of the recombinant shuttle plasmid; where M: DNA marker; 1: negative control; 2: pMV361-CU / ZN-SOD;

[0017] Figure 2 Shows the double digestion identification of the recombinant expression plasmid; where 1: recombinant plasmid; 2: recombinant plasmid pMV361-CU / ZN-SOD digested with BamHI-EcoR I; M: DNA marker;

[0018] Figure 3 Shows the resistance screening of the recombinant BCG;

[0019] Figure 4 Shows the PCR identification of the genomic DNA of the recombinant BCG; where M: DNA marker; 1: rBCG-pMV-361; 2: rBCG--CU / ZN-SOD;

[0020] Figure 5 Shows the Western blot identification of the recombinant BCG; where 1: BCG strain; 2: recombinant BCG strain;

[0021] Figure 6Growth curve of recombinant BCG; among them, A: BCG; B: rBCG-pMV361-CU / ZN-SOD;

[0022] Figure 7 To detect the IFN-γ secretion level of splenocytes of mice immunized with recombinant BCG by ELISpot;

[0023] Figure 8 Specific antibody levels of IgG, IgG1 and IgG2 in the sera of mice immunized with recombinant BCG; among them, A: Changes in IgG antibody levels; B: Changes in IgG2a antibody levels; C: Changes in IgG1 antibody levels; D: Changes in the IgG2a / IgG1 ratio;

[0024] Figure 9 Virus challenge protection effect of mice immunized with recombinant BCG; among them, A: Spleen index of mice; B: Bacterial load in the spleen of mice. Detailed implementation manners

[0025] The examples given are for better illustration of the present invention, but the content of the present invention is not limited only to the examples given. Therefore, those skilled in the art who make non-essential improvements and adjustments to the implementation manners according to the above invention content still fall within the protection scope of the present invention.

[0026] The terms used herein are only for describing specific embodiments and are not intended to limit the present disclosure. Unless having a significantly different meaning in the context, the singular form of the expression includes the plural form of the expression. As used herein, it should be understood that terms such as "including", "having", "containing" are intended to indicate the existence of features, numbers, operations, components, parts, elements, materials or combinations. The terms of the present invention are disclosed in the specification, and are not intended to exclude the possibility of the existence or addition of one or more other features, numbers, operations, components, parts, elements, materials or their combinations. As used herein, depending on the circumstances, " / " can be interpreted as "and" or "or".

[0027] An embodiment of the present invention provides a recombinant BCG, which is obtained by transferring the CU / ZN-SOD expression sequence into BCG (also known as rBCG), and the CU / ZN-SOD expression sequence is as shown in SEQ ID NO:1.

[0028] It should be noted that the present invention is based on the Brucella CU / ZN-SOD gene and the tuberculosis vaccine strain Bacillus Calmette-Guérin (rBCG) vector, performs gene recombination, constructs a recombinant vector, and verifies the immune protection effect in mice; specifically, first constructs a recombinant shuttle vector; cultures and identifies Bacillus Calmette-Guérin to obtain competent Bacillus Calmette-Guérin; electrotransforms the shuttle vector into the competent state, and verifies by PCR, Western blot and growth curve; immunizes mice with the successfully constructed recombinant Bacillus Calmette-Guérin, and detects the spleen index and spleen CFU after challenging with Brucella to evaluate the vaccine protection ability; the results show that the recombinant Bacillus Calmette-Guérin rBCG-CU / ZN-SOD is successfully constructed, and the recombinant BCG strain grows well; after immunizing mice, it promotes the proliferation of T lymphocytes, forms an immune state dominated by Th1-type immune response, and can significantly improve the immune protection effect of mice.

[0029] The embodiment of the present invention also provides a method for constructing the recombinant Bacillus Calmette-Guérin in the present invention, including: transferring the recombinant shuttle vector into Bacillus Calmette-Guérin to obtain recombinant Bacillus Calmette-Guérin; wherein, the recombinant shuttle vector contains a CU / ZN-SOD expression sequence.

[0030] It should be noted that, as described above, the present invention obtains recombinant Bacillus Calmette-Guérin by transferring a recombinant shuttle vector containing a CU / ZN-SOD (copper-zinc superoxide dismutase) expression sequence into Bacillus Calmette-Guérin; wherein, the CU / ZN-SOD expression sequence is well known in the art.

[0031] In some specific examples, the nucleotide sequence of the above recombinant shuttle vector is as shown in SEQ ID NO:2.

[0032] It should be noted that the method for constructing the recombinant shuttle vector includes: first inserting CU / ZN-SOD into an expression vector to obtain a recombinant plasmid; then connecting the recombinant plasmid with the shuttle vector to prepare a recombinant shuttle vector; in addition, the expression vector and the shuttle vector are well known in the art, for example, the expression vector can be a pMD-19T vector, and the shuttle vector can be a pMV361.

[0033] The embodiment of the present invention also provides a Brucella vaccine, which includes the recombinant Bacillus Calmette-Guérin in the present invention.

[0034] It should be noted that the recombinant Bacillus Calmette-Guérin in the present invention can be used as a live vector vaccine, and can also be combined with other auxiliary reagents to prepare a Brucella vaccine. The auxiliary reagents are well known in the art, such as buffer solution, etc.

[0035] The embodiment of the present invention also provides an application of the recombinant Bacillus Calmette-Guérin in the present invention in the preparation of a vaccine for preventing or treating Brucella infection diseases.

[0036] It should be noted that the recombinant BCG in the present invention can be used as a vaccine for preventing or treating Brucella infection diseases, or can be prepared into a vaccine for preventing or treating Brucella infection diseases.

[0037] In some specific examples, the above-mentioned Brucella is Brucella melitensis.

[0038] It should be noted that the Brucella in the present invention is the well-known Brucella in the art, such as Brucella melitensis.

[0039] In some specific examples, the above application includes: the application of recombinant BCG in being used as or preparing a vaccine for inducing Th1-type immune response.

[0040] The embodiment of the present invention provides an application of BCG in being used as a Brucella vaccine vector.

[0041] It should be noted that the present invention discovers that BCG can be used as a Brucella vaccine vector to form a dual vaccine, improving the immune stimulation effect of the vaccine.

[0042] To better understand the present invention, the following specific examples are used to further clarify the content of the present invention, but the content of the present invention is not limited to the following examples.

[0043] In the following examples, the BCG strain and the pMV361 shuttle vector are preserved by Shihezi University; the Brucella M28 standard strain is preserved by Tiankang Biopharmaceutical Co., Ltd.

[0044] In the following examples, the restriction endonucleases (BamH I, EcoR I), T4 DNA ligase are all purchased from Takara Company; the bacterial genomic DNA extraction kit is purchased from Shanghai Jingnuo Biotechnology Co., Ltd.; magnesium citrate, sodium glutamate, magnesium sulfate, potassium dihydrogen phosphate are purchased from Shanghai Sangon Biological Company; 7H9 Broth and 7H10 Ager are purchased from BD Company;

[0045] Middlebrook ADC enrichment broth, Middlebrook OADC enrichment broth; acid-fast staining kit is purchased from Beijing Solarbio Science & Technology Co., Ltd. The McFarland turbidimeter (RSM-10051B) is purchased from Shanghai Ruiqi Biotechnology Co., Ltd.; the electroporator and the electroporation cuvette are purchased from Eppendorf Company.

[0046] I. Construction and identification of recombinant plasmid pMD-19T-CU / ZN-SOD

[0047] (I) Design and synthesis of primers

[0048] In the present invention, the designed primers are specific amplification primers and recombinant plasmid identification primers designed for the pMV361 plasmid and the CU / ZN-SOD (KF362132.1) gene sequence (SEQ ID NO: 1). They were synthesized by Shanghai Sangon Biotech Co., Ltd. After centrifuging the synthesized primers at 12,000 rpm for 10 min, they were dissolved in sterile water to a storage solution with a concentration of 100 pmol / μL and stored at -20°C for later use. The specific information of the primers is shown in Table 1 below.

[0049] Table 1 Primer Design

[0050]

[0051] (II) Construction of recombinant plasmid pMD-19T-CU / ZN-SOD

[0052] The target gene sequence was codon-optimized using online software; BamHI-EcoRI restriction sites were introduced, and a stop codon (TAA) was introduced downstream. It was synthesized by Anhui General Biotechnology Co., Ltd. Subsequently, the target gene was inserted into the pMD-19T vector to construct the recombinant plasmid pMD-19T-CU / ZN-SOD, which was stored at -20°C for later use.

[0053] (III) Identification of recombinant plasmid by colony PCR

[0054] The above-synthesized recombinant positive plasmid pMD-19T-CU / ZN-SOD was streaked on LB solid medium, and a single colony was picked and inoculated into LB liquid medium (containing Amp resistance). It was cultured with shaking at 37°C for 2 h. 2 μL of the bacterial liquid was taken as a template for colony PCR amplification and identification; the bacterial liquid identified as positive was transferred to 20 mL of LB medium and cultured with shaking overnight at 37°C; the reaction system for PCR amplification is shown in Table 2 below (where the upstream primer F: GGATCCATGAAGTCGCTGTT, the downstream primer R: TTCTTACTCGATCACACCGC); the reaction procedure was: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 40 s, annealing at 56°C for 30 s, extension at 72°C for 1 min, for 30 cycles; total extension at 72°C for 10 min.

[0055] Table 2 PCR Reaction System

[0056] Component System (20 μL) Forward primer (GGATCCATGAAGTCGCTGTT) 0.2 μL Reverse primer (TTCTTACTCGATCACACCGC) 0.2 μL Template 2 μL 2×Taq PCR Master Mix 10 μL <![CDATA[ddH 2 O]]> 7.6 μL

[0057] II. Construction and identification of recombinant shuttle vector pMV361-CU / ZN-SOD

[0058] (I) Construction of recombinant shuttle vector

[0059] The shuttle vector pMV361 was double-digested with BamHI / EcoRI restriction endonucleases, and then the gel was recovered and the pMD-19T-CU / ZN-SOD obtained by enzyme digestion and recovery was ligated to the shuttle vector pMV361 with T4 ligase to construct a recombinant shuttle vector; after the recombinant positive strain was used to extract plasmid DNA, it and the pMV361 empty vector were respectively double-digested with BamHI / EcoRI. The double-digestion reaction system is shown in Table 3 below, and the enzyme digestion conditions were in an incubator at 37°C for 4 h.

[0060] Table 3 Double-digestion reaction system

[0061] Component System (20 μL) Plasmid 10 μL <![CDATA[ddH 2 0]]> 6 μL Buffer 2 μL BamHI 1 μL EcoRI 1 μL

[0062] After the enzyme digestion was completed, 10 μL of the enzyme digestion product was subjected to 1.5% agarose gel electrophoresis at a voltage of 120 V and a current of 90 mA for about 30 min; then the gel of the enzyme digestion product was cut, and the product was recovered with a gel recovery kit and then ligated to the shuttle vector. The ligation system is shown in Table 4 below, and the ligation conditions were an overnight water bath at 16°C.

[0063] Table 4 Ligation system

[0064]

[0065]

[0066] (II) Identification of the recombinant shuttle vector

[0067] The positive colonies selected from the recombinant shuttle vector in the LB culture plate were shaken and activated, and bacterial liquid PCR identification was carried out (the reaction system is shown in Table 2). The PCR reaction conditions were: pre-denaturation at 95°C for 5 min, (denaturation at 94°C for 40 s, annealing at 56°C for 30 s, extension at 72°C for 1 min) for 30 cycles, and total extension at 72°C for 10 min; the results of the bacterial liquid PCR identification were as Figure 1 shown. The results showed that pMV361-CU / ZN-SOD ( Figure 1 ) amplified a band with a size of 531 bp, which was consistent with the size of the target gene fragment, indicating that the recombinant plasmid was successfully constructed.

[0068] In addition, the bacterial liquid with correct PCR amplification was transferred to a 20 mL conical flask for shaking culture, plasmid was extracted, and then double-digested with BamHI / EcoRI (the same as Table 3 above), and identified by 1.5% agarose gel electrophoresis; the identification results were as Figure 2As shown, the results showed that a 4684bp vector fragment band and three 531bp target bands were obtained, which were consistent with the size of the inserted target gene sequence. After subsequent sequencing identification, the recombinant shuttle plasmid was successfully constructed. In addition, the recombinant plasmid with correct digestion was sent for sequencing, and the recombinant shuttle plasmid with correct sequencing was named pMV361-CU / ZN-SOD (the sequence is shown in SEQ ID NO: 2), and it was stored in a glycerol tube and kept at -20°C for standby.

[0069] III. Preparation and Identification of Recombinant BCG

[0070] (I) Preparation of BCG Competent Cells

[0071] Inoculate BCG into 7H9 liquid medium (the finished product Bouillon 7H9 deMiddlebrook purchased from BD company) and culture for about 20 days. Place the bacterial liquid in an ice bath in an ice box for 50 min. Collect the pre-cooled BCG and centrifuge at 8000 rpm for 15 min in a 4°C centrifuge, and discard the supernatant. Resuspend BCG with pre-cooled sterile 10% glycerol water, centrifuge at 8000 rpm for 5 min, wash repeatedly 3 times, and discard the supernatant; finally, resuspend BCG with pre-cooled sterile 10% glycerol and dispense for use.

[0072] (II) Electroporation

[0073] Melt the recombinant shuttle plasmid and BCG competent cells on ice; aseptically pipette 10 μL of the recombinant shuttle plasmid into a sterile bench and add it to 100 μL of BCG competent cells. Gently pipette and mix well to avoid generating bubbles, and incubate on ice for 30 min. Slowly add the plasmid-competent cell mixture to a pre-cooled electroporation cuvette. Place it in an electroporator, adjust the voltage to 1800 v, the capacitance to 25 μF, the resistance to 400 Ω, and the transformation time to 5 ms. Electroporate once, twice, and three times respectively, with a 90 s interval each time. Take out the electroporation cuvette and quickly add 1 mL of 7H9 liquid medium without resistance to it. Pipette and mix well, transfer it to an empty 2 mL centrifuge tube, and place it in a 37°C constant temperature shaker for 48 h. After centrifuging at 8000 rpm for 5 min, discard the culture medium, and leave 100 μL of the culture medium to resuspend the strain. Use a spreading rod to evenly spread it on 7H10 solid medium (containing Kan resistance). Invert and place it in a 37°C incubator for culture. Add 2 mL of sterile water to the medium every 5 days to ensure the humidity of the culture environment and avoid the medium from drying out; culture for about 20 days. Wait until single colonies grow on the plate (refer to Figure 3 ), randomly pick 10 single colonies, inoculate them into 7H9 liquid medium with Kan resistance for culture; collect the bacterial liquid for identification of recombinants.

[0074] (III) PCR Verification of Recombinant BCG

[0075] Collect the recombinant BCG bacterial solution, grind the bacteria with a grinder, and extract the genomic DNA of recombinant BCG using a mycobacterium genomic DNA extraction kit; using the extracted genomic DNA as a template, amplify the target gene by PCR for PCR identification (the identification method is the same as the method of "colony PCR identification of recombinant plasmid" mentioned above).

[0076] The results of PCR identification are as Figure 4 shown. A target band with a size of approximately 531 bp was amplified, which was consistent with the expected size, indicating that the recombinant shuttle plasmid had been successfully transferred into BCG competent cells. The sequencing results were all correct, indicating that the recombinant BCG was successfully constructed and named rBCG-CU / ZN-SOD; in addition, the recombinant strain with correct sequencing was stored in a glycerol preservation tube and stored at -20 °C.

[0077] (IV) Western blot verification of recombinant BCG

[0078] Transfer the recombinant strain with positive PCR identification to 100 mL of 7H9 liquid medium for culture. After 20 days, collect the bacteria, extract the total bacterial protein, and perform SDS-PAGE and Western blot analysis. The specific methods are as follows: Perform SDS-PAGE electrophoresis on the extracted total protein. After the electrophoresis is completed, cut the gel where the target protein size is located; and corresponding-sized filter paper and 0.22 μm PVDF. Soak the filter paper and gel in the transfer buffer for later use, and activate the PVDF membrane in methanol. Place these three layers of materials in a transfer apparatus and stack them in turn from the negative electrode to the positive electrode: three layers of filter paper - gel - PVDF membrane - three layers of filter paper. Avoid generating air bubbles in each layer and place them in an electrotransfer apparatus, and add cold transfer buffer for electrotransfer. The electrotransfer conditions are: 80 V voltage, 300 mA constant current. After the electrotransfer is completed, place the PVDF membrane in 5% skim milk powder for blocking, block at room temperature for 2 h or block overnight at 4 °C. After the blocking is completed, wash the PVDF membrane 3 times with TBST for 10 min each time, incubate with the primary antibody (rabbit anti-CU / ZN-SOD antibody), and incubate overnight at 4 °C. Wash the membrane 3 times with TBST. Incubate the secondary antibody (HRP-labeled goat anti-rabbit IgG) at room temperature for 2 h. After washing the membrane 3 times with TBST, add the high-sensitivity ECL chromogenic solution, place it in a dual-color laser imaging split system in the dark for color development and luminescence, and take pictures and save. If the detection is as Figure 5 shown, the results indicate that the recombinant BCG can produce a specific band with the polyclonal antibody against CU / ZN-SOD, and the size is about 18 kDa, which is consistent with the theoretical molecular weight of the inserted protein, indicating that the recombinant BCG rBCG--CU / ZN-SOD was successfully constructed.

[0079] (V) Plotting the growth curve of recombinant BCG

[0080] The correctly identified recombinant BCG was inoculated into 100 mL of 7H9 liquid medium at a ratio of 1:1000 and cultured in a shaker at 37°C. Every three days, 1 mL was taken, homogenized and ground, and the absorbance at OD600 was measured (1 mL of the bacterial solution grown for a certain period of time was taken, ground completely using a homogenizer, fully mixed, 200 μL was taken and placed in a 96-well plate, and the absorbance at OD600 was measured using an enzyme-linked immunosorbent assay reader), and the growth curve was plotted to determine the logarithmic growth phase of the recombinant BCG; the growth activities of the parental strain and the recombinant strain were compared; the recombinant BCG in the logarithmic growth phase was re-cultured, the bacterial solution was collected, ground, and serially diluted by a factor of 10. 100 μL of the serially diluted BCG was evenly spread on a 7H10 solid culture plate and cultured at 37°C for 15 days. The colonies in the counting plate were counted and the average value was calculated to obtain the colony CFU in the logarithmic growth phase.

[0081] The results are as Figure 6 shown. It can be seen from the curve that the growth rate of the recombinant BCG is similar to that of the parental strain BCG, reaches its peak at 15 days of proliferation, and the logarithmic growth phase is around OD600 of 0.9, and the bacterial solution concentration is 5×10 9 CFU / mL.

[0082] IV. Animal experiments

[0083] (I) Immunization of mice with recombinant BCG

[0084] Female BALB / c mice aged 4 - 6 weeks were randomly divided into 3 groups of 12 each; after counting the colonies of the recombinant BCG rBCG-CU / ZN-SOD and the BCG strain, they were adjusted to 1×10 7 CFU / mouse and injected subcutaneously at 100 μL per mouse. Among them, PBS was used as a blank control. Booster immunization was carried out 14 days after the first immunization. All vaccine groups had their tail veins bled every 7 days after the first immunization to collect serum, which was stored at -20°C for later use.

[0085] (II) Detection of IFN-γ secretion by mouse spleen lymphocytes using ELISpot

[0086] (I) Isolation of mouse spleen lymphocytes

[0087] (1) Three mice from each group at 28 days and 42 days after the first immunization were randomly sacrificed by cervical dislocation and soaked in 75% alcohol for 10 minutes.

[0088] (2) The spleens of the mice were aseptically removed and placed in a 2 mL EP tube to weigh the spleen weight;

[0089] (3) 1 mL of homogenate was added to cut the spleen into pieces, and all the tissues were ground while rinsing with the homogenate. It was filtered through a 70 μm sterile cell sieve and finally collected in a 15 mL centrifuge tube, and centrifuged at 450×g for 10 minutes;

[0090] (4) Discard the supernatant, and resuspend the splenocytes by adding 1 - 4 mL of sample diluent;

[0091] (5) Take another 15 - mL centrifuge tube and add 4 mL of separation solution. Slowly add the cell suspension from the previous step to the upper layer of the separation solution, and centrifuge at 490×g for 25 min;

[0092] (6) Slowly aspirate the middle milky white lymphocyte layer into a new 15 - mL centrifuge tube. Add 10 mL of washing solution and centrifuge at 400×g for 10 min;

[0093] (7) Discard the supernatant, resuspend the cells by adding 5 mL of cleaning solution, and centrifuge at 250×g for 10 min;

[0094] (8) Discard the supernatant and repeat step (7);

[0095] (9) Discard the supernatant. Add 1 mL of 1640 culture medium (containing 10% fetal bovine serum, and the 1640 culture medium is purchased from Gibio's RPMI 1640 medium) to the tube to resuspend the mouse splenocytes, and take 10 μL of the cells for cell counting.

[0096] II) Detection of IFN - γ secretion by mouse splenocytes using ELISpot

[0097] (1) Wash the ELISPOT plate 4 times with sterile PBS (200 μL / well);

[0098] (2) Add 200 μL of 1640 cell culture medium with 10% fetal bovine serum and incubate at room temperature for 30 min;

[0099] (3) Pour out the culture medium and seed 1×10 6 splenocytes;

[0100] (4) Add 10 μL of ConA (100 μg / mL) as the positive control well, 10 μL of PBS as the negative control well; 10 μL of inactivated Brucella (1×10 7 CFU) as the experimental group; Seal the plate with a sealing film and incubate in a 37°C, 5% CO2 incubator for 48 h;

[0101] (5) Discard the cell culture in the plate and wash 5 times with PBS;

[0102] (6) Dilute the detection antibody to 1 μg / mL with PBS containing 0.5% fetal bovine serum, filter through a 0.22 - μm filter membrane, add 100 μL, and incubate at room temperature for 2 h;

[0103] (7) Discard the detection antibody in the plate and wash 5 times with PBS;

[0104] (8) Dilute streptavidin-ALP with PBS (1×PBS buffer containing 0.5% fetal bovine serum, purchased from Procell) at a ratio of 1:1000, add 100 μL to each well, and incubate at room temperature for 1 h.

[0105] (9) Discard streptavidin-ALP in the plate and wash 5 times with PBS.

[0106] (10) Filter the substrate solution (BCIP / NBT-plus) with a 0.45 μm filter membrane and add 100 μL for color development.

[0107] (11) Rinse with tap water to terminate the reaction.

[0108] (12) Perform spot counting using an ELISpot reader, take pictures for preservation and perform statistical analysis.

[0109] The results are as Figure 7 shown. The results show that after immunizing mice with recombinant BCG, after re-stimulating splenic lymphocytes with specific antigen, the secretion of IFN-γ can be significantly increased. Among them, the recombinant BCG rBCG-CU / ZN-SOD group is significantly higher than the PBS control group and the BCG control group (p < 0.05). The results indicate that the Brucella recombinant BCG rBCG-CU / ZN-SOD can significantly induce the improvement of the cellular immune level in mice.

[0110] (III) Detection of specific antibody IgG, IgG1, IgG2a levels by indirect ELISA

[0111] Use the serum of the immunized mice collected above as the test serum, and detect the expression levels of specific antibodies IgG, IgG1, IgG2a of a single antigen in each test serum by indirect ELISA; first, use the checkerboard titration method to screen the optimal dilution concentrations of ELISA-coated antigen, test serum and secondary antibody. The optimal concentration of ELISA-coated antigen is 2 μg / mL, the concentration of test serum is 1:500, and the optimal dilution concentration of secondary antibody is 1:100000; then perform indirect ELISA detection, as follows:

[0112] (1) Dilute the purified recombinant protein (the recombinant protein CU / ZN-SOD expressed and purified using the prokaryotic expression system above) with ELISA coating buffer (1×ELISA coating buffer purchased from Solarbio), that is, 50 mM sodium bicarbonate solution (pH = 9.6) at 4 concentration gradients: 4 μg / mL, 2 μg / mL, 1 μg / mL, and 0.5 μg / mL as the coating antigen, add 100 μL to each well of a 96-well ELISA plate, seal with a sealing film and incubate at 4 °C overnight for coating.

[0113] (2) On the next day, discard the coating solution, wash the plate 5 times with PBST at 300 μL / well; after blotting dry the liquid with blotting paper, add 5% BSA blocking solution at 200 μL / well and block at 37 °C for 2 h;

[0114] (3) Discard the blocking solution, wash 5 times with PBST. Use the serum from mice immunized with recombinant protein CU / ZN-SOD as the primary antibody and set it as the positive serum; use the serum from normal mice as the primary antibody and set it as the negative serum. Dilute them with PBST (purchased from Solarbio, 1×PBST) to 1:50, 1:100, 1:200, and 1:400 respectively; add them into a 96-well ELISA plate at 100 μL / well and incubate at 37 °C for 1 h;

[0115] (4) Discard the primary antibody, wash 5 times with PBST. Use HRP-labeled goat anti-mouse IgG, goat anti-mouse IgG1, and goat anti-mouse IgG2a as the secondary antibodies respectively, and dilute them at 1:10000, 1:50000, and 1:100000 respectively; add 100 μL / well and incubate at 37 °C for 1 h;

[0116] (5) Discard the secondary antibody, wash 5 times with PBST. Add 100 μL of single-component TMB chromogenic solution (purchased from Solarbio) to each well, incubate at room temperature in the dark for 15 min; add 50 μL / well of stop solution to terminate the reaction; immediately place it into an enzyme-linked immunosorbent assay instrument (purchased from TECAN, Sunrise TM ) and read the OD value at a wavelength of 450 nm; Result determination: Set the OD value of the positive serum as the P value and the OD value of the negative serum as the N value. Take P / N value ≥ 2.1 as the effective value, and select the antigen coating concentration, the dilution of the serum to be tested, and the dilution concentration of the secondary antibody corresponding to the maximum P / N value as the optimal conditions;

[0117] (6) Establish an indirect ELISA detection method according to the optimized conditions explored to detect the levels of specific antibodies IgG, IgG1, and IgG2a in the sera to be tested from mice immunized with each group of vaccines at 7 d, 14 d, 21 d, 28 d, 35 d, and 42 d. And calculate the ratio of IgG2a to IgG1.

[0118] The detection results are as Figure 8 shown, and the results show that:

[0119] Growth and decline pattern of specific antibody IgG: The expression of specific antibody IgG showed a gradually increasing trend from 7 d to 42 d after immunization, reached the peak at 28 d and then remained at a high level without a downward trend. The rBCG-CU / ZN-SOD group was significantly higher than the PBS control group (p < 0.05) ( Figure 8 A), indicating that recombinant BCG can produce high levels of specific IgG antibodies after immunizing mice.

[0120] Growth pattern of specific antibody IgG2a: The expression of specific antibody IgG2a showed a gradually increasing trend from 7 days to 42 days after immunization, reached the peak at 21 days and then remained at a high level, which was significantly higher than that of the PBS control group (p < 0.05)( Figure 8 B), indicating that the recombinant BCG could induce high levels of specific IgG2a antibodies in immunized mice and mediate Th1-type humoral immune responses.

[0121] Growth pattern of specific antibody IgG1: The levels of specific antibody IgG1 in each group began to increase after 21 days of immunization, reached the peak at 35 days. The recombinant BCG could induce low levels of specific IgG1 antibodies in immunized mice and mediate Th2-type humoral immune responses( Figure 8 C).

[0122] The statistical results of the IgG2a / IgG1 ratio showed that the IgG2a / IgG1 ratios in the rBCG-CU / ZN-SOD group of the recombinant BCG vector vaccine were all greater than 1, indicating that the immune responses induced by it were all biased towards Th1-type immune responses; and the IgG2a / IgG1 ratio was the highest at 42 days after immunization, indicating that the body was still in a stage of high-level immune response at 42 days after immunization( Figure 8 D).

[0123] (IV) Brucella challenge

[0124] At 42 days after immunization of each group of mice, 100 μL (containing 1×10 5 CFU) of the virulent strain of Brucella melitensis (M28 strain) was intraperitoneally inoculated. After challenge, the feeding and mental status changes of the mice were observed daily. After 14 days, the mice were sacrificed, their spleens were removed and weighed. The spleens of each group were separated, ground and plated, and colony counting was performed; specifically as follows: 6 mice were randomly selected from each group 14 days after Brucella challenge, euthanized by dislocation and weighed, soaked in 75% alcohol for 10 min, the spleens were aseptically removed and weighed, the spleens were placed in 2 mL centrifuge tubes, 1 mL of 0.2% Triton X-100 and steel beads were added, and homogenized to a meat paste in a homogenizer. 100 μL of the tissue homogenate was taken from each group for serial dilution, and 100 μL of each dilution was spread on Brucella solid medium (TSA), inverted and cultured in a 37 °C incubator for 3 - 5 days. After colonies grew on the plate, CFU counting was performed and statistical analysis was done.

[0125] The results were as Figure 9 shown. After challenge, the degree of spleen enlargement in the rBCG-CU / ZN-SOD group of the vaccine was significantly smaller than that of the PBS control group, with a significant difference (p < 0.01)( Figure 9 A); the bacterial load in the spleen was significantly smaller than that of the PBS control group (p < 0.05)( Figure 9B); The above results indicate that the BCG vector vaccine can reduce the degree of splenomegaly and the amount of bacteria carried during reinfection in mice.

[0126] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the purpose and scope of the technical solutions of the present invention, and they should all be covered by the scope of the claims of the present invention.

Claims

1. A recombinant BCG vaccine, characterized in that: The CU / ZN-SOD expression sequence was transferred into Bacillus Calmette-Guérin (BCG) to obtain a recombinant BCG, and the CU / ZN-SOD expression sequence is shown in SEQ ID NO:

1.

2. The method for constructing the recombinant BCG vaccine according to claim 1, characterized in that: include: The recombinant shuttle vector is transferred into BCG to obtain the recombinant BCG; wherein the recombinant shuttle vector contains the CU / ZN-SOD expression sequence.

3. The construction method according to claim 2, characterized in that: The nucleotide sequence of the recombinant shuttle vector is shown in SEQ ID NO:

2.

4. Brucella vaccine, characterized in that Including the recombinant BCG vaccine described in claim 1.

5. Use of the recombinant BCG vaccine according to claim 1 as or in the preparation of a vaccine for preventing or treating Brucella infection.

6. The use according to claim 5, characterized in that: The Brucella is Brucella melitensis.

7. The use according to claim 5 or 6, characterized in that: Applications include: Use of recombinant BCG as or in the preparation of a vaccine for eliciting a Th1 type immune response.

8. The use of Bacillus Calmette-Guérin (BCG) as a Brucella vaccine vector.

Images