A pta gene inactivated bovine mycobacterium bacillus calmette-guerin mutant strain and application thereof

By constructing the B494 mutant strain of Mycobacterium bovis with inactivated pta gene, the problem of unstable protective efficacy of existing vaccines was solved, and the attenuation effect and safety in macrophages were improved, providing a candidate strain for a novel tuberculosis vaccine.

CN122146545APending Publication Date: 2026-06-05HUAZHONG AGRI UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HUAZHONG AGRI UNIV
Filing Date
2026-01-23
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing bovine mycobacterium BCG vaccines offer unstable protection for adults and pose safety risks. The lack of in-depth research on the role of pta genes in regulating mycobacterial metabolism and virulence presents challenges in developing novel tuberculosis vaccines.

Method used

A library of BCG mutants from Mycobacterium bovis was constructed using Himar1 transposon random insertion technology. The mutant strain B494, which had its pta gene inactivated, was screened out and its survival and stress tolerance were evaluated in a macrophage model. Its attenuated characteristics were verified by metabolic analysis and morphological observation.

Benefits of technology

The inactivation of the pta gene leads to energy metabolism disorders, intracellular acidification, and morphological changes, which significantly weakens the survival and proliferation ability of the mutant strain B494 in macrophages. It has clear attenuation characteristics and good safety, making it suitable for the development of novel tuberculosis vaccines.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146545A_ABST
    Figure CN122146545A_ABST
Patent Text Reader

Abstract

This invention discloses a plant pta The study of gene-inactivated BCG mutant strains and their applications falls under the fields of biotechnology and infectious disease prevention and control. Mutant strain B494 (accession number CCTCC NO.M 20253064) was obtained through screening a random insertion mutant library of Mycobacterium bovis BCG. Identification revealed that the mutation occurred in... pta The gene (SEQ ID NO.1), inactivation of which leads to impaired bacterial energy metabolism, intracellular acidification, decreased tolerance to environmental stress, and reduced survival and proliferation capacity within macrophages. This invention discloses... pta Genes play a central role in regulating mycobacterial metabolism and virulence. The mutant strain B494 exhibits significant attenuated characteristics and can serve as a candidate strain for novel attenuated live tuberculosis vaccines or for screening anti-tuberculosis drugs that regulate metabolism.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and infectious disease prevention and control technology, and relates to a Mycobacterium bovis BCG mutant strain and its application in the preparation of BCG vaccines. Background Technology

[0002] Bovine tuberculosis is caused by Mycobacterium bovis (Bacillus subtilis). Mycobacterium bovis Mycobacterium tuberculosis complex (MBTC) is a zoonotic, chronic, wasting infectious disease that seriously threatens livestock production and public health security. Mycobacterium tuberculosis complex, Members of MTBC, including Mycobacterium bovis and Mycobacterium tuberculosis in humans ( Mycobacterium tuberculosis Highly homologous to BCG and with a broader host range, it can survive long-term within macrophages and evade immune clearance. Its pathogenic mechanism involves a highly complex metabolic regulatory network and the expression of virulence factors. Currently, the only approved tuberculosis vaccine globally is the Mycobacterium bovis BCG vaccine (BCG BCG vaccine). Mycobacterium bovis Bacille Calmette-Guerin M.bovis While BCG (biologically modified cirrhotic tuberculosis) is effective, its protective efficacy against pulmonary tuberculosis in adults is unstable and poses certain safety risks. Therefore, developing a new generation of tuberculosis vaccines with higher safety and better immunogenicity is a current research focus.

[0003] Bacterial metabolic activities not only maintain their growth and energy supply but are also closely related to their virulence and pathogenicity. Products or intermediate metabolites of metabolic pathways can act as signaling molecules, directly or indirectly regulating the expression of virulence factors, the activity of secretory systems, and the bacteria's ability to adapt to host environmental stress. Acetic acid metabolism is one of the core pathways of bacterial energy metabolism, and phosphotransacetylase (PTA) is a key enzyme in this pathway, catalyzing the reaction of acetyl-CoA with inorganic phosphate to produce acetyl phosphate (AcP). AcP is not only an important intermediate product of energy metabolism but also a key donor for the non-enzymatic acetylation of protein lysine.

[0004] Although PTA is known to play a role in bacterial metabolic homeostasis, there is still much to be done regarding its role. pta How genes specifically participate in maintaining the homeostasis of the mycobacterial internal environment, and how these genes regulate bacterial survival and stress levels within host cells through metabolic chain reactions, remains poorly understood, especially their potential as vaccine attenuation targets. Therefore, screening and identifying key genes that can simultaneously regulate mycobacterial metabolism and virulence is crucial for elucidating the pathogenic mechanisms of mycobacteria, developing novel anti-tuberculosis drugs, and constructing next-generation candidate vaccine strains. Summary of the Invention

[0005] The purpose of this invention is to provide a Mycobacterium bovis BCG mutant strain and its application in the preparation of BCG vaccines, while also clarifying... pta The specific mechanisms and roles of genes in regulating mycobacterial metabolism and virulence.

[0006] To achieve the above objectives, this invention constructed a library of Mycobacterium bovis BCG (BCG) mutants using Himar1 transposon random insertion mutation technology. Growth-deficient strains were screened in a medium with sodium acetate as the sole carbon source, and the mutant genes were identified using reverse PCR and sequencing. The insertion site was verified by PCR. Next, the intracellular viability of the mutant strains was assessed using a macrophage infection model, and their stress tolerance was analyzed under acidic and oxidative stress conditions. Finally, the levels of key metabolites (acetyl phosphate AcP, acetyl-CoA Ac-CoA) and ATP were measured by ELISA, intracellular pH was detected using the fluorescent probe BCECF-AM, and morphological changes in the bacteria were observed by scanning electron microscopy.

[0007] Finally, a mutant strain B494 with severe growth defects under sodium acetate carbon source was obtained through screening. pta Transposon insertion within the gene leads to inactivation. Compared to the wild-type strain, B494 showed significantly reduced survival in THP-1 macrophages (P<0.01); its growth was severely inhibited under oxidative stress (P<0.001), while exhibiting some tolerance in an acidic environment. Metabolic analysis revealed abnormal accumulation of AcP in B494 cells (P<0.05), inhibited Ac-CoA synthesis (P<0.01), significantly reduced ATP levels (P<0.01), and markedly acidified intracellular environment (P<0.001). Morphological observation showed that B494 cells were shorter and deformed, with a significantly reduced average length (P<0.001).

[0008] The above results indicate that pta Genes are key factors in maintaining metabolic homeostasis and virulence in Mycobacterium bovis. Their inactivation leads to impaired bacterial energy metabolism, intracellular acidification, decreased stress tolerance, and morphological changes, ultimately weakening the bacteria's survival and proliferation capacity within macrophages. This mutant strain (B494) exhibits a clear attenuation mechanism and good safety profile, making it a potential candidate strain for developing novel live attenuated tuberculosis vaccines and providing an important model for studying the metabolic-virulence interactions of mycobacteria.

[0009] The more detailed technical solution is as follows: A mutant strain of Mycobacterium bovis BCG (BCG) is disclosed, wherein the mutant strain is an inactivating mutation of the phosphoroacetyltransferase (PTA) gene in the wild-type BCG genome, resulting in impaired phosphoroacetyltransferase function. The nucleotide sequence of the phosphoroacetyltransferase gene is shown in SEQ ID NO. 1, and the amino acid sequence encoding the protein is shown in SEQ ID NO. 2. The preservation number of the mutant strain is CCTCC NO. M 20253064.

[0010] Preferably, the inactivation mutation is achieved by inserting a foreign DNA sequence into the coding region of the phosphorylacetyltransferase gene, wherein the foreign DNA sequence is the Himar1 transposon.

[0011] The mutant strain has at least one of the following biological characteristics: 1) Growth is inhibited in a medium with sodium acetate as the carbon source: This “acetic acid auxotroph” strain can be partially compensated for in the host, so it can still grow to a limited extent to stimulate immunity. This feature is also beneficial for monitoring the genetic stability of vaccine strains during production. 2) Reduced survival rate within macrophages: This helps reduce the risk of spread and disease caused by vaccination, decreases local inflammation and systemic reactions, and makes vaccination possible for immunocompromised individuals; 3) Increased tolerance to acidic environments and enhanced sensitivity to oxidative stress; B494 can survive for a short period in acidic phagolysosomes, giving it more time to be processed and presented, resulting in a stronger and more lasting immune response; and once macrophages are activated to produce reactive oxygen species (ROS), B494 will be rapidly inactivated, greatly enhancing the biosafety of the vaccine. 4) Increased intracellular acetyl phosphate content and decreased acetyl-CoA and ATP content: This energy depletion ensures the weakening of bacterial virulence, greatly reducing the risk of spread and pathogenicity in the body. However, the bacteria are not completely dead; they can still be phagocytosed and express antigens to a limited extent, thereby effectively inducing durable T-cell immune memory. 5) Intracellular acidification: This inherent acidification trend prevents mutant strains from restoring virulence or establishing persistent infection; 6) The bacterial cell length is shortened, exhibiting morphological characteristics of attenuated virulence.

[0012] Furthermore, the present invention also provides the use of the aforementioned Mycobacterium bovis BCG mutant strain in the preparation of a medicament for the prevention or treatment of tuberculosis. Preferably, the medicament is a BCG vaccine containing the aforementioned mutant strain and a pharmaceutically acceptable carrier or adjuvant.

[0013] It should be noted that this invention not only screened for mutant strain B494 using Himar1 transposon random insertion mutation technology, but also identified the specific mutant gene and a clear insertion site. Based on this, other genetic engineering techniques, such as homologous recombination gene knockout, CRISPR / Cas9 gene editing, and antisense RNA technology, were used to obtain... pta Gene knockout or silenced BCG strains can achieve the same effect as mutant strain B494.

[0014] The beneficial effects of this invention are as follows: 1) This invention is the first to be identified and confirmed. pta Genes are key targets regulating the metabolism and virulence of Mycobacterium bovis. Inactivation of this gene leads to severe impairment of bacterial energy metabolism, intracellular acidification, and a significant decrease in tolerance to environmental stress (especially oxidative stress), ultimately resulting in a substantial reduction in the bacteria's survival and proliferation capacity within macrophages. This attenuation method based on a clearly defined metabolic defect offers greater safety and controllability compared to traditional empirical attenuation, and is applicable to a wider range of populations, including individuals with potential immunodeficiency.

[0015] 2) The unique "acid-resistant but oxygen-intolerant" phenotype gives this mutant strain relative tolerance in acidic phagosomes, prolonging the "window period" for antigen processing and immune initiation; at the same time, its high sensitivity to oxidative stress ensures effective clearance after activation of the immune system. This combination of phenotypes allows it to more effectively mimic the immune activation process in the early stages of natural infection while avoiding the risk of persistent infection, potentially inducing stronger and more durable protective immune memory.

[0016] 3) This invention systematically verified the attenuated phenotype of the mutant strain from multiple dimensions, including growth curve, intracellular survival, stress tolerance, key metabolites (AcP, Ac-CoA), energy level (ATP), intracellular pH, and cell morphology, providing sufficient scientific basis for its use as a vaccine candidate strain.

[0017] 4) This mutant strain can not only serve as a candidate strain for a new generation of tuberculosis preventive or therapeutic vaccines, but also as a unique model for studying the cross-regulation of mycobacterial metabolism and immunity, as well as a platform for constructing recombinant vector vaccines, which has important scientific value and application potential. Attached Figure Description

[0018] Figure 1 The growth curves of the Mycobacterium bovis mutant library under sodium acetate carbon source are shown. Among them, 387, 389, 494, 567, 575, and 1160 represent the six mutant strains selected in the experiment. The red circle marks 494, which represents mutant strain B494, which shows obvious growth defects under sodium acetate carbon source.

[0019] Figure 2Figure 1 shows the sequencing chromatograms of the damaged gene in mutant strain B494 and a schematic diagram of the insertion site. Figure A compares the sequencing chromatograms of wild-type and mutant sequences, with the black double arrow in the middle indicating the insertion site of the Tn (transposon) at approximately 2068 bp; Figure B shows... pta The genome sequence map shows the inserted sequence of the Himar1 transposon marked with a purple box. The results confirm that the transposon insertion occurred in... pta The 758th position of the gene (corresponding to position 523358 after the BCG Pasteur 1173P2 genome) leads to gene inactivation.

[0020] Figure 3 : PCR electrophoresis identification of the transposon insertion site in mutant strain B494. M represents the DL 2000 DNA Marker; lanes 1 and 2 represent mutant strain B494, showing a positive amplification band at approximately 883 bp, confirming the transposon insertion site. pta Intragenic insertion; lanes 3 and 4 are wild-type (WT) controls, and no amplification bands were observed.

[0021] Figure 4 Bar chart showing the relative survival rate of the Mycobacterium bovis BCG B494 mutant strain in THP-1 macrophages. The horizontal axis represents time post-infection, and the vertical axis represents the relative survival rate relative to 0h (%). In the figure, "**" indicates the survival rate compared to the wild-type WT group. P <0.01, "***" indicates a difference compared to the wild-type WT group. P <0.001.

[0022] Figure 5 Growth curve of Mycobacterium bovis BCG B494 mutant strain under acid stress. The horizontal axis represents culture time (Time / days), and the vertical axis represents OD600 value; "*" in the figure indicates that compared with the wild-type WT group, P<0.05.

[0023] Figure 6 Growth curve of Mycobacterium bovis BCG B494 mutant strain under oxidative stress. The horizontal axis represents culture time (Time / days), and the vertical axis represents OD600 value; "***" in the figure indicates that compared with the wild-type WT group, P<0.001.

[0024] Figure 7 A comparative statistical chart of acetyl phosphate (AcP) content in bacterial cells of different groups of strains. The vertical axis represents AcP content (ng / L); "*" in the figure indicates a comparison with the wild-type WT group. P <0.05. The results showed that AcP accumulated significantly in the B494 mutant strain.

[0025] Figure 8 A comparative statistical chart of acetyl-CoA (Ac-CoA) content in bacterial cells of different groups of strains. The vertical axis represents Ac-CoA content (ng / L); "***" in the figure indicates a comparison with the wild-type WT group. P <0.001. The results show that Ac-CoA synthesis is inhibited in the B494 mutant strain.

[0026] Figure 9 : Statistical graph of ATP content in bacterial cells of each group of strains. The vertical axis represents the ATP level per unit protein content (ATP / protein nmol / mg); "**" in the graph indicates a comparison with the wild-type WT group. P <0.01. The results confirmed that the B494 mutant strain has a severe energy metabolism disorder.

[0027] Figure 10 Statistical graph of intracellular pH measurement (BCECF-AM fluorescence intensity) for each group of strains. The vertical axis represents fluorescence intensity; in the graph, "**" indicates a comparison with the wild-type WT group. P <0.01. The results confirmed that the intracellular environment of the B494 mutant strain was significantly acidified.

[0028] Figure 11 Scanning electron microscope (SEM) images of the morphological characteristics of each group of strains.

[0029] Figure 12 : A statistical graph of cell length for each group of bacterial strains. The vertical axis is in units of... μ m; in the figure, "***" indicates the comparison with the wild-type WT group. P <0.001. Detailed Implementation

[0030] The present invention will be further described in detail below with reference to specific embodiments. Unless otherwise specified, the experimental operations involved in the embodiments are conventional technical means; unless otherwise specified, the reagents or materials are all from commercial sources.

[0031] Example 1: Screening and phenotypic identification of Mycobacterium bovis BCG mutant strains The Mycobacterium bovis BCG Pasteur strain (ATCC: 35734) was used as the parent strain (wild-type strain, WT), and a temperature-sensitive bacteriophage was used. MycoMarT 7 (carry) Himar 1. Transposons), infected during the logarithmic growth phase (OD) according to conventional phage transfection methods. 600 The parental strain was approximately 0.8 μg / mL. The infected bacterial suspension was spread onto a plate containing 50 μg / mL kanamycin (≈0.8). KanOn 7H11 solid medium, the bacteria were cultured at 37°C for 3-4 weeks, and all resistant colonies were collected to establish a random insertion mutant library of Mycobacterium bovis BCG vaccine.

[0032] The strains from the above mutant library were inoculated separately into cells containing... Kan The strain was amplified in 7H9 liquid medium, and then washed with PBS and resuspended in M9 minimal medium (without carbon source). The initial OD of the strain in the logarithmic growth phase was adjusted. 600 The values ​​were consistent, approximately 0.1. The culture was carried out in M9 medium with different substances (0.5% glucose, 0.5% glycerol, 0.5% pyruvate, 0.5% sodium acetate) as the sole carbon source, and the OD was measured periodically. 600 Values ​​and plot growth curves.

[0033] The screening results are as follows Figure 1 As shown, when 0.5% sodium acetate was used as the sole carbon source, the wild-type WT strain and other mutant strains exhibited normal logarithmic growth phases, while the OD of the B494 mutant strain was significantly lower. 600 The value showed almost no increase over 12 days, remaining completely stagnant. Furthermore, it was found that when glucose, glycerol, or pyruvate were used as carbon sources, the growth trend of the B494 mutant was essentially the same as that of the wild-type WT and other mutants. This result strongly demonstrates that the B494 mutant exhibits a specific blockage of the acetic acid metabolism pathway, and preliminarily identifies its mutated gene as a key metabolic regulatory gene.

[0034] The selected B494 mutant strain, classified as *Mycobacterium bovis* B494, was deposited at the China Center for Type Culture Collection (Wuhan) on December 31, 2025, with accession number CCTCC NO. M 20253064. This mutant strain was obtained through transposon insertion mutation technology using *Mycobacterium bovis* BCG Pasteur strain (ATCC 35734) as the parent strain.

[0035] Example 2: Identification and Verification of Mutation Sites in the B494 Mutant Strain 1. Location and sequence alignment of mutant genes Genomic DNA was extracted from the B494 mutant strain of Mycobacterium bovis BCG using the conventional CTAB method. The linker between the Himar1 transposon and the strain genome was amplified and sequenced using reverse PCR. The sequencing results were compared with the complete genome sequence of Mycobacterium bovis BCG (BCG Pasteur 1173P2, Accession: GCA_000009445.1).

[0036] The results are as follows Figure 2As shown, this confirms that the damaged gene in the B494 mutant strain is... pta Gene (Gene ID: 4695793). The transposon is inserted at position 523358 of the genome, corresponding to... pta After the 758th base within the gene (full length as shown in SEQ ID NO. 1). This insertion results in pta The gene reading frame is truncated, preventing the normal expression of phosphoacetyltransferase.

[0037] 2. PCR experiments to verify transposon insertion. To further verify the role of transposons pta Precise insertion in genes is achieved using SnapGene software based on transposon edge sequences and pta Gene sequence-specific identification primers were designed (Tn-F: GTCCCGCTCAGAAGAACTCGTCAA; Tn-R: TGGATGGCTTTCTTGCCGCC). PCR amplification was performed using B494 mutant genomic DNA as a template and wild-type BCG (WT) genomic DNA as a negative control.

[0038] The verification results are as follows Figure 3 As shown: Lanes 1 and 2 (B494 mutant strain) both amplified specific positive bands of approximately 883 bp, confirming that the transposon had successfully inserted into the target gene. Lanes 3 and 4 (wild-type BCG) did not show amplified bands because the primers could not pair due to the absence of transposon sequences in the genome. This experiment confirms at the molecular level that the B494 mutant strain... pta The gene is physically blocked by transposons.

[0039] Example 3: Detection of intracellular viability of the Mycobacterium bovis BCG B494 mutant strain The intracellular viability of the strain was evaluated using a macrophage model induced by the human mononuclear cell line THP-1. 1) Cell induction: at 2×10 6 THP-1 cells were seeded into 12-well plates at a ratio of cells / well, and PMA was added to induce their adherence and differentiation. The cells were then cultured at 37°C and 5% CO2. 2) Cell washing: Wash three times with RPMI-1640 incomplete medium before infection to remove non-adherent cells and cell debris; 3) Strain infection: Wild-type strain BCG and mutant strain B494 in the logarithmic growth phase were washed, dispersed and counted by HBSS, and infected into THP-1 cells at a ratio of 10:1 with a multiplicity of infection (MOI) of 10:1 and incubated at 37°C for 4 h. 4) Removal of foreign bacteria: Discard the infected supernatant, wash 3 times with incomplete culture medium; add 100... μ Gentamicin at a concentration of g / mL was incubated in RPMI-1640 complete medium for 1 h to kill any remaining extracellular bacteria. 5) Continue culturing: After antibiotic treatment, wash three more times and continue culturing in RPMI-1640 complete medium without antibiotics. This time point is counted as 0 h post-infection. 6) Colony counting: Cells were collected at 0 h, 12 h, 24 h, 48 h and 72 h post-infection. Cells were lysed with 0.05% Triton X-100. The lysate was spread on 7H11 solid medium at an appropriate dilution and incubated at 37°C for 3-4 weeks before colony counting (CFU).

[0040] Experimental results are as follows Figure 4 As shown, in the initial stage of infection (0 h), there was no significant difference in the initial bacterial load entering the cells between the wild-type and mutant strains. However, with the extension of infection time, at 48 h and 72 h, the wild-type strain WT continued to proliferate (relative survival rates reached approximately 150% and 170%, respectively), while the proliferation of the mutant strain B494 was significantly inhibited (relative survival rate remained at approximately 130%). Statistical analysis indicated that at 48 h (… P <0.01) and 72h ( P At two time points (<0.001), the intracellular viability of B494 was significantly lower than that of the wild-type strain.

[0041] This result strongly proves pta Gene inactivation impairs the adaptability and proliferation of Mycobacterium bovis within host cells, resulting in a significantly reduced virulence phenotype.

[0042] Example 4: Environmental stress adaptability test of B494 mutant strain Acid stress test: Logarithmic growth phase suspensions of wild-type BCG and B494 mutant strains were collected, centrifuged, washed, and resuspended in pH 4.5 acid stress medium. The suspensions were cultured at 37°C and 5% CO2, and OD values ​​were measured periodically. 600 Values ​​were calculated and a growth curve was plotted. The results are as follows: Figure 5 As shown, the B494 mutant strain exhibits a tolerance trend in acidic environments compared to the wild-type strain.

[0043] Oxidative stress assay: Bacterial cells were resuspended in oxidative stress culture medium containing 1 mM tBHP. Results are as follows. Figure 6 As shown, under oxidative stress, the growth of the B494 mutant strain was significantly inhibited, and its cell density was significantly lower than that of the wild-type strain on days 6-8. P<0.001), indicating pta Gene inactivation reduces the ability of Mycobacterium bovis to resist oxidative damage.

[0044] Example 5: Determination of key metabolites AcP and Ac-CoA in the B494 mutant strain Wild-type strain WT, mutant strain B494, and complement strain B494C were cultured to the logarithmic growth phase. The bacterial pellet was collected by centrifugation, resuspended in pre-cooled lysis buffer, and sonicated. The supernatant was collected by high-power centrifugation at 4°C as the test sample. Using commercial AcP ELISA and Ac-CoA ELISA kits, samples and standards were added to pre-coated antibody-coated plates. Incubation, washing, antibody binding, and colorimetric reaction were performed sequentially. Absorbance was measured at 450 nm, and the AcP and Ac-CoA concentrations (ng / L) were calculated based on the standard curve.

[0045] The results of AcP content determination are as follows: Figure 7 As shown, the intracellular acetyl phosphate (AcP) content of mutant strain B494 was significantly higher than that of wild-type strain WT. P <0.05), indicating pta Gene inactivation blocked the conversion of acetyl phosphate to acetyl-CoA or acetic acid, leading to its abnormal intracellular accumulation. However, the AcP level in the replacement strain B494C was significantly reduced, recovering to levels close to those of the wild-type strain, demonstrating that this metabolic difference was caused by… pta Caused by gene inactivation.

[0046] The results of the AcCoA content determination are as follows: Figure 8 As shown, the AcCoA content in mutant strain B494 was significantly lower than that in WT (P<0.01), while the complement strain B494C effectively restored the Ac-CoA level. This indicates that... pta As a key node in the Pta-AckA pathway, the gene plays a central regulatory role in maintaining the homeostasis of acetyl donors within the bacteria.

[0047] Example 6: Determination of homeostasis in the B494 mutant strain 1. Determination of ATP content Wild-type WT and mutant B494 were cultured to the logarithmic growth phase (OD). 600nm (≈0.6-0.8), collect bacterial cells by centrifugation and wash three times with PBS. Add 100-200 μL of lysis buffer for complete lysis, centrifuge at 12000g for 5 min at 4℃ and collect the supernatant. Add 100 μL of ATP detection working solution to the detection well and let it stand at room temperature for 3-5 min to consume the background ATP. Then add 20 μL of sample or standard, mix quickly and use a chemiluminescence analyzer to measure the RLU value. Calculate the ATP content according to the standard curve and normalize it in combination with the protein concentration.

[0048] The results are as follows Figure 9 As shown, compared with the wild-type WT strain, the intracellular ATP level of the mutant strain B494 was significantly reduced ( P <0.01), its energy level is only about 40% of that of the wild plant. This indicates that pta Gene inactivation severely disrupts the bacterial energy metabolism pathway, leading to insufficient ATP synthesis, which in turn inhibits bacterial life activities and proliferation.

[0049] 2. Measurement of intracellular pH Collect cells in the logarithmic growth phase and adjust the concentration to OD. 600 ≈0.6, add 10 under light-protected conditions μ M BCECF-AM fluorescent probe was incubated at 37℃ for 30 min, washed to remove unbound probe, and resuspended. The double excitation ratio (excitation wavelength 490 nm / 440 nm, emission wavelength 530 nm) was detected using a microplate reader.

[0050] The results are as follows Figure 10 As shown, the fluorescence intensity (representing intracellular pH) of the mutant strain B494 was significantly lower than that of the wild-type strain and the complement strain. P <0.001). This indicates that in pta After gene inactivation, bacteria lose their ability to maintain intracellular acid-base homeostasis, resulting in significant acidification of the intracellular environment. This disruption of the internal environment, combined with insufficient ATP supply, leads to a decrease in the virulence of the strain.

[0051] Example 7: Observation of morphological characteristics of the B494 mutant strain Wild-type strain WT, mutant strain B494, and complement strain B494C were cultured to the logarithmic growth phase. Cell pellets were collected and fixed with 2.5% glutaraldehyde at 4°C for 24 h. The fixed samples were washed with PBS, dehydrated using a gradient of ethanol (30%, 50%, 70%, 80%, 90%, 95%, 100%), critical point drying, and sputter-coated with gold. The surface morphology and cell arrangement of each group of strains were observed using scanning electron microscopy (SEM). Using ImageJ or related image analysis software, typical fields of view of each group of strains were randomly selected from the SEM images. At least 100 complete individual cells were measured from each group, and their lengths were recorded. μ m) and statistical analysis was performed using GraphPad Prism.

[0052] Morphological observation results as follows Figure 11As shown in the scanning electron microscopy results, the wild-type strain WT exhibits a typical long rod shape with a smooth surface and relatively regular cell arrangement. In contrast, the mutant strain B494 shows a significant change in cell morphology, characterized by shorter, thinner cells and a degree of distortion. The complement strain B494C reverts to a long rod shape, essentially consistent with the wild type.

[0053] Length statistics results are as follows Figure 12 As shown, the average length of wild-type WT is mainly distributed between 2.0 and 4.0 mm. μ Between m, while the average length of mutant B494 was significantly shortened ( P <0.001), with most bacterial cells concentrated at 2.0 mm in length. μ Approximately m. The cell length distribution of the reinjected strain B494C returned to the level of the wild-type strain.

[0054] The above morphological evidence intuitively shows that, pta Gene inactivation leading to disordered acetyl metabolism and energy (ATP) deficiency has severely interfered with the normal synthesis of the cell wall or cell division and development of Mycobacterium bovis, resulting in a significantly weakened morphology of the bacteria.

[0055] In summary, this invention, through random transposon mutation technology, has for the first time identified a key gene regulating acetic acid metabolism in Mycobacterium bovis BCG vaccine. pta Experiments confirmed that inactivation of this gene leads to inhibited Ac-CoA synthesis, a significant decrease in ATP energy levels, and acidification of the intracellular environment, resulting in altered bacterial morphology, decreased environmental adaptability, and significantly weakened proliferation capacity within macrophages. Therefore, this... pta The gene-inactivated mutant strain B494 has excellent safety and attenuation characteristics, making it an important candidate strain for developing novel tuberculosis preventive vaccines or therapeutic agents.

Claims

1. A mutant strain of Mycobacterium bovis BCG (BCG), characterized in that: The mutant strain is an inactivating mutation of the phosphoroacetyltransferase (PTA) gene in the wild-type BCG genome, resulting in impaired phosphoroacetyltransferase function in the mutant strain. The nucleotide sequence of the phosphoroacetyltransferase gene is shown in SEQ ID NO. 1, and the preservation number of the mutant strain is CCTCC NO. M 20253064.

2. The mutant strain according to claim 1, characterized in that: The inactivation mutation is achieved by inserting a foreign DNA sequence, specifically the Himar1 transposon, into the coding region of the phosphorylacetyltransferase gene.

3. The Mycobacterium bovis BCG mutant strain according to claim 1 or 2, characterized in that, The mutant strain has at least one of the following biological characteristics: 1) Growth is inhibited in a medium with sodium acetate as the carbon source; 2) Reduced survival rate within macrophages; 3) Increased tolerance to acidic environments and improved sensitivity to oxidative stress; 4) Intracellular acetyl phosphate levels are increased, while acetyl-CoA and ATP levels are decreased; 5) The intracellular environment becomes acidic; 6) The bacterial cell length is shortened, exhibiting morphological characteristics of attenuated virulence.

4. The use of the bovine Mycobacterium BCG mutant strain according to claim 1 or 2 in the preparation of a drug for the prevention or treatment of tuberculosis.

5. The application according to claim 4, characterized in that: The drug is a BCG vaccine containing the mutant strain and a pharmaceutically acceptable carrier or adjuvant.

6. The application of reagents for knocking out or silencing the phosphoacetyltransferase gene in the preparation of BCG live attenuated vaccine, wherein the nucleotide sequence of the phosphoacetyltransferase gene is shown in SEQ ID NO. 1.