Sephatase dsGlu519 from deep sea and application thereof

Abstract

The invention belongs to the technical field of enzyme engineering and metagenomics, and relates to dextranase dsGlu519 from deep sea and application of the dextranase dsGlu519. The amino acid sequence of the enzyme is shown as SEQ ID NO.1 in a sequence table. The dextranase dsGlu519 from the deep sea, provided by the invention, can be used for effectively catalyzing a beta-glucan substrate in an environment of 30-80 DEG C so as to generate reducing sugar. The wide temperature adaptability enables the catalyst to be better suitable for extreme industrial application scenes, optimization of an existing industrial process can be promoted, possibility is provided for development of a new bioconversion technology, and therefore the catalyst has important significance in the fields of food processing and biomass catalysis.

Description

Technical Field

[0001] The present invention belongs to the technical fields of enzyme engineering and metagenomics, and relates to a dextranase dsGlu519 derived from the deep sea and its uses. Background Art

[0002] In the field of biomass conversion, β-1,3-dextranase, as an important biocatalyst, plays a crucial role. This enzyme can efficiently decompose the dextran in the cell wall, providing a basis for subsequent bioconversion processes. Dextranases are mainly divided into endoenzymes and exoenzymes, which are responsible for cleaving the inside and ends of dextran respectively, thereby decomposing it into smaller sugar molecules. Among them, the endoenzyme hydrolyzes β-1,3-dextran from the inside of the sugar chain, exerting the main hydrolytic activity, and the exoenzyme hydrolyzes the β-1,3-dextran substrate one by one from the non-reducing end of the sugar chain, playing a certain auxiliary role.

[0003] The potential of dextranase in industrial applications is gradually being explored, providing raw materials for the production of biofuels and other industrial processes. In the paper industry, dextranase can convert xylan in paper industry, fertilizers and agricultural waste into xylose monomers, and then into fuel. In the textile industry, dextranase can be used for degumming treatment of fibers to improve the softness and spinnability of fibers. The application of dextranase in the food industry and feed industry is also relatively extensive. In the food industry, due to the presence of dextran, the extraction rate in the sugar industry is reduced, and losses are caused by the increase in the residual sucrose content in molasses. Using dextranase to treat the dextran in the decoction can effectively reduce sugar losses; in addition, in the beer brewing process, dextranase can be used to reduce the viscosity of wort, improve the filtration performance, increase the malt dissolution rate, prevent beer turbidity, and stabilize the beer quality. In the feed industry, dextranase in feed can be used to reduce the content of non-starch polysaccharides and their anti-nutritional factors, improve the absorption of nutrients by livestock and poultry, and increase the growth rate and feed conversion efficiency of livestock and poultry.

[0004] With the continuous development of biotechnology, significant progress has been made in the research and improvement of dextranase. Through genetic engineering and protein engineering means, scientists have developed a variety of highly efficient and stable dextranases, which not only have significantly improved activity and stability, but also show excellent heat resistance and stress resistance. There is currently a blank for dextranases that can exhibit high activity under extreme temperature conditions such as low temperature and high temperature. Summary of the Invention

[0005] The object of the present invention is to fill the blank in the prior art and provide a dextranase dsGlu519 mined and identified from the deep-sea hydrothermal vent metagenome, which can effectively catalyze β-dextran substrate to generate reducing sugars in an environment of 30 - 80°C.

[0006] To achieve the above object, the technical solution adopted by the present invention is as follows: A dextranase dsGlu519 derived from the deep sea, whose amino acid sequence is shown in SEQ ID NO.1 in the sequence listing.

[0007] Preferably, the nucleotide sequence of the gene encoding the dextranase dsGlu519 is shown in SEQ ID NO.2 in the sequence listing.

[0008] Preferably, the present invention also provides an expression vector containing the gene, and the expression vector is a eukaryotic vector, a prokaryotic vector, a plasmid vector or a viral vector.

[0009] Preferably, the present invention also provides a host cell containing the expression vector, and the host cell is a bacterium.

[0010] Preferably, the present invention also provides an engineered strain, and the engineered strain contains the gene or the expression vector.

[0011] The present invention also provides the use of the dextranase dsGlu519 in catalyzing β-glucan substrate to generate reducing sugar in an environment of 30-80 °C.

[0012] The present invention further provides the use of the expression vector, the gene, the host cell, and the engineered strain in the preparation of β-1,3-dextranase dsGlu519.

[0013] The dextranase dsGlu519 derived from the deep sea provided by the present invention can effectively catalyze the β-glucan substrate to generate reducing sugar in an environment of 30-80 °C. Its broad temperature adaptability enables it to be better applicable to relatively extreme industrial application scenarios, which can not only promote the optimization of existing industrial processes, but also provide the possibility for the development of new biotransformation technologies. Therefore, the present invention has important significance in the fields of food processing and biomass catalysis. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 It is the plasmid map of pET22b expressing dsGlu519 in the embodiment of the present invention; Figure 2 It is the SDS-PAGE analysis result of purified dsGlu519; wherein, M is the protein marker; 1 is the purified dsGlu519; Figure 3 It is a schematic diagram of determining the dextranase activity by the DNS method; Figure 4 It is the standard curve of the glucose solution; Figure 5 It is the enzyme activity of dsGlu519 at different temperatures; Figure 6 Activity comparison of dsGlu519 catalyzing different substrates. Detailed implementation mode

[0015] To facilitate the understanding of this research, the following will provide a more detailed description of this research in combination with the accompanying drawings and specific embodiments. However, this research can be implemented in many different forms and is not limited to the embodiments described in this specification. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosed content of this research more thorough and comprehensive.

[0016] This invention screens from deep-sea metagenomes and obtains a glucanase named dsGlu519, which can specifically hydrolyze β-1,3-glycosidic bonds. The amino acid sequence of this enzyme is shown in Sequence Listing SEQ ID NO.1, and the nucleotide sequence of its encoding gene is shown in Sequence Listing SEQ ID NO.2.

[0017] The following conducts tests and verifications on the functional characteristics and catalytic activities of this enzyme through experiments.

[0018] I. Preparation of the substrate of dsGlu519 Laminarin (L9634, Merck, Darmstadt, Germany) is used to verify the function of dsGlu519, and an acidic buffer solution with a pH of 4.8 is used to dissolve the laminarin substrate. Weigh 0.2 g of the laminarin substrate into a beaker, add 20 mL of the acidic buffer solution, place it in an 80°C water bath with magnetic stirring until the laminarin is completely dissolved, then stop heating and continue stirring until it cools down, and make up the volume to 2.5 mL with the acidic buffer solution to make its final concentration 8 mg / mL.

[0019] Preparation of the acidic buffer solution: Weigh 176.52 g of disodium hydrogen phosphate dodecahydrate and 53.26 g of citric acid monohydrate into a beaker, add about 800 mL of distilled water and dissolve it fully, then transfer it to a 5 L volumetric flask, adjust the pH to 4.8 ± 0.05 with sodium hydroxide solution (200 g / L) or citric acid solution (0.1 mol / L), and finally make up the volume with distilled water and shake well.

[0020] II. Analysis of the dsGlu519 gene and protein sequences To determine the novelty of the dsGlu519 amino acid sequence, the present invention searched for its homologous proteins in GenBank through online BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) and arranged them according to sequence similarity. As shown in Table 1, among the top 10 proteins with the highest sequence identity, the first sequence is dsGlu519 of the present invention, and this sequence is derived from the MAG database. However, this MAG sequence is only the result of metagenomic data assembly and has not been experimentally verified. Its function, enzymatic properties, and potential for industrial applications have not been publicly disclosed. The present invention has carried out cloning, expression, and functional verification for the first time, and has detailedly determined its enzymatic characteristics, proving that the enzyme has significant catalytic activity and stability under specific conditions, providing an experimental basis for its potential value in the fields of biocatalysis, industrial applications, etc., and has revealed its biological function and application value for the first time, showing important novelty.

[0021] Table 1. Protein sequences with high identity to dsGlu519 in GeneBank GeneBank accession number Amino acids length Identity (%) MCD6105519.1 277 100.00 (MAG) MBO8139524.1 277 98.56 MDK2886546.1 276 75.27 MBZ4649601.1 282 69.09 WP_004103002.1 276 69.09 MDK2886545.1 279 66.27 MEN6515316.1 236 63.79 MCD6253614.1 643 63.78 WP_407635689.1 633 63.49 AEH51752.1 647 63.49 。

[0022] 1. Cloning of the dsGlu519 gene The full gene was synthesized based on the dsGlu519 amino acid sequence and codon-optimized for E. coli expression. The synthesized sequence is shown in SEQ ID NO.1 in the sequence listing. The dsGlu519 gene fragment was amplified using Glu-F and Glu-R as primers. Using pET22b as a template, 22b-F and 22b-R were used as primers to linearly amplify pET22b. The primer sequences are shown in Table 2. The PCR amplification conditions were: 98°C for 30 seconds; 98°C for 10 seconds, 56°C for 5 seconds, 72°C for 10 seconds, for 35 cycles; 72°C for 1 minute, and then cooled to 4°C for storage.

[0023] Table 2. Primers for cloning dsGlu519 into pET22b and their sequences Primer Primer sequence (5’ - 3’) Serial number Glu-F ctgcccagccggcgatggccTGTGAAAATAAAGTATTTAATAACACAGATGA SEQ ID NO.3 Glu-R cagtggtggtggtggtggtgTTTCACTTTCTGCCACACCTTAAT SEQ ID NO.4 22b-F CACCACCACCACCACCACTG SEQ ID NO.5 22b-R GGCCATCGCCGGCTGGGC SEQ ID NO.6 。

[0024] 2. Construction of engineering strains The obtained dsGlu519 fragment was ligated with the linearized pET22b vector fragment using a seamless cloning kit (ClonExpress II One Step Cloning Kit, Novoprotein, Nanjing) to form the expression vector pET22b-dsGlu519, and the map is as Figure 1 shown, and transformed into the E. coli expression strain Escherichia coli BL21(DE3) pLysS to obtain the expression strainE. coli dsGlu519. Strain E. coli dsGlu519 expresses a fusion protein with a pelB signal peptide at the N-terminus and a His tag at the C-terminus, and dsGlu519 can be obtained by Ni-NTA affinity chromatography for activity detection.

[0025] 3. Expression and purification of dsGlu519 Pick E. coli dsGlu519 monoclonal colonies are inoculated into the medium (containing 50 μg / mL ampicillin and 20 μg / ml chloramphenicol double resistance) for seed culture, and cultured in a shaker at 37°C and 220 rpm for 8 - 12 h; the scale of the enlarged culture is 1:500 - 1:100, and cultured in a shaker at 37°C and 220 rpm for about 4 - 6 hours. When OD 600 reaches 0.8 - 1.2, IPTG is added to start induction, and the final concentration of IPTG can be 0.2 - 1 mM. The induction conditions are 18 - 30°C for 18 - 24 h. The induced bacterial solution is centrifuged at 4°C and 3000 - 6000 g for 10 minutes to collect the bacterial cells.

[0026] The collected bacterial cells are resuspended with 50 mL of pre-cooled lysis buffer, and the bacterial cells are lysed using an ultrasonic disruptor in an ice bath. The lysis program is a power of 290 W, ultrasonic disruption for 4 s, stop for 8 s, and the total ultrasonic duration is 15 min. Centrifuge at 4°C, 13000 g for 60 min to take the supernatant. The supernatant is incubated with 3 mL of Ni-NTA resin at 4°C for 1 hour to allow the target protein to fully bind to the resin. Wash with 15 mL of lysis buffer and 15 mL of wash buffer successively, and elute and collect the target protein with 5 mL of elution buffer. Concentrate the eluate to 2.5 mL using an Ultracel-30K ultrafiltration tube. Equilibrate the desalting column PD-10 with 25 mL of desalting buffer, add 2.5 mL of the concentrated protein solution to the desalting column PD-10, add 3.5 mL of desalting buffer to collect the protein, and the collected effluent is dsGlu519. Concentrate dsGlu519 to 1 mL using an Ultracel-30K ultrafiltration tube, measure the absorbance at 280 nm using a micro-spectrophotometer to determine the concentration of the purified protein, and take 5 μL of the protein for SDS-PAGE detection. The detection results are as Figure 2 shown. The remaining protein is quickly frozen with liquid nitrogen and stored at -80°C.

[0027] The formulations of the above protein purification buffers are as follows: Lysis buffer (1 L): 7.8 g NaH 2 PO 4 ·3H 2 O, 17.532 g NaCl, 100 g glycerol, 0.6808 g imidazole, pH 8.0.

[0028] Wash buffer (1 L): 7.8 g NaH 2 PO 4 ·3H 2 O, 17.532 g NaCl, 100 g glycerol, 1.3616 g imidazole, pH 8.0.

[0029] Elution buffer (1 L): 7.8 g NaH 2 PO 4 ·3H 2 O, 17.532 g NaCl, 100 g glycerol, 17.02 g imidazole, pH 8.0.

[0030] Desalting buffer (1 L): 7.8 g NaH 2 PO 4 ·3H 2 O, 17.532 g NaCl, 100 g glycerol, pH 8.0.

[0031] III. Plotting of the substrate standard curve For the determination of glucanase activity, laminarin is used as the substrate. The process is as Figure 3 follows: After the substrate is hydrolyzed to produce glucose monomers, this reducing sugar can reduce the nitro group of DNS to an amino group under alkaline and heated conditions, producing a brownish-red substance that exhibits a characteristic absorption peak at 485 nm. After respectively pipetting 1 mL of acidic buffer solution and glucose series standard working solutions into graduated test tubes, 1 mL of water and 2.5 mL of DNS reagent are added, mixed well, and then placed in a boiling water bath for 5 min, and then cooled to room temperature with running water and made up to 12.5 mL with water. Using the blank as a control, the absorbance is measured at a wavelength of 540 nm. With the glucose mass (mg) as the ordinate and the absorbance as the abscissa, a standard curve is plotted, and the results are as Figure 4 shown.

[0032] Preparation of glucose series standard working solutions: Weigh 1 g of anhydrous glucose dried to a constant weight at 105 °C into a 100 mL volumetric flask, dissolve it with distilled water and make up to the mark. Respectively pipette 1 mL, 2 mL, 3 mL, 4 mL, 5 mL, 6 mL and 7 mL of the prepared glucose solution into 100 mL volumetric flasks, and make up to the mark with acidic buffer solution so that the mass of glucose in each milliliter is 0.1 - 0.7 mg.

[0033] IV. Determination of the enzyme activity of dsGlu519 at different temperatures One of the most representative proteins of β-glucanase is Blg32, which was isolated from Bacillus lehensis , and showed high activity towards β-glucan substrates. Pipette 0.5 - 1 mL of glucanase sample into a 100 mL volumetric flask, add 80 mL of acidic buffer solution, stir well for 30 min, then make up to 100 mL with acidic buffer solution and mix evenly. Then continue to dilute it twice with acidic buffer solution to control the glucanase activity at 0.04 - 0.08 U / mL. Using laminarin as the reaction substrate, first pipette 10 mL of the dissolved substrate, equilibrate it in a 50 °C water bath for 5 min, and at the same time pipette 10 mL of the glucanase sample solution, equilibrate it in a 50 °C water bath for 5 min.

[0034] The present invention uses the DNS method to determine the enzyme activity, and the specific method is as follows: Under the conditions of pH 4.8, 30 °C, 50 °C and 80 °C, a 12.5 ml reaction system includes 1 mL of appropriately diluted enzyme solution and 1 mL of glucanase substrate. After reacting for 30 min, add 2.5 mL of DNS reagent to terminate the reaction, heat it in a boiling water bath for 5 min, and measure the absorbance value of the sample at a wavelength of 540 nm after cooling to room temperature. In the blank control group, under the conditions of pH 4.8, 30 °C, 50 °C and 80 °C, first add 1 mL of appropriately diluted enzyme solution and react for 30 min, then supplement 1 mL of glucanase substrate, and then immediately add 2.5 mL of DNS reagent to terminate the reaction, heat it in a boiling water bath for 5 min, and measure the absorbance value of the sample at a wavelength of 540 nm after cooling to room temperature. One enzyme activity unit (U) is defined as the amount of enzyme that releases 1 μmol of reducing sugar from a β-glucan solution with a mass concentration of 4 mg / mL in 1 minute under certain temperature and pH conditions.

[0035] The glucanase enzyme activity is calculated according to Equation 1: Equation 1; In the formula, is the β-glucanase activity of the sample, U / mL; is the mass of glucose calculated from the absorbance on the standard curve, mg; 1000 is the conversion coefficient between millimoles and micromoles, 1 mmol = 1000 μmol; is the sample dilution factor; is the sample volume, mL; 180.2 is the molar mass of glucose, mg / mmol; is the enzymatic hydrolysis reaction time, min.

[0036] The reaction results are as Figure 5 shown. The activities of Blg32 and dsGlu519 at 30 °C reached 474.27 and 109.94 U / mg respectively, 2275.72 and 301.81 U / mg at 50 °C, and 1026.99 and 1285.15 U / mg at 80 °C.

[0037] V. Activity comparison of dsGlu519 catalyzing different substrates In this example, laminarin, yeast β-glucan, and barley β-glucan were used as reaction substrates respectively to compare the activities of dsGlu519 and Blg32. 1 mL of dsGlu519 and 1 mL of glucanase substrate were incubated at pH 4.8 and 80 °C for 30 min, and 1 mL of Blg32 and 1 mL of glucanase substrate were incubated at pH 4.8 and 50 °C for 30 min. Then, 2.5 mL of DNS reagent was added to terminate the reaction. After heating in a boiling water bath for 5 min and cooling to room temperature, the absorbance of the sample was measured at a wavelength of 540 nm.

[0038] The reaction results are as Figure 6 shown. Both dsGlu519 and Blg32 showed high activities towards the laminarin substrate, and also showed certain catalytic activities towards yeast and barley β-glucan, demonstrating their great application potential in the food processing and biomass conversion industries.

Claims

1. A deep-sea glucanase dsGlu519, characterized in that: The amino acid sequence is shown in the sequence listing SEQ ID NO.

1.

2. The gene encoding the glucanase dsGlu519 according to claim 1, characterized in that The nucleotide sequence is shown in the sequence listing SEQ ID NO.

2.

3. An expression vector comprising the gene according to claim 2, characterized in that: The expression vector is a eukaryotic vector, a prokaryotic vector, a plasmid vector or a viral vector.

4. A host cell comprising the expression vector according to claim 3, characterized in that: The host cell is a bacterium.

5. An engineered strain, characterized in that: The engineered strain comprises the gene according to claim 2 or the expression vector according to claim 3.

6. The use of the glucanase dsGlu519 according to claim 1, characterized in that: The glucanase dsGlu519 catalyzes β-glucan substrate to generate reducing sugars under the environment of 30-80°C.

7. Use of the gene according to claim 2, the expression vector according to claim 3, the host cell according to claim 4 or the engineered strain according to claim 5 in preparing the glucanase dsGlu519 according to claim 1.

Images