Method and primer group for identifying Frankliniella occidentalis and Flavothrips theasali and application of primer group

Abstract

The invention relates to the technical field of molecular biology, and particularly discloses a method and a primer group for identifying Frankliniella occidentalis and Flavothrips tawaiiensis and application, the method comprises the following steps: extracting genome DNA of a to-be-detected sample, and using the primer group Sd-F, Sd-R, Fo-F and Fo-R to carry out dual PCR amplification; if only a band with the size of 254bp appears on the amplification product, determining that the sample to be detected is the thrips thealensis; if only a band with the size of 362bp appears on the amplification product, the sample to be detected is the Frankliniella occidentalis; if two bands with the lengths of 254bp and 362bp simultaneously appear on the amplification product, the sample to be detected is a mixed sample of the thrips theasali and the thrips occidentalis. The method provided by the invention can be used for quickly and accurately distinguishing and identifying the Frankliniella occidentalis and the Flavoniella rebaudiana, is high in specificity, and can be used for quickly identifying the important pests Frankliniella occidentalis and Flavoniella rebaudiana in a blueberry planting area in actual production.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and particularly relates to a method, primer set and application for differentiating Frankliniella occidentalis and Scirtothrips dorsalis. Background Art

[0002] Blueberries are known as the "king of berries". Blueberries have a sour and sweet taste and are very beneficial to the human body. Blueberries are low in calories but high in dietary fiber, vitamin C and vitamin K; blueberries can reduce DNA damage, help prevent aging and cancer; in addition, blueberries can also protect cholesterol in the blood from damage and lower blood pressure, etc. to reduce the risk of heart disease. As a high-value agricultural product, the blueberry industry has broad market prospects, can provide rich economic benefits for farmers, and drive the development of local modern agriculture and industrial chains. Therefore, it has gradually attracted people's attention, and its market and consumer demand are also constantly expanding.

[0003] The planting areas of blueberries are widely distributed, including Anhui, Hunan, Hubei, Jiangsu, Shandong, Liaoning and other places. However, with the increase in planting area, agricultural pests, especially thrips, have become increasingly serious year by year, posing a major threat to the yield and quality of blueberries. Thrips damage parts such as the flowers, young leaves, young shoots, and young fruits of blueberries, causing symptoms such as blocked flower development, curling and wrinkling of young leaves, slow growth of young shoots, and scars on the fruit surface. The main thrips species on blueberries include Frankliniella occidentalis and Scirtothrips dorsalis. The two thrips species are relatively small, about 1 mm in size, and it is difficult to distinguish and identify them morphologically with the naked eye. In production, the control of these two thrips mainly relies on the combination of chemical and physical control methods. However, the resistance of the two thrips species to chemical pesticides is inconsistent, and improper use of pesticides will increase the resistance of thrips. In addition, there are differences in the color tropism of Frankliniella occidentalis and Scirtothrips dorsalis. Frankliniella occidentalis is attracted to blue, while Scirtothrips dorsalis is attracted to yellow. At present, the differentiation and identification of Frankliniella occidentalis and Scirtothrips dorsalis mainly rely on traditional morphological identification, which requires professional knowledge of insect taxonomy and is difficult to master. Therefore, there is a need to develop a method for quickly differentiating Frankliniella occidentalis and Scirtothrips dorsalis. Summary of the Invention

[0004] To develop a new method for differentiating Frankliniella occidentalis and Scirtothrips dorsalis, the present invention provides a method, primer set and application for differentiating Frankliniella occidentalis and Scirtothrips dorsalis. The method provided by the present invention can accurately distinguish and identify Frankliniella occidentalis and Scirtothrips dorsalis, has strong specificity, and can be used for the rapid identification of the important pests Frankliniella occidentalis and Scirtothrips dorsalis in blueberry planting areas in actual production.

[0005] The present invention provides a method for differentiating Frankliniella occidentalis and Scirtothrips dorsalis, comprising the following steps: Extract the genomic DNA of the sample to be tested, and perform duplex PCR amplification using a primer combination; the primer combination includes Sd-F shown in SEQ ID NO.1, Sd-R shown in SEQ ID NO.2, Fo-F shown in SEQ ID NO.3, and Fo-R shown in SEQ ID NO.4; If only a band with a size of 254 bp appears in the amplification product, the sample to be tested is Frankliniella intonsa; if only a band with a size of 362 bp appears in the amplification product, the sample to be tested is Frankliniella occidentalis; if two bands with lengths of 254 bp and 362 bp appear simultaneously in the amplification product, the sample to be tested is a mixed sample of Frankliniella intonsa and Frankliniella occidentalis.

[0006] In the present invention, specific primers Fo-F and Fo-R for Frankliniella occidentalis and specific primers Sd-F and Sd-R for Frankliniella intonsa are used as a primer set to amplify the genomic DNA of the sample to be tested, and the sample to be tested is identified as Frankliniella occidentalis or Frankliniella intonsa by distinguishing the size of the amplification product. The method provided by the present invention can quickly and accurately distinguish and identify Frankliniella occidentalis and Frankliniella intonsa, has strong specificity, and can be used for the rapid identification of important pests Frankliniella occidentalis and Frankliniella intonsa in blueberry planting areas in actual production.

[0007] Further, the duplex PCR amplification system includes 0.4 μL - 1.6 μL of primer Sd-F, 0.4 μL - 1.6 μL of primer Sd-R, 0.8 μL - 1.6 μL of primer Fo-F, and 0.8 μL - 1.6 μL of primer Fo-R.

[0008] Further, the duplex PCR amplification system is 20 μL: 0.4 μL - 1.6 μL of each of primer Sd-F and Sd-R, 0.8 μL - 1.6 μL of each of primer Fo-F and Fo-R, 1.6 μL - 2 μL of template DNA, 10 μL - 10.5 μL of 2×Taq Master Mix, and the balance is ddH2O.

[0009] Further, the duplex PCR amplification system is 20 μL: 0.8 μL of each of primer Sd-F, Sd-R, Fo-F, and Fo-R, 2 μL of template DNA, 10 μL of 2×Taq Master Mix, and the balance is ddH2O.

[0010] Further, the duplex PCR amplification reaction conditions are: pre-denaturation at 94°C - 94.5°C for 5 min; 35 cycles of denaturation: 94°C - 94.5°C for 15 s, 35°C - 36.3°C for 15 s, 72°C for 15 s; extension at 72°C for 5 min.

[0011] The present invention also provides a primer set for differentiating Frankliniella occidentalis and Thrips flavus, and the primer set includes the primers shown in SEQ ID NO.1 to SEQ ID NO.4.

[0012] The present invention also provides a kit, which includes the primer set for differentiating Frankliniella occidentalis and Thrips flavus, 2×Taq Master Mix and ddH2O.

[0013] The present invention also provides an application of the primer set or the kit in differentiating Frankliniella occidentalis and Thrips flavus. The differentiation process is as follows: extract the genomic DNA of the sample to be tested, perform double PCR amplification using the primer set or the kit. If only a band with a size of 254bp appears in the amplification product, the sample to be tested is Thrips flavus; if only a band with a size of 362bp appears in the amplification product, the sample to be tested is Frankliniella occidentalis; if two bands with lengths of 254bp and 362bp appear simultaneously in the amplification product, the sample to be tested is a mixed sample of Thrips flavus and Frankliniella occidentalis.

[0014] The present invention also provides a primer pair for differentiating Thrips flavus, including Sd-F primer and Sd-R primer. The sequence of the Sd-F primer is as shown in SEQ ID NO.1, and the Sd-R primer is as shown in SEQ ID NO.2.

[0015] The present invention also provides an application of the primer pair in differentiating Thrips flavus. The primer pair is used to differentiate Thrips flavus from Frankliniella occidentalis, Thrips palmi, Thrips tabaci and Thrips imaginis.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: By using the specific primers Fo-F and Fo-R of Frankliniella occidentalis and the specific primers Sd-F and Sd-R of Thrips flavus as a primer set, the genomic DNA of the sample to be tested is amplified, and the sample to be tested is differentiated and identified as Frankliniella occidentalis or Thrips flavus based on the amplification product. The method provided by the present invention can quickly and accurately differentiate Frankliniella occidentalis and Thrips flavus, with strong specificity, and can be used for the rapid identification of the important pests Frankliniella occidentalis and Thrips flavus in blueberry planting areas in actual production.

[0017] The present invention provides a primer set for differentiating Frankliniella occidentalis and Thrips flavus, and can accurately differentiate Frankliniella occidentalis and Thrips flavus through this primer set. Among them, the Sd-F primer and the Sd-R primer can accurately differentiate Thrips flavus from Frankliniella occidentalis, Thrips palmi, Thrips tabaci and Thrips imaginis. The results show that the primer set shown in SEQ ID NO.1 to SEQ ID NO.4 has high specificity and high detection accuracy. Description of the Drawings

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0019] Figure 1 It is the electrophoresis diagram for detecting the primer specificity of Frankliniella occidentalis in Embodiment 1 of the present invention; In the figure, a is the electrophoresis diagram for detecting the specificity of primers Sd-F and Sd-R; b is the electrophoresis diagram for detecting the specificity of primers Sd-F1 and Sd-R1; c is the electrophoresis diagram for detecting the specificity of primers Sd-F2 and Sd-R2; d is the electrophoresis diagram for detecting the specificity of primers Sd-F3 and Sd-R3; Lane M: D2000 standard DNA Marker; Lane 1 is Frankliniella occidentalis; Lane 2 is Thrips palmi; Lane 3 is Frankliniella intonsa; Lane 4 is Thrips tabaci; Lane 5 is Thrips hawaiiensis.

[0020] Figure 2 It is for detecting the primer specificity of Frankliniella occidentalis and Frankliniella intonsa; in the figure, Lane M: D2000 standard DNA Marker; 1 is for detecting the specificity of primers Fo-F and Fo-R of Frankliniella occidentalis; 2 is for detecting the specificity of primers Sd-F and Sd-R of Frankliniella intonsa; 3 is for detecting the specificity of dual PCR primers of the mixed sample of Frankliniella occidentalis and Frankliniella intonsa.

[0021] Figure 3 It is the identification diagram of different thrips species in Dalian City, Liaoning Province in Embodiment 2 of the present invention; in the figure, M: D2000 standard DNA Marker; Samples 5 and 8 are Frankliniella occidentalis, Sample 11 is the mixed sample of Frankliniella occidentalis and Frankliniella intonsa (positive control), and the rest are Frankliniella intonsa.

[0022] Figure 4Effect of the volume of the introduced object on the results of duplex PCR detection in the present invention; in the figure, lane M: D2000 standard DNA Marker; lane 1: the addition amounts of the specific primers Fo-F and Fo-R for Frankliniella occidentalis are both 0.4 μl, and the addition amounts of the specific primers Sd-F and Sd-R for Scirtothrips dorsalis are both 0.4 μl; lane 2: the addition amounts of the specific primers Fo-F and Fo-R for Frankliniella occidentalis are both 0.4 μl, and the addition amounts of the specific primers Sd-F and Sd-R for Scirtothrips dorsalis are both 0.8 μl; lane 3: the addition amounts of the specific primers Fo-F and Fo-R for Frankliniella occidentalis are both 0.4 μl, and the addition amounts of the specific primers Sd-F and Sd-R for Scirtothrips dorsalis are both 1.6 μl; lane 4: the addition amounts of the specific primers Fo-F and Fo-R for Frankliniella occidentalis are both 0.8 μl, and the addition amounts of the specific primers Sd-F and Sd-R for Scirtothrips dorsalis are both 0.8 μl; lane 5: the addition amounts of the specific primers Fo-F and Fo-R for Frankliniella occidentalis are both 0.8 μl, and the addition amounts of the specific primers Sd-F and Sd-R for Scirtothrips dorsalis are both 0.4 μl; lane 6: the addition amounts of the specific primers Fo-F and Fo-R for Frankliniella occidentalis are both 0.8 μl, and the addition amounts of the specific primers Sd-F and Sd-R for Scirtothrips dorsalis are both 1.6 μl; lane 7: the addition amounts of the specific primers Fo-F and Fo-R for Frankliniella occidentalis are both 1.6 μl, and the addition amounts of the specific primers Sd-F and Sd-R for Scirtothrips dorsalis are both 1.6 μl; lane 8: the addition amounts of the specific primers Fo-F and Fo-R for Frankliniella occidentalis are both 1.6 μl, and the addition amounts of the specific primers Sd-F and Sd-R for Scirtothrips dorsalis are both 0.4 μl; lane 9: the addition amounts of the specific primers Fo-F and Fo-R for Frankliniella occidentalis are both 1.6 μl, and the addition amounts of the specific primers Sd-F and Sd-R for Scirtothrips dorsalis are both 0.8 μl.

[0023] Figure 5 Effect of the annealing temperature on the results of duplex PCR detection; in the figure, lane M: D2000 standard DNA Marker; the annealing temperatures of lanes 1 to 8 are respectively: 50.0 °C, 48.8 °C, 47.0 °C, 44.4 °C, 40.9 °C, 38.3 °C, 36.3 °C and 35 °C; Figure 6 Duplex PCR system DNA sensitivity detection chart; lane M: D2000 standard DNA Marker; 1: 10 ng DNA; 2: 25 ng DNA; 3: 50 ng DNA; 4: 100 ng DNA; 5: 150 ng DNA; 6: 200 ng DNA. Detailed implementation manners

[0024] The following is a detailed description of the specific embodiments of the present invention. It should be understood that the protection scope of the present invention is not limited by the specific embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts belong to the protection scope of the present invention. In the experimental methods described in the embodiments of the present invention, unless otherwise specified, they are all conventional methods. The materials, reagents, etc. used in the following embodiments, unless otherwise specified, can all be obtained from commercial channels.

[0025] Example 1: Design and verification of specific primers for Frankliniella intonsa.

[0026] 1. Primer design Four pairs of primers were designed according to the CO I gene sequence of Frankliniella intonsa, and were respectively denoted as Sd-F / R, Sd-F1 / R1, Sd-F2 / R2 and Sd-F3 / R3. The sequences of the four pairs of primers are shown as follows:

[0027] Sd-F: GTCTTAATAATATAAGATTTT (SEQ ID NO.1).

[0028] Sd-R: AGACGTTTTATCTGAAGATA (SEQ ID NO.2).

[0029] Sd-F1: TAGCATTTCCTCGTCT (SEQ ID NO.7).

[0030] Sd-R1: TAAACTTCTGGGTGTCC (SEQ ID NO.8).

[0031] Sd-F2: GTTGAACTGTTTATCCACCAT (SEQ ID NO.9).

[0032] Sd-R2: CTGAAGTAAAGTAGGCTCGT (SEQ ID NO.10).

[0033] Sd-F3: AAGGTGCTGGTACAGGTTG (SEQ ID NO.11).

[0034] Sd-R3: ATCAGAATATCGTCGTGGT (SEQ ID NO.12).

[0035] 2. Verification of primer specificity Genomic DNAs of Frankliniella occidentalis (Shenyang City), Thrips palmi (Xinmin City), Frankliniella intonsa (Dalian City), Thrips tabaci (Shenyang City) and Thrips flavus (Shenyang City) were extracted respectively, numbered 1, 2, 3, 4 and 5 in sequence for standby.

[0036] Using the above-extracted genomic DNA as a template respectively, perform PCR amplification reactions with four pairs of designed primers; the amplification reaction system for PCR amplification is as follows: 0.8 μL of each of the forward primer and the reverse primer, 2 μL of template DNA, 10 μL of 2×Taq Master Mix, 4.8 μL of ddH2O, for a total of 20 μL. The PCR amplification reaction conditions are: pre-denaturation at 94 °C for 5 min; denaturation for 35 cycles: 94 °C for 15 s, 36.3 °C for 15 s, 72 °C for 15 s; extension at 72 °C for 5 min.

[0037] Perform agarose gel electrophoresis analysis on the amplification products obtained by PCR amplification.

[0038] The results are as Figure 1 shown. Only Sd-F and Sd-R as primers can specifically amplify a band with a size of 254 bp shown in SEQ ID NO.5 of Frankliniella intonsa, and no corresponding band can be amplified in the genomic DNA of the other four thrips species. Although the other three pairs of primers can amplify bands of Frankliniella intonsa, they can also amplify bands of other thrips species, making it difficult to distinguish Frankliniella intonsa from the other four thrips species.

[0039] It can be seen that Sd-F and Sd-R are highly specific for Frankliniella intonsa.

[0040] Example 2: A method for identifying Frankliniella occidentalis and Frankliniella intonsa.

[0041] I. This example provides a method for identifying Frankliniella occidentalis and Frankliniella intonsa, which specifically includes the following steps: 1. Extract the genomic DNA of the test sample for later use.

[0042] 2. Using the genomic DNA of the test sample extracted as a template, perform duplex PCR amplification with the Frankliniella intonsa species-specific primer pair Sd-F and Sd-R determined in Example 1 and the Frankliniella occidentalis species-specific primer pair Fo-F and Fo-R.

[0043] The primer sequences are as follows: Sd-F: GTCTTAATAATATAAGATTTT (SEQ ID NO.1).

[0044] Sd-R: AGACGTTTTATCTGAAGATA (SEQ ID NO.2).

[0045] Fo-F: CGACTTAATAACATAAGATTTT (SEQ ID NO.3).

[0046] Fo-R: GATGTATTTAAGTTTCGGTCT (SEQ ID NO.4).

[0047] The amplification reaction system for duplex PCR amplification is 20 μL and includes: 0.8 μL each of primers Sd-F, Sd-R, Fo-F, and Fo-R, 2 μL of template DNA, 10 μL of 2×Taq Master Mix, and the balance is ddH2O. The duplex PCR amplification reaction conditions are: pre-denaturation at 94 °C for 5 min; 35 cycles of denaturation: 94 °C for 15 s, 36.3 °C for 15 s, 72 °C for 15 s; extension at 72 °C for 5 min.

[0048] 3. The amplification products obtained by duplex PCR amplification are analyzed by agarose gel electrophoresis, and the sample types are identified according to the sizes of the amplification product bands.

[0049] The identification criteria are as follows: (1) If only the band with a size of 254 bp shown in SEQ ID NO.5 appears in the amplification product, the sample to be tested is Frankliniella intonsa; (2) If only the band with a size of 362 bp shown in SEQ ID NO.6 appears in the amplification product, the sample to be tested is Frankliniella occidentalis; (3) If two bands with lengths of 254 bp and 362 bp appear simultaneously in the amplification product, the sample to be tested is a mixed sample of Frankliniella intonsa and Frankliniella occidentalis.

[0050] SEQ ID NO.5: GTCTTAATAATATAAGATTTTGACTTTTACCACCTTCAATTATTTTATTAATTATAGGATTATCAAAAGAAGGTGCTGGTACAGGTTGAACTGTTTATCCACCATTATCTACATTTTATCATTCTGGAATTTCAGTAGATTTAACAATTTTTTCTCTTCACCTTGCAGGAATTTCTTCAATTTTAGGAGCTCTTAATTTTATTACTACAATTATTAATCTAAAAACAAAAAATTTATCTTCAGATAAAACGTCT.

[0051] SEQ ID NO.6: CGACTTAATAACATAAGATTTTGACTTCTTCCACCCTCTTTAACATTGTTAATTATAGGTTCATCAAAAGATGGTGCAGGAACAGGATGAACAGTTTACCCACCTTTGTCAACTTTTTATCACTCTGGACCATCAGTAGATTTAACTATTTTTTCCCTTCATTTAGCAGGTATTTCTTCAATTCTAGGAGCCTTAAATTTTATTACAACGATTTTAAATTTAAAGATCAAAAAATTAACAACGGAAAAGATAACTTTATTTGTTTGATCAGTTATTTTAACAGCTATTTTATTATTATTGTCGTTACCAGTTTTAGCAGGAGCTATTACAATATTATTAACAGACCGAAACTTAAATACATC。

[0052] II. Primer Specificity Detection of Frankliniella occidentalis and Scirtothrips dorsalis The results are as Figure 2 shown. The primers Fo-F and Fo-R are highly specific for Frankliniella occidentalis, and the primers Sd-F and Sd-R are highly specific for Scirtothrips dorsalis. When PCR is performed with these two pairs of primers simultaneously, their respective bands can be amplified without affecting each other.

[0053] III. Verification of the Method for Identifying Frankliniella occidentalis and Scirtothrips dorsalis 1. Preparation of Samples to be Tested Prepare 10 samples to be tested collected from the blueberry planting area in Dalian, Liaoning Province, numbered 1-10 respectively. Sample 11 is the mixed DNA of Scirtothrips dorsalis and Frankliniella occidentalis in the laboratory, used as a positive control.

[0054] Perform PCR amplification on the above 11 samples using the traditional PCR method. The amplification primers are the universal primers LCO1490 (primer sequence shown in SEQ ID NO.13) and HCO2198 (primer sequence shown in SEQ ID NO.14). The size of all amplification products is approximately 710bp.

[0055] SEQ ID NO.13: GGTCAACAAATCATAAAGATATTGG.

[0056] SEQ ID NO.14: TAAACTTCAGGGTGACCAAAAAATCA.

[0057] The PCR reaction system was 25 μL, including 2 μL of DNA template, 0.5 μL each of the upstream primer and the downstream primer, 2.5 μL of 10× Buffer, 0.5 μL of dNTPs (2.5 mmol·L -1 ), 0.2 μL of Taq DNA polymerase (5 U·μL -1 ), and ddH20 was added to make up to 25 μL. Amplification conditions: pre-denaturation at 94°C for 5 min; 94°C for 30 s, 51°C for 30 s, 72°C for 1 min, for 35 cycles; extension at 72°C for 5 min.

[0058] After sequencing, sequence alignment was performed through NCBI. The alignment results showed that samples 5 and 8 were Frankliniella occidentalis, and the rest were Scirtothrips dorsalis.

[0059] 2. Verification of the duplex PCR amplification method Using the above 11 samples as the test samples, amplification was performed respectively according to the duplex PCR amplification method of the present invention.

[0060] The results were as Figure 3 shown. After amplification of samples 1-4, samples 6-7, and samples 9-10, a band with a size of 254 bp shown in SEQ ID NO.5 appeared, and they were identified as Scirtothrips dorsalis; after amplification of samples 5 and 8, a band with a size of 362 bp shown in SEQ ID NO.6 appeared, and they were identified as Frankliniella occidentalis. Therefore, the duplex PCR amplification method in the present invention can accurately identify and distinguish Scirtothrips dorsalis and Frankliniella occidentalis.

[0061] IV. Influence of primer volume on the duplex PCR detection result Set the primer volume in the duplex PCR system according to the records in Table 1, and the other components were the same as the amplification reaction system of the aforementioned duplex PCR amplification to study the influence of the primer volume in the duplex PCR system on the detection result.

[0062] Table 1 Primer volumes in the duplex PCR reaction system (unit: μL) Prepare a 20 μL duplex PCR amplification reaction system according to the primer volumes in Table 1, using the DNA of a mixed sample of Scirtothrips dorsalis and Frankliniella occidentalis as the template, and perform amplification according to the above-described duplex PCR amplification reaction conditions.

[0063] The results were as Figure 4As shown, when the addition amounts of the specific primers Fo-F and Fo-R for Frankliniella occidentalis are both 0.8 μl, and the addition amounts of the specific primers Sd-F and Sd-R for Scirtothrips dorsalis are both 0.8 μl; when the addition amounts of the specific primers Fo-F and Fo-R for Frankliniella occidentalis are both 0.8 μl, and the addition amounts of the specific primers Sd-F and Sd-R for Scirtothrips dorsalis are both 0.4 μl, the two amplified bands are relatively bright (lanes 4 and 5), indicating that the amplification efficiency of the duplex PCR is high. Only one bright band can be seen in lanes 2, 3 and 9, and although two bands are shown in the remaining lanes, one band is bright and the other is dim, or both are relatively dim. It can be seen that the primer volume has a great influence on the amplification efficiency of the duplex PCR, and thus has a significant impact on the detection result. Therefore, in the 20 μL amplification reaction system of the duplex PCR of the present invention, when the volumes of the primers Sd-F and Sd-R are both 0.4 μL - 1.6 μL, and the volumes of the primers Fo-F and Fo-R are both 0.8 μL - 1.6 μL, the amplification efficiency is better and meets the detection requirements.

[0064] V. Influence of the annealing temperature of the primers in the duplex PCR conditions on the detection result To study the influence of the annealing temperature on the detection result, the annealing temperatures were set at 50.0 °C, 48.8 °C, 47.0 °C, 44.4 °C, 40.9 °C, 38.3 °C, 36.3 °C and 35 °C respectively. With other conditions unchanged, duplex PCR amplification was carried out using the DNA of the mixed sample of Scirtothrips dorsalis and Frankliniella occidentalis as the template.

[0065] The amplification reaction system for the duplex PCR amplification is 20 μL, including: 0.8 μL each of the primers Sd-F, Sd-R, Fo-F and Fo-R, 2 μL of template DNA, 10 μL of 2×Taq Master Mix, and the balance is ddH2O.

[0066] The results are as Figure 5 shown, when the annealing temperature is 36.3 °C and 35 °C, the amplification efficiency is better and the results can be detected.

[0067] VI. Detection results of the sensitivity of the template DNA in the duplex PCR system The template DNA concentrations in the amplification reaction system for the duplex PCR amplification were set as follows: 1: 10 ng DNA; 2: 25 ng DNA; 3: 50 ng DNA; 4: 100 ng DNA; 5: 150 ng DNA; 6: 200 ng DNA.

[0068] The results are as Figure 6 shown, when the template DNA concentration is greater than 50 ng DNA, the detection effect is better for both thrips.

[0069] The rapid and accurate identification of the two thrips species in the present invention can clarify the dominant species of thrips in the blueberry planting area, guide the scientific use of pesticides and the rational selection of physical sticky boards in this area, ultimately improve the control effect on thrips, and ensure the yield and quality of the blueberry production area. Through the investigation of thrips species in the blueberry planting area of Dalian City, Liaoning Province, it is clarified by this technical method that Scirtothrips dorsalis is the dominant species in this area. Chemical agents with low drug resistance to Scirtothrips dorsalis can be selected for control, and it is recommended that the ratio of hanging yellow boards to blue boards be set at 3:1.

[0070] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these embodiments once they know the basic creative concept.

[0071] Obviously, those skilled in the art can make various changes and deformations to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and deformations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention also intends to include these modifications and deformations.

Claims

1. A method for distinguishing western flower thrips and tea yellow thrips, characterized in that: The steps include: Extracting genomic DNA from the sample to be tested, and performing dual PCR amplification using a primer combination; the primer combination includes Sd-F shown in SEQ ID NO.1, Sd-R shown in SEQ ID NO.2, Fo-F shown in SEQ ID NO.3, and Fo-R shown in SEQ ID NO.4; If the amplified product only shows a band of 254 bp, the sample to be tested is the tea yellow thrips; if the amplified product only shows a band of 362 bp, the sample to be tested is the western flower thrips; if the amplified product shows two bands of 254 bp and 362 bp at the same time, the sample to be tested is a mixed sample of the tea yellow thrips and the western flower thrips.

2. The method for distinguishing western flower thrips and thuja thrips according to claim 1, characterized in that: The double PCR amplification system includes primer Sd-F 0.4 μL to 1.6 μL, primer Sd-R 0.4 μL to 1.6 μL, primer Fo-F 0.8 μL to 1.6 μL and primer Fo-R 0.8 μL to 1.6 μL.

3. The method for distinguishing western flower thrips and tea yellow thrips according to claim 2, characterized in that: The double PCR amplification system is 20 μL: 0.4 μL to 1.6 μL of primers Sd-F and Sd-R, 0.8 μL to 1.6 μL of primers Fo-F and Fo-R, 1.6 μL to 2 μL of template DNA, 10 μL to 10.5 μL of 2×Taq Master Mix, and the balance is ddH2O.

4. The method for distinguishing western flower thrips and tea yellow thrips according to claim 3, characterized in that: The double PCR amplification system was 20 μL: 0.8 μL each of primers Sd-F, Sd-R, Fo-F and Fo-R, 2 μL of template DNA, 10 μL of 2× Taq Master Mix, and the balance was ddH2O.

5. The method for distinguishing western flower thrips and tea yellow thrips according to claim 1, characterized in that: The reaction conditions for the double PCR amplification were as follows: pre-denaturation at 94°C-94.5°C for 5 min; 35 cycles of denaturation at 94°C-94.5°C for 15 s, 35°C-36.3°C for 15 s, and 72°C for 15 s; and extension at 72°C for 5 min.

6. A primer set for identifying western flower thrips and tea yellow thrips, characterized in that: The primer set includes the primers shown in SEQ ID NO.1 to SEQ ID NO.4 in claim 1.

7. A kit, characterized in that: The kit comprises the primer set for identifying western flower thrips and truncatula occidentalis according to claim 6, 2×Taq Master Mix and ddH2O.

8. Use of the primer set for distinguishing western flower thrips and tea yellow thrips according to claim 6 or the kit according to claim 7 in distinguishing western flower thrips and tea yellow thrips, characterized in that: The genomic DNA of the sample to be tested is extracted, and the primer set or the kit is used to perform dual PCR amplification. If only a band with a size of 254 bp appears in the amplified product, the sample to be tested is F. thrips var. leucoderma; if only a band with a size of 362 bp appears in the amplified product, the sample to be tested is F. occidentalis; if two bands with lengths of 254 bp and 362 bp appear in the amplified product at the same time, the sample to be tested is a mixed sample of F. thrips var. leucoderma and F. occidentalis.

9. A primer pair for identifying Thrips oleraceus, characterized in that: It comprises the Sd-F primer and the Sd-R primer in claim 1, wherein the sequence of the Sd-F primer is shown as SEQ ID NO.1, and the sequence of the Sd-R primer is shown as SEQ ID NO.

2.

10. Use of the primer pair according to claim 9 in identifying Thrips oleraceus, characterized in that: The primer pair was used to distinguish the thrips from western flower thrips, palm thrips, thrips tabaci, and flower thrips.

Images