Cell-free protein synthesis system for screening protein and polypeptide

Abstract

The invention discloses a cell-free protein synthesis system for protein and polypeptide screening, and belongs to the technical field of biology. According to the escherichia coli engineering bacterium for the cell-free protein synthesis system, ssrA, arfB and smrB genes of the escherichia coli engineering bacterium are knocked out through gene editing, and proteins coded by the escherichia coli engineering bacterium are removed from the gene level; protease degradation tags are added to the C ends of prfA, prfB, prfC, pth, frr and arfA genes, and proteins coded by the proteins are removed from the protein level. The cell-free protein expression system prepared by using the engineered escherichia coli can completely remove proteins which influence the stability of the ternary complex and are unfavorable for ribosome display, can significantly improve the stability of the ternary complex, can perform protein synthesis under the condition of 30 DEG C, and can be used for screening proteins and polypeptides.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to an Escherichia coli engineering bacterium for a cell-free protein synthesis system and its applications in ribosome display, protein and polypeptide screening. Background Art

[0002] In nature, in order to adapt to the constantly changing living environment, living organisms can evolve through genetic selection, but the natural evolution of living organisms is an extremely slow process, which can hardly meet the human desire for biomaterials with new structures or new functions. To accelerate the evolution of biomolecules, scientists imitate natural evolution and conduct directed design, characterization and screening of biofunctional molecules, and expected biofunctional molecules can be obtained in a relatively short time. Among them, the directed evolution of proteins and polypeptides is the most valuable research field. Its main process: First, construct a diverse protein library by mutating or recombining the encoding gene, and then select a suitable method for in vivo or in vitro screening, and repeat this process to obtain proteins with target characteristics.

[0003] Ribosome display technology is one of the ideal technologies for screening functional proteins and polypeptides from large libraries. It is a high-throughput screening technology that utilizes protein-protein interactions and relies on the simultaneous binding of the translated protein and its mRNA to ribosomes to form an mRNA-ribosome-protein ternary complex, linking the genotype and phenotype of the target protein. This technology uses ribosomes as a link to tie messenger RNA (mRNA) and nascent polypeptides together in a cell-free protein synthesis system to form a ternary complex, thus realizing the connection between phenotype and genotype. Then, through specific screening of nascent peptides, the sequence information of the target polypeptide can be obtained.

[0004] The general process of in vitro ribosome display technology includes: 1. Synthesis of a DNA / RNA mutant library; 2. Translation of the DNA / RNA mutant library into a protein library in vitro through a cell-free protein synthesis system (CFPS); 3. Affinity screening; 4. Reverse transcription and PCR amplification; 5. Sequencing to obtain the genotype of the protein, or returning the DNA sequence to the second step for further screening and enrichment. Bacterial extracts are a relatively perfect cell-free protein synthesis system.

[0005] In the stage of translating DNA / RNA mutation libraries into protein libraries in vitro, the key factor affecting the efficiency of ribosome display technology is the stability of the nascent peptide-ribosome-mRNA ternary complex. Low stability makes it impossible to closely link the genotype and phenotype of the protein. At present, in order to maintain the stability of the ternary complex, experiments are carried out under low temperature conditions, but the interaction between proteins is affected by temperature, and the existing technology is not suitable for exploring the interaction between proteins at room temperature. The factor affecting the stability of the ternary complex is that the translation termination in the translation system has the effect of releasing the nascent peptide and dissociating the ribosome. In addition, some nucleases are also contained in the bacterial cell extract, which will affect the stability of mRNA. And the genes encoding these factors in the bacterial genome are essential genes, and there is no way to remove them in the genome. These factors inevitably reduce the stability of the ternary complex, which hinders the acquisition of reliable results. Summary of the invention

[0006] The efficiency of ribosome display technology in screening target proteins depends on the stability of the newly formed short peptide-ribosome-mRNA ternary complex, and the stability of the ternary complex is affected by the termination factor. The current ribosome display technology platform using cell extract as the protein synthesis system cannot avoid this problem, resulting in low efficiency of ribosome display technology, harsh operating environment, and the need to be carried out under low temperature conditions throughout the process to prevent the dissociation of the ternary complex. The purpose of the present invention is to solve these problems existing in the prior art and provide an Escherichia coli engineered bacterium for a cell-free protein synthesis system and its application in ribosome display, protein and polypeptide screening.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] An engineered Escherichia coli bacterium is an Escherichia coli in which the ssrA gene is knocked out and a protease degradation tag is inserted into the C-terminus of the prfA, prfB, prfC, and frr genes; or an Escherichia coli in which the ssrA, arfB, and smrB genes are knocked out and a protease degradation tag is added to the C-terminus of the prfA, prfB, prfC, pth, frr, and arfA genes. The protease degradation tag is not degraded by the protease of the Escherichia coli itself.

[0009] Preferably, the protease degradation tags include pdt3 tag, H1 tag, H2 tag, etc. The amino acid sequence of pdt3 tag is AANKNEENTNEVPTFMLNAGQANRRRV (SEQ ID NO.1), the amino acid sequence of H1 tag is ENTNEVPTFMLNAGQRRRV (SEQ ID NO.2), and the amino acid sequence of H2 tag is ENTNEVPTFMLNARRRV (SEQ ID NO.3). The protein expressed after inserting pdt3 tag, H1 tag or H2 tag at the C-terminus of the gene will be degraded by mycoplasma mf-Lon protease.

[0010] The method for preparing the cell extract of the above-mentioned Escherichia coli engineered bacterium includes the following steps: transforming the plasmid expressing protease into the above-mentioned Escherichia coli engineered bacterium, culturing, inducing expression, collecting the bacterial cells, breaking them, and centrifuging to obtain the cell extract. The protease can degrade the protein expressed by the gene with a protease degradation tag inserted at the C-terminus in the above-mentioned Escherichia coli engineered bacterium. When the protease degradation tag is pdt3 tag, H1 tag or H2 tag, the protease is mycoplasma mf-Lon protease.

[0011] A cell extract of the above-mentioned Escherichia coli engineered bacterium, which is obtained by including the above-mentioned preparation method.

[0012] The application of the above-mentioned Escherichia coli engineered bacterium or the above-mentioned cell extract in the preparation of a cell-free protein synthesis system or a ribosome display platform.

[0013] A cell-free protein synthesis system, which contains the above-mentioned cell extract.

[0014] A ribosome display platform, which contains the above-mentioned cell extract.

[0015] The application of the above-mentioned cell-free protein synthesis system or ribosome display platform in screening proteins or polypeptides.

[0016] Advantages and beneficial effects of the present invention: In the Escherichia coli engineered bacterium constructed by the present invention, the ssrA, arfB, and smrB genes are knocked out by gene editing to remove the proteins encoded by them at the gene level; protease degradation tags are added to the C-terminus of the prfA, prfB, prfC, pth, frr, and arfA genes to remove the proteins encoded by them at the protein level. The cell-free protein expression system prepared using the Escherichia coli engineered bacterium of the present invention completely removes the proteins that affect the stability of the ternary complex and are unfavorable for ribosome display, and it can significantly improve the stability of the ternary complex and can perform protein synthesis under the condition of 30°C. Description of the Drawings

[0017] Figure 1It is a schematic structural diagram of a homologous DNA fragment for gene editing in an embodiment of the present invention.

[0018] Figure 2 It is a schematic synthesis diagram of a homologous DNA fragment in an embodiment of the present invention.

[0019] Figure 3 It is a flowchart of an experiment for analyzing the stability of a ternary complex in an embodiment of the present invention.

[0020] Figure 4 It is a schematic structural diagram of a DNA template used in an experiment for analyzing the stability of a ternary complex in an embodiment of the present invention.

[0021] Figure 5 It is a result graph of the ribosome stalling efficiency of different Escherichia coli strains in an embodiment of the present invention. Detailed implementation manners

[0022] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0023] Example 1 Construction of an Escherichia coli engineering strain for cell-free protein synthesis

[0024] Using Escherichia coli BL21(DE3)star wild type (WT) as the initial strain. Gene editing was carried out using the λ-Red homologous recombination system to knockout the ssrA gene, and at the same time, the protease degradation tag pdt3 (AANKNEENTNEVPTFMLNAGQANRRRV) was inserted at the C-terminus of the prfA, prfB, prfC, and frr genes to obtain Escherichia coli S-ABCF. Gene editing was carried out using the λ-Red homologous recombination system to knockout the ssrA (Gene ID: 945053), arfB (Gene ID: 946046), and smrB (Gene ID: 944847) genes, and at the same time, the protease degradation tag pdt3 was added to the C-terminus of the prfA (Gene ID: 949002), prfB (Gene ID: 947369), prfC (Gene ID: 948897), pth (Gene ID: 945765), frr (Gene ID: 946122), and arfA (Gene ID: 1450289) genes to obtain Escherichia coli SfBrB-ABCPFfA. To quantify the stability of the ternary complex, flag tags were inserted at the C-terminus of the genes encoding the ribosomal large subunit protein rplQ and the small subunit protein rpsB.

[0025] The homologous recombination plasmid used for gene editing with the λ-Red homologous recombination system is pTKRED (AddGene #41062). The experimental procedure mainly includes three steps: preparation of homologous DNA fragments, screening of resistant strains, and removal of resistance genes.

[0026] (1) Preparation of homologous DNA fragments

[0027] Design a homologous DNA fragment according to the insertion site and the inserted gene. Its structure is as Figure 1 shown, including homologous arms upstream and downstream of the insertion site, the sequence to be inserted, DR sequence, restriction site sequence, and resistance gene.

[0028] This homologous DNA fragment is obtained by three rounds of PCR. The enzyme used in the PCR reaction is PrimeSTAR Max Premix (2X) from Takara. Its synthesis schematic diagram is as Figure 2 shown.

[0029] The first round of PCR consists of 3 reactions. Using the E. coli genome as a template, the upstream homologous fragment is amplified with UF and UR as primers; using the E. coli genome as a template, the downstream homologous fragment is amplified with LF and LR as primers; using the ampicillin gene plasmid as a template, the resistance screening fragment is amplified with AF and AR as primers. After gel extraction and recovery, it is used for the second round of PCR reaction.

[0030] The second round of PCR consists of 1 reaction. Using the resistance screening fragment and the downstream homologous fragment as templates, AF and LR are used as primers to link the two fragments by Overlap PCR. After gel extraction and recovery, it is used for the third round of PCR reaction

[0031] The third round of PCR consists of 1 reaction. Using the upstream homologous fragment and the product of the second round of PCR as templates, UF and LR are used as primers to link the two fragments by Overlap PCR. After gel extraction and recovery, the construction of the homologous DNA fragment is completed.

[0032] Taking the addition of the pdt3 tag to the C-terminus of the prfA gene as an example, the process of obtaining the homologous DNA fragment is described.

[0033] Table 1 Primer names and sequences

[0034]

[0035] First-round PCR: Using the genome of Escherichia coli BL21 Star(DE3) as a template, fragment 1 was amplified by PCR with prfA-UF and prfa-UR as primers; using the plasmid containing the amp gene as a template, fragment 2 was amplified by PCR with prfa-AF and prfA-AR as primers; using the genome of Escherichia coli BL21 Star(DE3) as a template, fragment 3 was amplified by PCR with prfA-LF and prfA-LR as primers.

[0036] Among them, the nucleotide sequence of the amp gene is: ATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCC TTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAA。

[0037] Second-round PCR: Using Fragment 1 and Fragment 2 as templates, and prfA-UF and prfA-AR as primers, Fragment 4 was amplified by PCR.

[0038] Second-round PCR: Using Fragment 3 and Fragment 4 as templates, and prfA-UF and prfA-LR as primers, Fragment 5 was amplified by PCR to obtain the homologous DNA fragment.

[0039] (2) Screening of resistant strains:

[0040] The homologous DNA fragment was introduced into BL21 Star(DE3) containing the pTKRED plasmid by electroporation. After screening by Amp resistance, positive strains were subjected to first-generation sequencing, and finally, successfully edited strains were screened out. The specific steps are as follows:

[0041] 1) Electroporate the homologous DNA fragment into BL21 Star(DE3) containing the pTKRED plasmid, add SOB medium, and incubate at 30 °C for 1 h.

[0042] 2) After electroporation incubation, spread the bacteria on an LB solid medium plate containing 2 mM IPTG, 100 μg / mL Spe, and 100 μg / mL Amp, and place it in a 30 °C incubator until single colonies grow.

[0043] 3) Pick 4-8 single colonies from the plate and inoculate them into 5 mL of LB liquid medium with an Amp concentration of 100 μg / mL, and culture at 30 °C and 220 rpm for 12 h.

[0044] 4) Using the bacterial solution as the PCR template, perform PCR with primers F3 and LR that are 100 bp away from the upstream homologous arm.

[0045] 5) Use agarose gel electrophoresis to determine whether the molecular weight of the PCR product is correct. If correct, it is identified as a positive strain.

[0046] (3) Removal of resistance gene

[0047] After the DNA fragment was successfully homologous recombined into the genome, in addition to the target gene being inserted, the Amp resistance used for strain screening was also inserted, and the resistance gene needs to be removed. The specific steps are as follows:

[0048] 1) Strain inoculation: Inoculate the positive strain into a liquid LB medium containing 2 mM IPTG, 0.2% arabinose, and 100 μg / mL Spe, and culture it on a shaker at 30 °C for 12 h to preliminarily induce the expression of SceI endonuclease. Subsequently, streak inoculate it on a solid LB medium with the same composition and place it in a 30 °C incubator until clear single colonies are formed.

[0049] 2) Single colony screening: Pick single colonies from the solid medium and inoculate them into LB liquid media with and without 100 μg / mL Amp respectively, and then culture them again in a shaker at 30 °C for 12 h. By observing and comparing the culture results of the two groups, especially the growth in the Amp-resistant medium, preliminarily evaluate whether the Amp resistance marker has been successfully removed.

[0050] 3) Bacterial liquid PCR verification: Use the bacterial liquid without Amp addition as the template, and perform bacterial liquid PCR amplification with two pairs of specific primers, F3 / A1 (primers on the Amp gene) and F3 / LR. Among them, the F3 / A1 primer is used to detect whether the Amp gene has been completely removed, while F3 / LR is used to confirm whether the editing operation is successful by first-generation sequencing. Analyze the PCR products by electrophoresis. If there is no F3 / A1 product and the size of the F3 / LR product meets the expectation, it is preliminarily regarded as a successfully edited strain.

[0051] 4) Sequencing confirmation and strain preservation: Purify the PCR products of F3 / LR and send them for first-generation sequencing to finally confirm the success of genome editing. Finally, freeze the verified edited strains in an -80 °C refrigerator for subsequent experimental use.

[0052] The editing of other genes is the same as the above process, only the primers used are different. The primers used for other gene editing are shown in Table 2 below.

[0053] Table 2 Primer names and sequences

[0054]

[0055]

[0056]

[0057]

[0058]

[0059] Example 2 Preparation of Escherichia coli cell extract

[0060] (1) Prepare the engineered Escherichia coli strain constructed in Example 1 into electrocompetent cells. Then, electrotransform the pZA16mflon plasmid (AddGene #75439, which is used to express mf-Lon protease) into each strain, spread the cells on a plate (Amp-LB plate), and culture overnight at 37°C. Pick single colonies from the plate, inoculate them into 22 mL of LB liquid medium, and culture overnight on a shaker at 37°C for 10 hours. Set aside a portion of the bacteria for cryopreservation. Pipette 10 mL of the overnight culture into 1 L of S30 medium containing 1 mM arabinose and add 1 mL of 100 mg / mL sodium ampicillin. Culture on a shaker at 37°C for about 11 hours, and harvest the bacteria when OD600 reaches about 1.7.

[0061] The S30 medium is prepared as follows: ① Prepare 2×YT: Weigh 16 g of peptone, 10 g of yeast extract, and 5 g of NaCl and add them to a 2 L Erlenmeyer flask. Add 900 mL of triple-filtered water, seal it with a breathable membrane, autoclave at 121°C for 20 minutes, and cool to room temperature. ② Prepare phosphate buffer: Weigh 2.9 g of KH2PO4 and 9.13 g of K2HPO4, add them to a 100 mL blue-capped reagent bottle, add 100 mL of triple-filtered water, autoclave at 121°C for 20 minutes, and cool to room temperature. ③ Prepare S30 medium: Mix the prepared 2×YT and phosphate buffer, and add 500 μL of 1 M IPTG. Shake well.

[0062] (2) Harvest the bacteria: After the culture is completed, immediately place the bacterial solution in an ice bath and let it stand for 30 minutes. Weigh an empty 50 mL centrifuge tube and label it. Centrifuge to harvest the bacteria (4200 rpm, 4°C, 30 minutes). Add 30 mL of S30 buffer (60 mM potassium glutamate, 14 mM magnesium acetate solution, 10 mM Tris-Acetate (pH 8.2), 2 mM DTT) to resuspend and wash the bacteria. Transfer them to a 50 mL centrifuge tube and then centrifuge to harvest the bacteria (5000 g, 4°C, 15 minutes). Repeat this step once. Discard the supernatant, weigh the centrifuge tube, and calculate the weight of the wet bacteria (total weight - net centrifuge tube weight). Freeze the bacteria at -80°C for storage.

[0063] (3) Preparation of S30 cell extract: Take out the preserved bacterial cells from -80 °C, place them in an ice bath for thawing. After thawing, add S30 buffer according to the ratio of 1.1 g of wet bacterial cells to 1 mL of S30 buffer to completely resuspend the bacterial cells. Pre-cool the high-pressure homogenizer, adjust the pressure to 1655 bar, disrupt the bacterial cells once, centrifuge to collect the supernatant (30000 g, 4 °C, 30 min), and repeat the above steps once. Transfer the supernatant to a 15 mL centrifuge tube, wrap it with tin foil, and incubate it at 37 °C, 220 rpm / min for 1 h. Centrifuge to collect the supernatant (30000 g, 4 °C, 30 min) to obtain the S30 cell extract. After aliquoting, quickly freeze it in liquid nitrogen and store it at -80 °C.

[0064] Example 3 Stability Analysis of the Ternary Complex

[0065] According to Figure 3 the experimental procedure shown below, perform the stability analysis of the ternary complex. The first step is to construct a DNA template. The 5' end of the DNA template has a strep tag II sequence (WSHPQFEK) for binding to streptavidin magnetic beads (SA), and the 3' end has a SecM sequence (FSTPVWISQAQGIRAGP) for stalling ribosomes. The second step is to synthesize proteins in vitro. The third step is to screen the synthesized proteins using SA. The more stable the structure of the nascent polypeptide-ribosome-mRNA ternary complex, the higher the ratio of the small subunit protein to the large subunit protein of the ribosome. The fourth step is to quantify the ribosomal proteins using the Western Blot (WB) method.

[0066] 1. Construction of DNA template: The structural schematic diagram of the DNA template is as shown in Figure 4 the following, and its nucleotide sequence is as follows.

[0067]

[0068] 2. In vitro protein translation: Mix 4×Buffer Mix, DNA template, and S30 cell extract according to Table 3 below. Add 3 μg of DNA template to each 100 μL reaction system and react at 30 °C for 2 h.

[0069] Table 3: CFPS reaction system for ternary complex stability analysis

[0070]

[0071] Among them, 4×Buffer Mix is prepared from 20×AA, 20×PEP, 25×Nucleotide Mix, and 10×Salt Mix. For details, see the Chinese patent "Application of the System in Improving the Insertion Efficiency of Unnatural Amino Acids" with the publication number CN113322267A.

[0072] 3. Terminate the reaction: Take out 200 μL of the reaction system and place it on ice, then add it to 800 μL of ice-cold Binding buffer (50 mM Tris-acetate pH 7.5, 150 mM NaCl, 50 mM MgAc, 0.1% (v / v) Tween-20). Place it on ice for 2 min and centrifuge at 4 °C and 14000×g for 5 min.

[0073] 4. In vitro screening: Take 400 μL of streptavidin magnetic beads, wash them twice with 800 μL of Binding buffer to prepare a 0.33× solution; take out 930 μL of the supernatant from the previous centrifugation and add it to a 1.5 mL centrifuge tube containing 400 μL of 0.33× magnetic beads. After mixing evenly, react with shaking at 30 °C for 30 min. Take out the supernatant and wash the magnetic beads once with 1 mL of WB (50 mM Tris-acetate pH 7.5, 300 mM NaCl, 50 mM MgAc, 0.1% (v / v) Tween-20), and wash with rotation at 4 °C for 5 min.

[0074] 5. Elution: Add 100 μL of EBB (50 mM Tris-acetate, pH = 7.5, 150 mM NaCl, 1 mM biotin) to the magnetic beads washed in the previous step and react in the dark at 30 °C for 30 min. Take out 60 μL of the supernatant and mix it with 20 μL of 4× protein loading buffer, then heat at 98 °C for 10 min to prepare a WB sample.

[0075] 6. Western Blot (WB): Load 30 μL of SDS-PAGE gel electrophoresis sample. After SDS-PAGE gel electrophoresis, transfer it to a PVDF membrane using wet transfer (100 V - 120 min). Add 4 mL of 5% BSA to block for 2 h. Wash 4 times with TBST, 10 min each time. Add the diluted primary antibody (rabbit anti-Flag tag monoclonal antibody) and incubate for 2 h. Wash 4 times with TBST, 10 min each time. Then add the diluted secondary antibody (HRP-labeled goat anti-rabbit polyclonal antibody) and incubate for 2 h. Wash 4 times with TBST, 10 min each time. Take out the membrane, add 0.8 mL of ECL plus luminescent solution, incubate for 1 min, and develop the image.

[0076] Quantify the large and small subunit proteins of ribosomes captured after ribosome display of 3 strains by WB. The better the stability of the ternary complex, the greater the amount of ribosomal proteins captured, and the greater the ratio of small subunit proteins to large subunit proteins. The experimental results are as Figure 5 shown in Table 4. The wild type of BL21(DE3)star cannot capture ribosomal proteins, indicating that a stable ternary complex cannot be formed or only a small amount is formed. Both strain S-ABCF and strain SfBrB-ABCPFfA can capture ribosomal proteins, indicating that the two strains can significantly improve the stability of the ternary complex. Moreover, the amount of ribosomal proteins captured by SfBrB-ABCPFfA is higher than that of S-ABCF, and the ratio of 30S / 50S is also higher.

[0077] Table 4: Ribosomal protein capture efficiency of 3 strains

[0078]

[0079] The above results indicate that the Escherichia coli engineering strain constructed in the present invention is more suitable for ribosome display technology than the wild type and can significantly improve the stability of the ternary complex.

[0080] The above embodiments are only used to help illustrate the present invention. The implementation manners of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. An engineered Escherichia coli, characterized in that: The engineered Escherichia coli is an Escherichia coli in which the ssrA gene is knocked out and a protease degradation tag is inserted into the C-terminus of the prfA, prfB, prfC, and frr genes; Or the engineered Escherichia coli is an Escherichia coli in which the ssrA, arfB, and smrB genes are knocked out and a protease degradation tag is added to the C-terminus of the prfA, prfB, prfC, pth, frr, and arfA genes.

2. The engineered Escherichia coli according to claim 1, characterized in that: The protease degradation tags include pdt3 tags, H1 tags, and H2 tags; The amino acid sequence of the pdt3 tag is AANKNEENTNEVPTFMLNAGQANRRRV; The amino acid sequence of the H1 tag is ENTNEVPTFMLNAGQRRRV; The amino acid sequence of the H2 tag is ENTNEVPTFMLNARRRV.

3. The method for preparing a cell extract of an engineered Escherichia coli according to claim 1 or 2, characterized in that: The method comprises the following steps: transforming the protease-expressing plasmid into the Escherichia coli engineering bacteria according to claim 1 or 2, culturing and inducing expression, collecting the bacteria, crushing them, and centrifuging them to obtain a cell extract; The protease can degrade the protein expressed by the gene with the protease degradation tag inserted into the C-terminus in the Escherichia coli engineering bacteria.

4. The method for preparing a cell extract of an engineered Escherichia coli according to claim 3, characterized in that: When the protease degradation tag is a pdt3 tag, an H1 tag or an H2 tag, the protease is a mycoplasma mf-Lon protease.

5. A cell extract of the engineered Escherichia coli according to claim 1 or 2, characterized in that: The method is obtained by the preparation method according to claim 3 or 4.

6. Use of the engineered Escherichia coli bacteria according to claim 1 or 2 or the cell extract according to claim 5 in preparing a cell-free protein synthesis system.

7. Use of the engineered Escherichia coli bacteria according to claim 1 or 2 or the cell extract according to claim 5 in ribosome display or in the preparation of a ribosome display platform.

8. A cell-free protein synthesis system, characterized in that: Containing the cell extract according to claim 5.

9. A ribosome display platform, characterized in that: Containing the cell extract according to claim 5.

10. Use of the cell-free protein synthesis system according to claim 8 or the ribosome display platform according to claim 9 in screening proteins or polypeptides.

Images