Component traditional Chinese medicine preparation for treating moderate and severe uterine prolapse as well as preparation method and application of component traditional Chinese medicine preparation

Abstract

The invention discloses a component traditional Chinese medicine preparation for treating moderate and severe uterine prolapse, which is prepared from the following components in percentage by mass: 2.5 to 3.5 percent of rhizoma bletillae gum, 1.0 to 2.0 percent of centella asiatica total glycosides, 0.3 to 0.6 percent of fructus cnidii oil, 0.2 to 0.5 percent of cinnamon oil, 0.001 to 0.005 percent of NP-700 type sodium polyacrylate, 0.35 to 0.65 percent of B type carbomer, 4.5 to 7.5 percent of glycerol, 0.35 to 0.65 percent of triethanolamine, 0.05 to 0.09 percent of chlorhexidine acetate and the balance of purified water. The sum of the mass percentages of the components is 100%. The specific preparation method comprises the following steps: weighing the components, dissolving, mixing, adjusting the pH value, and forming. The traditional Chinese medicine preparation is used for preparing medicines for treating moderate and severe uterine prolapse, has the effects of warming yang and promoting tissue regeneration, and can repair degenerated and damaged pelvic floor muscle groups by promoting collagen expression, extracellular matrix generation and muscle cell proliferation in pelvic floor tissues after vaginal administration; the structural strength and supporting tension of pelvic floor tissue are improved, the supporting and lifting effect on the uterus is recovered, and the prolapsed uterus is stably reset.

Description

Technical Field

[0001] The present invention belongs to the technical field of medicine, and particularly relates to a component traditional Chinese medicine preparation for treating moderate and severe uterine prolapse. The present invention also relates to a preparation method and application of the component traditional Chinese medicine preparation for treating moderate and severe uterine prolapse. Background Art

[0002] Uterine prolapse (UP) has become one of the most common chronic gynecological diseases in women, and is more common in postpartum women, postmenopausal women or elderly women. Surveys show that the proportion of UP in women who have given birth is 40% - 50%, and the incidence rate in women aged 45 - 80 is as high as 75%, and the condition of UP worsens around the age of 70. UP is divided into degrees I, II and III, among which, degrees II and III belong to moderate and severe. Since the uterus will partially or completely prolapse outside the vaginal orifice, the symptoms are obvious and the harm is great. The main manifestations are: ① There is an obvious sense of falling in the lower abdomen and lumbosacral soreness. The uterus cannot completely return to its original position after lying in bed and needs to be replaced by hand; friction during walking and labor can cause local mucosal congestion, edema, ulcer and even bleeding, leading to pain and infection such as vulvitis and vaginitis. ② The prolapsed uterus will compress the bladder and urethra, resulting in difficulty in urination and urinary retention, increasing the risk of urinary tract infection; and it is often combined with stress urinary incontinence (urine leakage when coughing or laughing), seriously affecting the daily work and life of patients. ③ The prolapsed uterus compresses the rectum, resulting in difficulty in defecation, constipation or a feeling of incomplete defecation. Some patients need to use their hands to assist in pushing back the prolapsed object to defecate, which further increases the increased abdominal pressure and forms a vicious cycle. ④ The long-term discomfort, body odor, abnormal appearance, etc. caused by prolapse or accompanied by urinary incontinence make patients anxious, self-abased and have social phobia, increasing the psychological burden and the risk of depression.

[0003] From a Western medicine perspective, the occurrence of UP is related to pregnancy and childbirth, advanced age at menopause, and long-term abnormal high abdominal pressure (such as chronic cough, long-term constipation, frequent heavy lifting, obesity, squatting for a long time, etc.): During pregnancy and childbirth, the pelvic floor muscle group can be torn and damaged, resulting in reduced strength and decreased tension; after advanced age at menopause, due to the decrease in estrogen levels, the pelvic floor muscle group will atrophy and relax, and the connective supporting tissue will be weak and flaccid; long-term high abdominal pressure can promote excessive apoptosis of muscle cells and loss of extracellular matrix, leading to tissue atrophy and relaxation. Anatomical studies have found that the degeneration and injury of the pelvic floor muscle group are the pathological basis for the occurrence of UP; however, since the specific pathological and molecular mechanisms of UP are not fully understood, there are currently no therapeutic drugs in clinical practice. Clinically, Western medicine mainly uses surgical and non-surgical treatments for UP: ① Surgical treatment is applicable to patients with moderate to severe prolapse or those who are ineffective in non-surgical treatment. It not only has high costs and large traumas, but also has a high recurrence rate and is prone to inducing various complications after surgery. Generally, patients are difficult to accept and the accessibility is relatively low. ② Non-surgical therapies mainly include pelvic floor muscle exercises (Kegel exercises), pessaries, and physical therapy, etc. Among them, pelvic floor muscle exercises can improve mild prolapse, but they need to be adhered to for a long time (15 - 30 minutes each time, 3 times a day, for 6 - 12 months). Due to the high time cost, cumbersome process, and unobvious self-experience, it is difficult for patients to adhere to, with low compliance and limited effects; the pessary only treats the symptoms but not the root cause, can relieve symptoms to a certain extent, and is applicable to the elderly, pregnant women, or those intolerant to surgery, but it needs to be cleaned and reviewed regularly, with relatively high costs and inconvenient use; physical therapy includes electrical stimulation and biofeedback, etc. It requires professional treatment equipment, and has a long time, many frequencies, a cumbersome process, large individual differences, and low patient compliance. The curative effect is difficult to guarantee and it is also prone to recurrence, and it is only suitable for early-stage mild prolapse patients. Therefore, the current Western medical therapies have unsatisfactory effects and are difficult to meet the urgent needs of UP patients for "non-invasive, natural, safe, and convenient" therapies.

[0004] At the level of traditional Chinese medicine (TCM), UP belongs to the category of "uterine prolapse" and "vaginal prolapse", and it is considered that it is mainly caused by qi deficiency and sinking, and kidney deficiency and insecurity, resulting in damage to the uterine collateral, and the belt vessel is unable to lift strongly, leading to uterine prolapse. As recorded in "The Treatise on the Causes and Symptoms of Various Diseases": "The uterine collateral is damaged, the uterus is deficient and cold, and qi rushes downward, causing the uterine prolapse, which is called downward prolapse. There are also cases where the vagina prolapses due to excessive exertion during childbirth and qi stagnation." "Golden Mirror of the Medical Tradition" records: "Uterine prolapse in women may be due to damage to the uterine collateral, or due to excessive exertion during childbirth, or due to qi deficiency and sinking, and dampness and heat pouring downward." It can be seen that "damage to the uterine collateral" is one of the recognized pathogenesis of UP, which is consistent with the pelvic floor muscle damage found in modern anatomy. However, there has never been a unified understanding among different schools of thought regarding the etiology and pathogenesis (syndrome) of UP in TCM. Therefore, there are various treatment methods in clinical TCM, mainly including drug treatment mainly with oral administration of Buzhong Yiqi Decoction / Pill or Shengxian Decoction, etc., and various physical therapy methods such as acupuncture and massage. There are problems such as large individual differences in curative effects, long treatment cycles, no unified standards, cumbersome processes, and poor self-experience of patients. Therefore, patients have poor compliance and low accessibility, and it is also difficult to meet the treatment needs of patients. Summary of the Invention

[0005] The first object of the present invention is to provide a component traditional Chinese medicine preparation for treating moderate to severe uterine prolapse. After vaginal administration, this preparation can promote the repair of pelvic floor muscle tissue, improve the support strength and tension of pelvic floor tissue, and thus restore the support and lifting effect on the uterus.

[0006] The second object of the present invention is to provide a preparation method of the component traditional Chinese medicine preparation for treating moderate to severe uterine prolapse.

[0007] The third object of the present invention is to provide the application of the above-mentioned component traditional Chinese medicine preparation for treating moderate to severe uterine prolapse in the preparation of drugs for treating moderate to severe uterine prolapse.

[0008] The technical solution adopted by the present invention is a component traditional Chinese medicine preparation for treating moderate to severe uterine prolapse, which is made of the following components: bletilla striata gum, total glycosides of hydrocotyle, cnidium monnieri oil, cinnamon oil, excipient, humectant, pH regulator, preservative and purified water.

[0009] The characteristics of the present invention also lie in: The purity of bletilla striata gum is not less than 95%.

[0010] The purity of total glycosides of hydrocotyle is not less than 80%.

[0011] Cnidium monnieri oil and cinnamon oil are prepared by supercritical carbon dioxide fluid extraction method.

[0012] The humectant adopts glycerol, and the preservative adopts chlorhexidine acetate.

[0013] The pH regulator adopts triethanolamine.

[0014] The excipients used are carbomer type B and sodium polyacrylate type NP-700.

[0015] The traditional Chinese medicine preparation is made from the following components by mass percentage: bletilla striata gum 2.5 - 3.5%, total centella asiatica glycosides 1.0 - 2.0%, cnidium monnieri oil 0.3 - 0.6%, cassia bark oil 0.2 - 0.5%, sodium polyacrylate type NP-700 0.001 - 0.005%, carbomer type B 0.35 - 0.65%, glycerol 4.5 - 7.5%, triethanolamine 0.35 - 0.65%, chlorhexidine acetate 0.05 - 0.09%, and the balance is purified water. The sum of the mass percentages of the above components is 100%.

[0016] Another technical solution of the present invention is a preparation method of the traditional Chinese medicine preparation for treating moderate to severe uterine prolapse. To prepare the traditional Chinese medicine preparation for treating moderate to severe uterine prolapse as described above, the following steps are included: Step 1: Prepare the components according to the following mass percentages: bletilla striata gum 2.5 - 3.5%, total centella asiatica glycosides 1.0 - 2.0%, cnidium monnieri oil 0.3 - 0.6%, cassia bark oil 0.2 - 0.5%, sodium polyacrylate type NP-700 0.001 - 0.005%, carbomer type B 0.35 - 0.65%, glycerol 4.5 - 7.5%, triethanolamine 0.35 - 0.65%, chlorhexidine acetate 0.05 - 0.09%, and the balance is purified water. The sum of the mass percentages of the above components is 100%; Step 2: Heat the purified water to boiling, divide it into two equal parts on average. Add the total centella asiatica glycosides to one part of the purified water, stir until completely dissolved, and then add the bletilla striata gum while stirring. After the bletilla striata gum is fully dissolved, a liquid medicine phase is obtained and reserved; Step 3: Slowly add carbomer type B to the other part of the purified water while stirring to make carbomer type B evenly dispersed, obtaining a carbomer phase and reserving it; Step 4: Add chlorhexidine acetate and sodium polyacrylate type NP-700 to glycerol, stir to make them evenly dispersed in glycerol, obtaining a glycerol phase and reserving it; Step 5: Mix the cnidium monnieri oil and cassia bark oil evenly to obtain an essential oil phase and reserve it; Step 6: Under vacuum conditions, mix the liquid medicine phase obtained in Step 2 and the carbomer phase obtained in Step 3 evenly; then add the glycerol phase obtained in Step 4 and the essential oil phase obtained in Step 5, stir to make them evenly mixed; finally, add triethanolamine and stir evenly to obtain the traditional Chinese medicine preparation for treating moderate to severe uterine prolapse.

[0017] The beneficial effects of the present invention are: 1. Based on the relationship between yin and yang dialectics in traditional Chinese medicine and the theory of flaccidity syndrome, the present invention proposes that the pathogenesis (syndrome) of UP in traditional Chinese medicine is "yang deficiency with muscular flaccidity". Within the treatment logic system of traditional Chinese medicine of "prescribing medicine according to syndrome, and eliminating disease when syndrome is resolved", the pathological basis and related molecular mechanisms of pelvic floor muscle group degeneration and atrophy in UP discovered by modern medical anatomy are attributed to the pathogenesis of "yang deficiency with muscular flaccidity" in traditional Chinese medicine, realizing a new mode of integrated traditional Chinese and Western medicine of "unifying diseases with syndrome". Then, based on the pathogenesis (syndrome) of "yang deficiency with muscular flaccidity", a treatment strategy of "warming yang to generate muscle" (i.e., the concept of drug design) is proposed, and the product of the present invention is developed, breaking through the technical bottleneck that the unclear modern medical molecular mechanism of UP restricts the research and development of therapeutic drugs. The present invention has the efficacy of "warming yang to generate muscle". After vaginal administration, it can repair the degenerated and damaged pelvic floor muscle group by promoting collagen expression, extracellular matrix generation and muscle cell proliferation in the pelvic floor tissue, improve the structural strength and support tension of the pelvic floor tissue, restore the supporting and lifting effect on the uterus, and make the prolapsed uterus reset and stabilize, having a good therapeutic effect on moderate and severe uterine prolapse with "yang deficiency with muscular flaccidity" as an important pathogenesis. Therefore, the present invention provides a reliable new means of traditional Chinese medicine for the clinical treatment of UP to meet the treatment needs and reduce the pain and medical burden of patients.

[0018] 2. The present invention treats UP by vaginal administration, which is convenient to use, has strong local targeting effect, significant and reliable drug efficacy, avoids the irritation to the gastrointestinal tract and the burden on the liver and kidneys caused by oral administration, and has the characteristics of "non-invasive, natural, safe and convenient". Therefore, patients have high compliance and strong willingness to take medicine, and the clinical application prospect is broad. The present invention effectively solves the disadvantages of surgical therapy, such as great trauma to the human body, high recurrence rate, high cost, many complications and difficulty for patients to accept; solves the disadvantages of physical therapy, such as long treatment period, high frequency, cumbersome process, unclear self-experience of patients, large individual differences and easy recurrence; and also solves the problems of traditional Chinese medicine treatment, such as insignificant curative effect, long treatment period, poor patient compliance and low accessibility.

[0019] 3. The present invention uses component compatibility instead of decoction piece compatibility, making the effective substances of the preparation clear and the action mechanism clear; the preparation is a double-skeleton matrix hydrogel made of type B carbomer and sodium polyacrylate NP-700, having good rheological properties, high stability, large drug loading capacity, prominent long-acting and sustained release properties and high bioadhesion; therefore, the product of the present invention is conducive to industrial production, quality control and clinical treatment application, can improve the accessibility of drugs and meet the treatment needs of patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1(A) is a scanning electron micrograph of human vaginal mucosal cells treated by the control group of the present invention; Figure 1(B) is a scanning electron micrograph of human vaginal mucosal cells treated by the preparation prepared in Example 3 of the present invention at 10 mg / L; Figure 1(C) is a scanning electron micrograph of human vaginal mucosal cells treated with the preparation prepared in Example 3 of the present invention at 20 mg / L; Figure 1(D) is a scanning electron micrograph of human vaginal mucosal cells treated with the preparation prepared in Example 3 of the present invention at 40 mg / L. Detailed implementation manners

[0021] The present invention will be described in detail below in conjunction with the specific implementation manners.

[0022] The component traditional Chinese medicine preparation for treating moderate and severe uterine prolapse of the present invention is made of the following components according to mass percentage: 2.5 - 3.5% of bletilla striata gum, 1.0 - 2.0% of total glycosides of centella asiatica, 0.3 - 0.6% of cnidium monnieri oil, 0.2 - 0.5% of cassia bark oil, 0.001 - 0.005% of NP - 700 type sodium polyacrylate, 0.35 - 0.65% of Carbomer type B, 4.5 - 7.5% of glycerol, 0.35 - 0.65% of triethanolamine, 0.05 - 0.09% of chlorhexidine acetate, and the balance is purified water. The sum of the mass percentages of the above components is 100%.

[0023] The traditional Chinese medicine components of the preparation of the present invention adopt the active pharmaceutical ingredients of bletilla striata gum, total glycosides of centella asiatica, cnidium monnieri oil and cassia bark oil. Among them, Bletilla striata gum, also known as bletilla striata polysaccharide or glucomannan, is the main active pharmaceutical ingredient of the traditional Chinese medicine bletilla striata, and has the effects of promoting granulation, stopping bleeding and detumescence. Modern research shows that it has pharmacological effects such as promoting wound healing, stopping bleeding, promoting collagen expression and improving uterine and ovarian functions. For example, "Huahui Yanyu" records: "Abscesses can be eliminated, festering can be supported, dead muscles can be removed, pus and blood can be cleaned, and it has the wonderful effect of supporting the old and generating the new." For example, "Ben Cao Zheng Yi" records: "The essential medicine for detumescence and promoting granulation of external ulcers." For example, "Chinese Herbal Medicine Dictionary" also records: "Treat prolapse of the vagina after childbirth and prolapse of the uterus." Therefore, it is the monarch drug; Cnidium monnieri oil, which is the volatile oil of cnidium monnieri, is the main active pharmaceutical ingredient of the traditional Chinese medicine cnidium monnieri, and has the pharmacological effects of drying dampness, expelling wind, killing insects and relieving itching, and warming the kidney and strengthening yang. Modern research shows that it has estrogen-like effects, improves ovarian and uterine functions and delays aging. For example, "Mingyi Bielu" records: "Warming the middle and descending qi, making the uterus of women hot." For example, "Chinese Herbal Medicine Dictionary" records: "Cnidium monnieri can be used for prolapse of the uterus and prolapse of the vagina in women." It is the ministerial drug; Cassia bark oil, also known as cinnamon oil, is the main active pharmaceutical ingredient of the traditional Chinese medicine cinnamon, and has the effects of warming and tonifying the life gate and warming and nourishing qi and blood. Modern research shows that it has the effects of improving yang-deficiency type ulcers, inhibiting platelet aggregation, analgesia and anti-inflammation. For example, "Huahui Yanyu" records: "Strengthening the yang of the life gate and cultivating the qi of the heart and kidney." Together with cnidium monnieri oil, it is the ministerial drug; Centella asiatica total glycosides, also known as asiaticoside, are the main active ingredients of the traditional Chinese medicine Centella asiatica, which have the effects of clearing heat and detoxifying, promoting blood circulation and relieving pain. Modern research shows that they can promote nerve repair and protection, promote the expression of collagen in the body, resist ulcers and inhibit scar formation, etc., and are adjuvant drugs; they can also prevent the overheating of cnidium fruit oil and cassia bark oil, and are also anti-adjuvant drugs.

[0024] The purity of the above-mentioned bletilla striata gum is not less than 95%, the purity of Centella asiatica total glycosides is not less than 80%, and cnidium fruit oil and cassia bark oil are prepared by supercritical carbon dioxide fluid extraction method.

[0025] The excipients used in the preparation of the present invention are Carbomer B, Sodium polyacrylate NP-700, glycerin, triethanolamine, chlorhexidine acetate and purified water. Among them, Carbomer B and Sodium polyacrylate NP-700: They are the excipients of the preparation of the present invention, which are pharmaceutical macromolecular materials and are safe and non-toxic to the human body; the mixture of the two can form a double-skeleton matrix hydrogel with high stability, good rheological properties and large drug loading capacity. It is a carrier of the drug and also has high bioadhesion, which can make the preparation adhere tightly to the vaginal cavity and avoid being cleared by the "self-cleaning effect" of the vagina, so as to play a long-acting and sustained-release effect; Chlorhexidine acetate: It is the preservative of the preparation of the present invention, which has the characteristics of good anti-corrosion effect, small dosage and safety and non-toxicity, and plays an anti-corrosion role in the preparation of the present invention; Glycerin: It is the moisturizer and solvent in the preparation of the present invention, which is safe and non-toxic to the human body. It can prevent the gel from losing water and caking, sticking to the container, and also plays a role in forming a mixed solvent with purified water to increase the solubility and stability of the drug; Triethanolamine: It is the pH regulator in the preparation of the present invention, mainly playing the role of promoting the dissolution and thickening of Carbomer B; Purified water: It is the solvent in the preparation of the present invention, playing the role of dissolving and dispersing drug components and excipients.

[0026] The present invention is based on the pathological basis of modern medical anatomy findings that pelvic floor muscle tissue in patients with uterine prolapse is atrophy and relaxation, collagen (type I and III) expression in the muscle is reduced, extracellular matrix is ​​excessively lost, and myocyte apoptosis occurs; at the same time, it has been found in long-term clinical practice that patients with uterine prolapse often present with kidney yang deficiency, life gate fire decline, and are often accompanied by muscle gland atrophy. Therefore, the present invention is within the framework of the treatment logic of "prescribing medicine according to the symptoms, eliminating the disease according to the symptoms", according to the dialectical relationship between yin and yang (such as "Yang is the commander, Yin is born from Yang and governs Yang", "The key to yin and yang, Yang is solid") and the relevant theories of "Suwen·痿论", with the macroscopic "symptom (pathogenesis)" of traditional Chinese medicine leading the "anatomical pathological basis and pathological molecular mechanism" of Western medicine to achieve the combination of Chinese and Western medicine of "using symptoms to govern the disease", and proposes that the pathogenesis of uterine prolapse in traditional Chinese medicine is "yang deficiency and muscle atrophy", and then proposes the treatment strategy and drug design and development concept of "warming yang and promoting muscle growth" according to the "pathogenesis / symptom", breaking through the bottleneck of modern medicine that limits the development of therapeutic drugs due to the unknown molecular mechanism of uterine prolapse pathology. The preparation of the present invention has the effect of "warming yang and promoting muscle growth", and the preparation can promote the repair of pelvic floor muscle tissue after vaginal administration, improve the support strength and tension of pelvic floor tissue, restore the support and lifting effect on the uterus, and stabilize the prolapsed uterus, thereby playing a preventive and therapeutic role for moderate and severe uterine prolapse.

[0027] The preparation method of the above-mentioned component Chinese medicine preparation for treating moderate to severe uterine prolapse is as follows: Step 1: According to the preparation requirements, prepare the following components: 2.5-3.5% of Bletilla striata gum, 1.0-2.0% of total glycosides of Cynanchum chinense, 0.3-0.6% of Cnidium monnieri oil, 0.2-0.5% of cinnamon oil, 0.001-0.005% of NP-700 sodium polyacrylate, 0.35-0.65% of Type B carbomer, 4.5-7.5% of glycerol, 0.35-0.65% of triethanolamine, 0.05-0.09% of chlorhexidine acetate, and the remainder is purified water. The sum of the mass percentages of the above components is 100%; Step 2: Heat purified water to boiling, divide it into two parts, add total glycosides of gentiana scabra into one part of purified water while it is hot, stir until completely dissolved, then add Bletilla striata gum into it, stirring while adding, and after the Bletilla striata gum is fully dissolved, obtain the liquid phase for standby use; Step 3: Slowly add Carbomer Type B to the remaining portion of purified water, stirring while adding, so that Carbomer Type B is evenly dispersed in the purified water to obtain a Carbomer phase for later use; Step 4: adding chlorhexidine acetate and NP-700 sodium polyacrylate to glycerol, stirring to make them dispersed evenly in the glycerol to obtain a glycerol phase for later use; Step 5: Mix the cnidium monnieri oil and cinnamon oil to obtain an essential oil phase for later use; Step 6: Under vacuum conditions, mix the medicinal liquid phase obtained in Step 2 and the carbomer phase obtained in Step 3 evenly; then add the glycerol phase obtained in Step 4 and the essential oil phase obtained in Step 5 and stir to mix them evenly; finally, add triethanolamine while stirring. After stirring evenly, the component traditional Chinese medicine preparation for treating moderate to severe uterine prolapse is obtained.

[0028] Example 1 A preparation method of a component traditional Chinese medicine preparation for treating moderate to severe uterine prolapse, comprising the following steps: Step 1: Prepare each component according to the following mass ratios: bletilla striata gum 2.5%, total centella asiatica glycosides 2.0%, cnidium monnieri oil 0.3%, cassia bark oil 0.5%, NP-700 type sodium polyacrylate 0.001%, type B carbomer 0.65%, glycerol 4.5%, triethanolamine 0.65%, chlorhexidine acetate 0.05%, purified water 88.849%. The sum of the mass percentages of the above components is 100%; Step 2: Heat the purified water to boiling, divide it into two equal parts on average. While it is still hot, add the total centella asiatica glycosides to one part of the purified water and stir until completely dissolved. Then add the bletilla striata gum while stirring. After the bletilla striata gum is fully dissolved, obtain the medicinal liquid phase and set it aside; Step 3: Slowly add type B carbomer to the remaining part of the purified water while stirring to make type B carbomer evenly dispersed in the purified water, obtain the carbomer phase and set it aside; Step 4: Add chlorhexidine acetate and NP-700 type sodium polyacrylate to glycerol and stir to make them evenly dispersed in glycerol, obtain the glycerol phase and set it aside; Step 5: Mix cnidium monnieri oil and cassia bark oil evenly to obtain the essential oil phase and set it aside; Step 6: Under vacuum conditions, mix the medicinal liquid phase obtained in Step 2 and the carbomer phase obtained in Step 3 evenly; then add the glycerol phase obtained in Step 4 and the essential oil phase obtained in Step 5 and stir to mix them evenly; finally, add triethanolamine while stirring. After stirring evenly, the component traditional Chinese medicine preparation for treating moderate to severe uterine prolapse is obtained.

[0029] Example 2 A preparation method of a component traditional Chinese medicine preparation for treating moderate to severe uterine prolapse, comprising the following steps: Step 1: Prepare each component according to the following mass ratios: bletilla striata gum 3.5%, total centella asiatica glycosides 1.0%, cnidium monnieri oil 0.6%, cassia bark oil 0.2%, NP-700 type sodium polyacrylate 0.005%, type B carbomer 0.35%, glycerol 7.5%, triethanolamine 0.35%, chlorhexidine acetate 0.09%, purified water 86.405%. The sum of the mass percentages of the above components is 100%; Step 2: Heat the purified water to boiling, divide it into two equal parts on average. While it is still hot, add the total saponins of Hydrocotyle nepalensis Hook. to one part of the purified water, stir until completely dissolved, then add the Bletilla striata gum while stirring. Stir until the Bletilla striata gum is fully dissolved to obtain the medicinal liquid phase, and set it aside for later use; Step 3: Slowly add type B carbomer to the remaining one part of the purified water while stirring to make type B carbomer evenly dispersed in the purified water, obtaining the carbomer phase, and set it aside for later use; Step 4: Add chlorhexidine acetate and sodium polyacrylate of NP - 700 type to glycerol, stir to make them evenly dispersed in glycerol, obtaining the glycerol phase, and set it aside for later use; Step 5: Mix the Cnidium monnieri oil and Cinnamomum cassia oil evenly to obtain the essential oil phase, and set it aside for later use; Step 6: Under vacuum conditions, mix the medicinal liquid phase obtained in Step 2 and the carbomer phase obtained in Step 3 evenly; then add the glycerol phase obtained in Step 4 and the essential oil phase obtained in Step 5, and stir to make them evenly mixed; finally, add triethanolamine while stirring. After stirring evenly, the component traditional Chinese medicine preparation for treating moderate to severe uterine prolapse is obtained.

[0030] Example 3 A preparation method of a component traditional Chinese medicine preparation for treating moderate to severe uterine prolapse, comprising the following steps: Step 1: Prepare each component according to the following mass percentage: Bletilla striata gum 3.0%, total saponins of Hydrocotyle nepalensis Hook. 1.5%, Cnidium monnieri oil 0.35%, Cinnamomum cassia oil 0.2%, sodium polyacrylate of NP - 700 type 0.003%, type B carbomer 0.45%, glycerol 5.5%, triethanolamine 0.45%, chlorhexidine acetate 0.06%, purified water 88.487%. The sum of the mass percentages of the above components is 100%; Step 2: Heat the purified water to boiling, divide it into two equal parts on average. While it is still hot, add the total saponins of Hydrocotyle nepalensis Hook. to one part of the purified water, stir until completely dissolved, then add the Bletilla striata gum while stirring. Stir until the Bletilla striata gum is fully dissolved to obtain the medicinal liquid phase, and set it aside for later use; Step 3: Slowly add type B carbomer to the remaining one part of the purified water while stirring to make type B carbomer evenly dispersed in the purified water, obtaining the carbomer phase, and set it aside for later use; Step 4: Add chlorhexidine acetate and sodium polyacrylate of NP - 700 type to glycerol, stir to make them evenly dispersed in glycerol, obtaining the glycerol phase, and set it aside for later use; Step 5: Mix the Cnidium monnieri oil and Cinnamomum cassia oil evenly to obtain the essential oil phase, and set it aside for later use; Step 6: Under vacuum conditions, mix the medicinal liquid phase obtained in Step 2 and the carbomer phase obtained in Step 3 evenly; then add the glycerol phase obtained in Step 4 and the essential oil phase obtained in Step 5, and stir to make them evenly mixed; finally, add triethanolamine while stirring. After stirring evenly, the component traditional Chinese medicine preparation for treating moderate to severe uterine prolapse is obtained.

[0031] Example 4 A preparation method of a component traditional Chinese medicine preparation for treating moderate to severe uterine prolapse, comprising the following steps: Step 1: Prepare each component according to the following mass ratios: Bletilla striata gum 2.95%, total glycosides of Hydrocotyle ranunculoides 1.35%, cnidium fruit oil 0.45%, cassia bark oil 0.4%, NP-700 type sodium polyacrylate 0.001%, Carbomer type B 0.35%, glycerol 5.0%, triethanolamine 0.39%, chlorhexidine acetate 0.06%, purified water 89.049%, and the sum of the mass percentages of the above components is 100%; Step 2: Heat the purified water to boiling, divide it into two equal parts on average, while it is hot, add the total glycosides of Hydrocotyle ranunculoides to one part of the purified water, stir until completely dissolved, then add the Bletilla striata gum to it, stirring while adding, and after the Bletilla striata gum is fully dissolved, obtain the medicinal liquid phase for standby; Step 3: Slowly add Carbomer type B to the remaining part of the purified water, stirring while adding, so that Carbomer type B is evenly dispersed in the purified water to obtain the Carbomer phase for standby; Step 4: Add chlorhexidine acetate and NP-700 type sodium polyacrylate to glycerol, stir to disperse them evenly in glycerol to obtain the glycerol phase for standby; Step 5: Mix the cnidium fruit oil and cassia bark oil evenly to obtain the essential oil phase for standby; Step 6: Under vacuum conditions, mix the medicinal liquid phase obtained in Step 2 and the Carbomer phase obtained in Step 3 evenly; then add the glycerol phase obtained in Step 4 and the essential oil phase obtained in Step 5, stir to make them mix evenly; finally, add triethanolamine, stirring while adding, and after stirring evenly, obtain the component traditional Chinese medicine preparation for treating moderate to severe uterine prolapse.

[0032] Example 5 A preparation method of a component traditional Chinese medicine preparation for treating moderate to severe uterine prolapse, comprising the following steps: Step 1: Prepare each component according to the following mass ratios: Bletilla striata gum 3.5%, total glycosides of Hydrocotyle ranunculoides 1.5%, cnidium fruit oil 0.35%, cassia bark oil 0.25%, NP-700 type sodium polyacrylate 0.002%, Carbomer type B 0.4%, glycerol 5.5%, triethanolamine 0.42%, chlorhexidine acetate 0.07%, purified water 88.008%, and the sum of the mass percentages of the above components is 100%; Step 2: Heat the purified water to boiling, divide it into two equal parts on average, while it is hot, add the total glycosides of Hydrocotyle ranunculoides to one part of the purified water, stir until completely dissolved, then add the Bletilla striata gum to it, stirring while adding, and after the Bletilla striata gum is fully dissolved, obtain the medicinal liquid phase for standby; Step 3: Slowly add Carbomer type B to the remaining part of the purified water, stirring while adding, so that Carbomer type B is evenly dispersed in the purified water to obtain the Carbomer phase for standby; Step 4: Add chlorhexidine acetate and sodium polyacrylate NP-700 into glycerol, stir to disperse them evenly in glycerol to obtain a glycerol phase for standby; Step 5: Mix cnidium fruit oil and cinnamon bark oil evenly to obtain an essential oil phase for standby; Step 6: Under vacuum conditions, mix the medicated liquid phase obtained in Step 2 and the carbomer phase obtained in Step 3 evenly; then add the glycerol phase obtained in Step 4 and the essential oil phase obtained in Step 5 and stir to mix them evenly; finally, add triethanolamine and stir while adding. After stirring evenly, the component Chinese medicine preparation for treating moderate and severe uterine prolapse is obtained.

[0033] Example 6 A preparation method of a component Chinese medicine preparation for treating moderate and severe uterine prolapse, comprising the following steps: Step 1: Prepare each component according to the following mass ratio: bletilla striata gum 3.5%, total centella asiatica glycosides 2.0%, cnidium fruit oil 0.6%, cinnamon bark oil 0.5%, sodium polyacrylate NP-700 0.004%, carbomer type B 0.65%, glycerol 7.5%, triethanolamine 0.65%, chlorhexidine acetate 0.09%, purified water 84.506%. The sum of the mass percentages of the above components is 100%; Step 2: Heat the purified water to boiling, divide it into two equal parts on average. While it is hot, add the total centella asiatica glycosides to one part of the purified water, stir until completely dissolved, and then add the bletilla striata gum while stirring. After the bletilla striata gum is fully dissolved, obtain a medicated liquid phase for standby; Step 3: Slowly add carbomer type B to the remaining part of the purified water while stirring to make carbomer type B evenly disperse in the purified water to obtain a carbomer phase for standby; Step 4: Add chlorhexidine acetate and sodium polyacrylate NP-700 into glycerol, stir to disperse them evenly in glycerol to obtain a glycerol phase for standby; Step 5: Mix cnidium fruit oil and cinnamon bark oil evenly to obtain an essential oil phase for standby; Step 6: Under vacuum conditions, mix the medicated liquid phase obtained in Step 2 and the carbomer phase obtained in Step 3 evenly; then add the glycerol phase obtained in Step 4 and the essential oil phase obtained in Step 5 and stir to mix them evenly; finally, add triethanolamine and stir while adding. After stirring evenly, the component Chinese medicine preparation for treating moderate and severe uterine prolapse is obtained.

[0034] The following further illustrates the beneficial effects produced by the present invention from pharmacological and toxicological experiments and clinical application treatment conditions: (1) Influence of the preparation prepared in Example 3 of the present invention on the expression of collagen in the pelvic floor tissue of UP rats Molecular biology has discovered that collagen (types I and III) is an important component of the extracellular matrix (ECM), which is the material basis for the exertion of support force in pelvic floor tissues and other tissues. In addition, collagen can also transmit biological signals into cells to regulate cell growth, migration, and function. Therefore, when the collagen content decreases, it causes damage to the ECM structure, atrophy of the pelvic floor structure, loss of integrity and stability, resulting in the uterus losing its support and lifting function and thus prolapsing. Moreover, the lower the collagen content in the pelvic floor muscle group tissue, the more severe the symptoms of uterine prolapse.

[0035] 1. Experimental methods (1) Preparation of the rat UP model: Female SD rats that had given natural birth three times were prepared, weighed, and anesthetized by intraperitoneal injection of chloral hydrate. They were fixed in the prone position, and a urinary catheter was inserted into the vagina about 3 cm. 3 mL of normal saline was injected into the balloon of the urinary catheter to expand the vagina and it was sutured to the vaginal orifice. The rats were fixed, and the pubic symphysis was placed at the edge of the table to make the urinary catheter droop. A tensile force of 300 g was applied and maintained for 4 h and then removed; the operation was repeated once after 2 weeks. After routine breeding for 2 weeks, bilateral ovariectomy was performed, and after the operation, they were routinely bred for 8 weeks. The rats after successful modeling were randomly divided into a model group, an invention group (the invention group was given the preparation prepared in Example 1 of the present invention, which included 3 groups with high, medium, and low doses), and a gel matrix group, with 6 rats in each group. Six healthy female SD rats without a reproductive history were used as the normal group.

[0036] (2) Drug administration plan: The model group was not given any drug. The high, medium, and low dose groups in the invention group were continuously administered by vaginal perfusion at doses of 1.2 g / Kg, 0.6 g / Kg, and 0.3 g / Kg respectively for 7 days; the gel matrix group was given a blank gel without drug at a dose of 1.2 g / Kg, and perfusion administration was carried out for 7 days.

[0037] (3) Detection and analysis: After the administration was completed, the animals were sacrificed, 50 mg of pelvic floor tissue was taken, 300 μL of lysis buffer was added, and total RNA was extracted strictly according to the instructions of the RNA extraction kit. Then, according to the formulation system of the reverse transcription kit, reverse transcription was carried out on ice, and amplification was carried out according to the formulation system of the amplification kit, repeated 3 times. Using β-actin as an internal reference, the relative expression level of the target gene was calculated by the relative quantification method. The primer sequences of the required target genes are as follows: Collagen I: F: CCCTACCCAGCACCTTCAAA, R: CATGGAGATGCCAGATGGTTAG; Collagen III: F: GCTGAAGGGCAGGGAACAA; R: TTGTGCAAAAGAGGAGAGAGGAA; GAPDH: F: TGAGGTGACCGCATCTTCTTG; R: CCGACCTTCACCATCTTGTCTAT.

[0038] 2. Experimental Results The experimental results showed that, as shown in Table 1, compared with the normal group, the expressions of Collagen I and III in the pelvic floor tissue of the model group rats were significantly decreased, indicating that the reduction of collagen (i.e., the loss of extracellular matrix) is the pathological basis for the occurrence of uterine prolapse. Compared with the model group, the low, medium, and high doses of the present invention could all promote the expressions of Collagen I and III, and the expression increased with the increase of the dose, showing a dose-dependence. This indicates that the present invention can promote collagen expression and extracellular matrix generation to repair the damaged pelvic floor muscles, which is the mechanism of its action in treating UP. Compared with the model group, there was no significant difference between the gel matrix group and the model group, indicating that the blank gel matrix without drugs had no pharmacological effect, and also indicating that the material basis for the efficacy of the present invention is the "warming yang and promoting muscle growth" effect of the drug components of the present invention.

[0039] Table 1 Effects of the present invention on the expressions of Collagen I and Collagen III mRNA in the pelvic floor tissue of UP rats ( x± S , n = 6)

[0040] Note: Compared with the blank group * P <0.05, ** P <0.01; compared with the model group # P <0.05, ## P <0.01.

[0041] (2) Effects of the preparation prepared in Example 3 of the present invention on the content of EGFR in the pelvic floor tissue of UP rats The epidermal growth factor receptor (EGFR) signaling pathway is involved in regulating the basic functions of cell survival, migration, and proliferation. It can be activated through the transactivation of various G-protein-coupled receptors, integrins, and cytokine receptors. Therefore, as a major transducer of different cell functions, EGFR is one of the important markers for the proliferation and growth of tissue cells.

[0042] 1. Experimental methods: (1) Preparation of the rat UP model and dosing regimen: The same as above.

[0043] (2) Detection and analysis: After the dosing was completed, the rats were fasted but allowed to drink water for 12 h. Then, 10% chloral hydrate solution was intraperitoneally injected to anesthetize the rats in each group. 100 mg of pelvic floor tissue was taken, added with an equal volume of normal saline and homogenized, centrifuged at 3000 r / min for 20 min, and the supernatant was taken to measure the content of EGFR using a microplate reader.

[0044] 2. Experimental results: The experimental results showed that, as shown in Table 2, the content of EGFR in the pelvic floor tissue of the model group was significantly decreased compared with that of the healthy group ( P <0.01), indicating that the downregulation of EGFR-induced apoptosis is one of the pathological bases for the occurrence of UP; compared with the model group, the low, medium, and high dose groups of the present invention could all increase the content of EGFR in the pelvic floor tissue of rats ( P <0.01), indicating that one of the "warming yang and promoting muscle growth" mechanisms is to upregulate the expression of EGFR; there was no significant difference between the gel matrix group and the model group ( P >0.05). It shows that the present invention can promote the proliferation of tissue cells by increasing the expression of EGFR in the pelvic floor tissue of UP rats, thereby promoting the repair of damaged and degenerated pelvic floor tissue.

[0045] Table 2 Effects of the present invention on EGFR in the pelvic floor tissue of UP rats ( x ± S , n = 6)

[0046] (III) Safety evaluation of the preparation prepared in Example 3 of the present invention on vaginal mucosa 1. Experimental methods: Twelve adult healthy female New Zealand white rabbits in the non-estrus state were selected as experimental animals. The body weights of the 12 white rabbits were all between 2.0 and 2.5 kg. The breeding environment was maintained at a room temperature of 18 - 22 °C and a relative humidity of 40 - 50%.

[0047] The test was carried out according to the vaginal mucosa irritation test method in the "Disinfection Technical Specification". Twelve test animals were randomly divided into 4 groups, namely the control group, the high-dose group, the medium-dose group and the low-dose group of the present invention, with 3 animals in each group. The specific operation method is as follows: ① High-dose group, medium-dose group and low-dose group of the present invention: Fix the rabbit on its back and expose the perineum and vaginal orifice. After wetting the catheter (8 cm), insert it into the vagina about 5 cm. The high-dose group, medium-dose group and low-dose group of the present invention were respectively injected into the vagina of female white rabbits through the catheter with the preparation of the present invention at the doses of 1.2 g / Kg, 0.6 g / Kg, and 0.3 g / Kg. After injection, keep the animal lying on its back and fixed for 4 h to allow the test substance to fully contact the vaginal mucosa. ② Control group: The same treatment was given with an equal volume of normal saline.

[0048] The experimental animals were sacrificed 24 h later, and the vaginal tissues of the rabbits were dissected and longitudinally incised. Carefully observe with the naked eye for phenomena such as congestion and edema; if there are changes, pathological histological examinations were carried out.

[0049] 2. Evaluation method: The evaluation was carried out according to the criteria in Table 3 below.

[0050] Table 3 Vaginal irritation response symptoms and scoring criteria

[0051] Note: 0 means non-irritating; 1 - 3 means minimal irritation; 4 - 6 means mild irritation; 7 - 9 means moderate irritation; 10 - 12 means obvious irritation.

[0052] 3. Experimental results: Observe with the naked eye whether there are abnormal secretions in the vulva and vagina, rinse them clean with normal saline, and observe with the naked eye for irritation response symptoms such as erythema and edema of the vaginal mucosa at the administration site, as shown in Table 3 below: Table 3 Vaginal mucosa irritation response scoring

[0053] Table 3 shows that the preparation of the present invention has no irritation to the vaginal mucosa.

[0054] (4) Influence of the preparation prepared in Example 3 of the present invention on human vaginal mucosa cells VK2 / E6E7 1. Experimental method The human vaginal mucosal cells VK2 / E6E7 (ATCC~CRL2616) were made into a single-cell suspension by passage. The cell suspension was gently pipetted, and a small amount of the cell suspension (about 6 μL) was added to one side of the coverslip on the technical plate. Under an inverted microscope, the number of cells in the four large squares at the corners of the technical plate was observed using a 10X objective lens. After cell counting, the cells were diluted into a single-cell suspension of 5000 cells in 100 μL and seeded into a 96-well plate, with 100 μL of cell suspension in each well. An untreated cell control group and a treated cell control group were set up, with 3 replicates in each well. The cells after seeding were cultured for 24 h. After the cells adhered to the wall, the culture medium was aspirated, and the cells after adhesion were treated by contacting with different doses (10 mg / L, 20 mg / L, 40 mg / L) of the preparation of the present invention for 72 h. After the treatment was completed, the liquid was aspirated, and the cell morphology was observed. At the same time, an equal amount of culture medium was used as a blank control.

[0055] 2. Evaluation method: The cells treated with the preparation of the present invention and the control group cells were both washed 2 times with PBS, fixed with 3.5% glutaraldehyde at 4 °C for 2 h, the cell clumps were separated with a probe, embedded with an embedding agent, stained and fixed with 1.0% osmium acid, dehydrated with gradient ethanol, and observed for cell growth and morphological structure using a scanning electron microscope (SEM) after vacuum drying.

[0056] 3. Experimental results As can be seen from Figures 1(A)-1(D), the relative growth rates of the cells in the high, medium, and low dose groups of the present invention are better than those of the control group, indicating that the preparation of the present invention has the effects of promoting cell proliferation and inhibiting cell apoptosis on human vaginal mucosal cells; and the morphological structure of the cells is complete, indicating that the preparation of the present invention is safe and non-toxic to human vaginal mucosal cells.

[0057] (5) Clinical efficacy of the present invention on patients with uterine prolapse 1. Selection criteria for clinical patients: According to the "Chinese Diagnosis and Treatment Guidelines for Pelvic Organ Prolapse" issued by the Obstetrics and Gynecology Branch of the Chinese Medical Association in 2020, the criteria for stage II-III uterine prolapse in the Quantitative Staging of Pelvic Organ Prolapse (POP-Q), and the diagnostic criteria for kidney yang deficiency of "Yin Ting" in "Chinese Gynecology", 78 female patients aged 25-80 years who had not undergone pelvic organ prolapse surgery were included in the treatment observation after informed consent.

[0058] Exclusion criteria: ① Those who have received relevant treatments recently; ② Those with pelvic inflammatory disease or uterine malignant lesions; ③ Pregnant or menstruating women; ④ Those with severe cardiovascular and cerebrovascular, hematological diseases or mental illnesses; ⑤ Those whose conditions deteriorated or suffered from other major diseases during the research period.

[0059] 2. Treatment method: Administer the preparation prepared in Example 3 of the present invention intravaginally. Carefully and slowly deliver 3.0 g of the preparation into the vagina once every night before going to bed. One course of treatment is 28 days, and a total of 3 courses of treatment are given, and then the curative effect is observed. At the same time, the pelvic floor muscle strength before and after treatment is measured.

[0060] 3. Curative effect judgment criteria: The curative effect evaluation criteria are drawn up with reference to the "Guiding Principles for Clinical Research of New Chinese Medicines (Trial)". The curative effect is evaluated after 3 courses of treatment: ① Cured: The position of the uterus returns to normal, and the symptom reduction rate of kidney-yang deficiency is ≥95%, and there is no recurrence within 3 months; ② Markedly effective: The uterus is retracted into the vagina, and the position of the external orifice of the cervix is ≤ -4 cm by color Doppler ultrasound examination, and 70% ≥ symptom reduction rate of kidney-yang deficiency < 95%; ③ Effective: The cervix and uterine body are retracted upward but not restored to the normal position, and 30% ≤ symptom reduction rate of kidney-yang deficiency < 70%; ④ Ineffective: There is no obvious improvement in the position of the uterus and symptoms and signs, and the symptom reduction rate of kidney-yang deficiency < 30%.

[0061] Total effective rate = (cured + markedly effective + effective) ÷ total number of cases × 100%.

[0062] 4. Treatment results: After 3 courses of treatment with the present invention, 20 patients were cured, accounting for 25.64%; 46 were markedly effective, accounting for 58.97%; 10 were effective, accounting for 12.82%; 2 were ineffective, accounting for 2.57%; the total effective rate reached 97.43%. Clinical trials show that the present invention has a definite therapeutic effect on moderate and severe uterine prolapse in women. In addition, during the treatment process, the pelvic floor muscle strength also increased significantly and steadily. Before treatment: The average muscle strength of type I and type II muscle fibers was 1.91 ± 1.05 (μV) and 2.31 ± 1.29 (μV) respectively; after 2 courses of treatment: The average muscle strength of type I and type II muscle fibers was 2.85 ± 1.15 (μV) and 3.12 ± 1.24 (μV) respectively; after 3 courses of treatment: The average muscle strength of type I and type II muscle fibers was 4.46 ± 1.78 (μV) and 4.97 ± 1.59 (μV) respectively. It can be seen that one of the treatment mechanisms of the present invention for UP is achieved by repairing and improving the structural strength and function of the pelvic floor support muscle group.

[0063] In addition, during the treatment with the preparation of the present invention, the patients reported that the product of the present invention was very convenient to use, there was no foreign body sensation or irritation in the vagina, and it did not stain clothes. The prolapse symptoms and discomfort of most patients were significantly improved on the 21st day of medication. Therefore, the compliance of the patients was high and they actively cooperated with the treatment.

[0064] 5. Typical cases: (1) Wang, female, 48 years old, a professional woman. Due to having given birth many times when she was young and not having sufficient rest and recovery after childbirth, she suffered from severe grade III uterine prolapse for 3 years. Especially when standing for too long or after fatigue, the prolapse is more severe, and the mass can cause ulceration and bleeding due to friction. After the patient used the present invention for 2 treatment courses, the uterine prolapse was restored, and the sense of abdominal distension and lumbosacral soreness disappeared.

[0065] (2) Ren, female, 50 years old, a doctor. After menopause, she suffered from grade II uterine prolapse for 1 year. When standing, sudden loud speaking or clearing the throat would cause prolapse and urinary incontinence, seriously affecting her daily work. She had previously used pelvic floor muscle training, physical therapy, and traditional Chinese medicine decoctions of the "tonifying middle qi and benefiting qi" type for conditioning, but with poor results. After the patient used the present invention for 2 treatment courses, the uterine prolapse was basically restored, and after continuing the treatment for 1 more course, she was cured.

[0066] (3) Zhao, female, 27 years old, a professional woman. After childbirth, she suffered from grade II uterine prolapse complicated with urinary incontinence. After the patient used the present invention for 2 treatment courses, the uterine prolapse was basically restored, and the urinary incontinence basically disappeared.

[0067] (4) Ma, female, 58 years old, a professional woman. She suffered from grade III uterine prolapse complicated with urinary incontinence for 3 years. She had previously used pelvic floor muscle exercise physical therapy, but did not continue due to the lack of obvious effect. The doctor recommended surgery, but the patient was reluctant to undergo surgical treatment. After the patient used the present invention for 2 treatment courses, the uterine prolapse was basically restored, the discomfort disappeared, and the urinary incontinence was cured. After continuing the treatment for 1 more course, she was cured and recovered.

[0068] (5) Ji, female, 50 years old, a freelancer. After menopause, she suffered from grade II uterine prolapse for 4 years. When doing heavy work, standing for a long time, or squatting, the uterus prolapsed out of the vaginal orifice, visible to the naked eye, with frictional pain and bleeding, seriously affecting work and life. After using the present invention for 3 treatment courses, the uterine prolapse was basically restored, the discomfort disappeared, and she could normally participate in work.

[0069] (6) Ma, female, 48 years old, a professional woman, with 3 childbirth histories. She suffered from grade II uterine prolapse complicated with urinary incontinence for 2 years. She had previously taken traditional Chinese medicine decoctions for tonifying and massage physical therapy for a long time, but gave up due to the lack of obvious effect and high cost, and was also worried about surgical trauma and recurrence. After the patient used the present invention for 3 treatment courses, the uterine prolapse was restored and the urinary incontinence disappeared. She was cured and recovered and returned to work.

[0070] Based on the combination of traditional Chinese and Western medicine, the present invention prepares an innovative component traditional Chinese medicine preparation with the efficacy of "warming yang and promoting granulation". The usage method of this preparation is to administer the component traditional Chinese medicine preparation for treating moderate to severe uterine prolapse prepared by the present invention intravaginally, once every night before going to bed, 3.0 g each time, and 28 days is one course of treatment. The active ingredients of this preparation are clear, the mechanism of action is clear, the administration is convenient, and the curative effect is reliable, providing a new means of traditional Chinese medicine for the clinical treatment of UP, meeting the trend of patients' demand for "non-invasive, natural, safe and convenient" therapies.

Claims

1. A component Chinese medicine preparation for treating moderate to severe uterine prolapse, characterized in that: The invention is prepared from the following components: bletilla striata gum, total glycosides of horsetail grass, cnidium monnieri oil, cinnamon oil, excipient, moisturizer, pH regulator, preservative and purified water.

2. The component Chinese medicine preparation for treating moderate to severe uterine prolapse according to claim 1, characterized in that: The purity of the white schizonepeta glue is not less than 95%.

3. The component Chinese medicine preparation for treating moderate to severe uterine prolapse according to claim 1, characterized in that: The purity of the total glycosides of Cynarostegium wilfordii is not less than 80%.

4. The component Chinese medicine preparation for treating moderate to severe uterine prolapse according to claim 1, characterized in that: The cnidium monnieri oil and cinnamon oil are prepared by adopting a carbon dioxide supercritical fluid extraction method.

5. The component Chinese medicine preparation for treating moderate to severe uterine prolapse according to claim 1, characterized in that: The moisturizing agent is glycerin, and the preservative is chlorhexidine acetate.

6. The component Chinese medicine preparation for treating moderate to severe uterine prolapse according to claim 5, characterized in that: The pH regulator is triethanolamine.

7. The component Chinese medicine preparation for treating moderate to severe uterine prolapse according to claim 6, characterized in that: The excipients include type B carbomer and NP-700 sodium polyacrylate.

8. The component Chinese medicine preparation for treating moderate to severe uterine prolapse according to claim 7, characterized in that: The traditional Chinese medicine preparation is prepared from the following components in percentage by mass: 2.5-3.5% of bletilla striata gum, 1.0-2.0% of total glycosides of calanthera, 0.3-0.6% of cnidium monnieri oil, 0.2-0.5% of cinnamon oil, 0.001-0.005% of NP-700 sodium polyacrylate, 0.35-0.65% of type B carbomer, 4.5-7.5% of glycerol, 0.35-0.65% of triethanolamine, 0.05-0.09% of chlorhexidine acetate, and the remainder is purified water, and the sum of the percentages by mass of the above components is 100%.

9. A method for preparing a component Chinese medicine preparation for treating moderate to severe uterine prolapse, characterized in that: The preparation of the component Chinese medicine preparation for treating moderate to severe uterine prolapse as claimed in claim 8 comprises the following steps: Step 1: Prepare the components according to the following mass percentages: 2.5-3.5% of Bletilla striata gum, 1.0-2.0% of total glycosides of Cynanchum chinense, 0.3-0.6% of Cnidium monnieri oil, 0.2-0.5% of cinnamon oil, 0.001-0.005% of NP-700 sodium polyacrylate, 0.35-0.65% of Type B carbomer, 4.5-7.5% of glycerol, 0.35-0.65% of triethanolamine, 0.05-0.09% of chlorhexidine acetate, and the remainder is purified water. The sum of the mass percentages of the above components is 100%; Step 2: Heat purified water to boiling, divide it into two parts, add total glycosides of gentiana scabra into one part of purified water, stir until completely dissolved, then add Bletilla striata gum thereto, stirring while adding, and after the Bletilla striata gum is fully dissolved, obtain a liquid phase for standby use; Step 3: Slowly add Carbomer Type B into another portion of purified water, stirring while adding to evenly disperse Carbomer Type B to obtain a Carbomer phase for later use; Step 4: adding chlorhexidine acetate and NP-700 sodium polyacrylate to glycerol, stirring to make them dispersed evenly in the glycerol to obtain a glycerol phase for later use; Step 5: Mix the cnidium monnieri oil and cinnamon oil to obtain an essential oil phase for later use; Step 6: Under vacuum conditions, mix the liquid phase obtained in step 2 and the carbomer phase obtained in step 3 evenly; then add the glycerin phase obtained in step 4 and the essential oil phase obtained in step 5, and stir to mix evenly; finally, add triethanolamine, and stir evenly to obtain a component Chinese medicine preparation for treating moderate to severe uterine prolapse.

10. Use of the component Chinese medicine preparation for treating moderate to severe uterine prolapse according to any one of claims 1 to 8 in the preparation of a drug for treating moderate to severe uterine prolapse.

Images