A preparation, its preparation method and application

By combining non-spore-forming bacteria with chemical stabilizers, the problems of bacterial activity and shelf life of the bacterial agent product have been solved, achieving stable live bacteria concentration and an economical preservation method.

CN120210034BActive Publication Date: 2026-07-07HUNAN INST OF MICROBIOLOGY +1
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HUNAN INST OF MICROBIOLOGY
Filing Date
2025-01-24
Publication Date
2026-07-07

AI Technical Summary

Technical Problem

Existing microbial agents have low bacterial concentrations, poor activity, and short shelf lives. Repeated fermentation and proliferation lead to functional decline of the strains, affecting the control effect.

Method used

Stable formulations are prepared through multi-stage fermentation using a combination of non-spore-forming bacteria such as Serratia nematodes and Acinetobacter calcium acetate, along with chemical stabilizers betaine, pyrroloquinoline quinone (PQQ), and L-hydroxyproline, ensuring viable cell concentration and shelf life.

Benefits of technology

It extends the shelf life of microbial preparations, reduces production and storage costs, improves economic efficiency, and enables stable preservation in anaerobic or low-oxygen environments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure HDA0005258599300000011
    Figure HDA0005258599300000011
Patent Text Reader

Abstract

The present application belongs to the field of microbial preparation, and discloses a kind of microbial stabilizer, including non-bacillus or its fermentation bacteria liquid, chemical stabilizer, wherein, the non-bacillus includes at least one of Serratia entomophila, Acinetobacter calcoaceticus.The present application also discloses the preparation method of the microbial stabilizer and its application in prolonging the shelf life of microbial agent.The present application studies the microbial stabilizer containing non-bacillus, finds that the microbial stabilizer formed by the suitable collocation of non-bacillus and chemical stabilizer can maintain the stability of viable bacterial concentration for a long time, can prolong the shelf life of microbial product, reduces the need for frequent production and storage, can ensure the supply of product in market more stable, thereby directly reduces the production cost, improves economic benefit, can be used in the field of microbial preparation technology.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial preparation technology, and particularly relates to a non-spore-forming bacillus preparation and its preparation method. Background Technology

[0002] Since the implementation of the "Vegetable Basket" project in the 1980s, my country's vegetable industry has developed rapidly, becoming the second largest crop after grain and a pillar industry for China's agricultural and rural economic development. However, pests and diseases continue to hinder the healthy development of the vegetable industry, causing economic losses of up to 50% in severe cases, and even destroying greenhouses or causing total crop failure in severely affected protected areas. Major vegetable pests include nematodes, spider mites, thrips, diamondback moths, leaf beetles, and leaf miners. Their short breeding cycles, high reproduction frequency, and wide feeding range greatly increase the difficulty of control. Currently, chemical control is the main method for controlling vegetable pests, but the indiscriminate use of chemical pesticides easily leads to environmental pollution, increased pesticide resistance in pests, and reduced vegetable product quality. To ensure vegetable production quality, increase farmers' profits, and meet the needs of ecological balance, Chinese agricultural scientists have conducted in-depth research and introduced biocontrol bacteria into the control of vegetable pests. Biocontrol bacteria are relatively safe and less likely to cause pesticide resistance in pests, making them promising for the production of organic, green, and pollution-free vegetables.

[0003] Most commercially available microbial agents suffer from low cell concentration, poor activity, short shelf life, and functional degradation due to repeated fermentation and proliferation, severely hindering the efficacy of functional microorganisms in applications. Therefore, there is a need to develop an agricultural formulation to increase the live bacteria concentration of microbial agents, thereby extending shelf life and promoting the rapid and healthy development of the agricultural microbiology industry. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the background art above, and to provide a formulation, its preparation method and application.

[0005] To solve the above-mentioned technical problems, the technical solution proposed by this invention is as follows:

[0006] An formulation comprising non-spore-forming bacteria or their fermentation broth, and a chemical stabilizer.

[0007] In the above-mentioned formulation, preferably, the chemical stabilizer includes betaine, pyrroloquinoline quinone (PQQ), and L-hydroxyproline.

[0008] Preferably, the above-mentioned formulation contains 0.05-0.1% betaine, 300-600 nmol / L pyrroloquinoline quinone (PQQ), and 800-1000 μmol / L L-hydroxyproline.

[0009] In the above-mentioned formulation, preferably, the non-spore-forming bacilli include at least one of Serratia nematodes and Acinetobacter calcium acetate.

[0010] In the above-mentioned formulation, preferably, the *Serratia nematodes* is *Serratia nematodes* FQ268, which was deposited at the China Center for Type Culture Collection on September 22, 2023, with accession number CCTCC M 20231765; and the *Acinetobacter calciacetate* is named *Acinetobacter calciacetate* CDWB36, which was deposited at the China Center for Type Culture Collection on June 8, 2023, with accession number CCTCC NO:M2023964.

[0011] In the above-mentioned formulation, preferably, the viable count of Serratia nematodes is 200-280 billion CFU / mL, or / and the viable count of Acinetobacter calcium acetate is 200-250 billion CFU / mL.

[0012] As a general inventive concept, the present invention also provides a method for preparing the formulation as described above, comprising the following steps:

[0013] (1) Non-spore-forming bacteria were transferred to LB solid medium for bacterial activation to obtain activated non-spore-forming bacteria;

[0014] (2) The activated non-spore-forming bacteria were inoculated into the seed culture medium for primary fermentation to obtain the primary seed liquid;

[0015] (3) The primary seed liquid is subjected to secondary fermentation to obtain secondary seed liquid;

[0016] (4) The secondary seed culture is subjected to tertiary fermentation to obtain the culture medium;

[0017] (5) After adding a chemical stabilizer to the culture medium obtained in step (4), mix well and dispense into a liquid dosage form to obtain the preparation.

[0018] In the above preparation method, preferably, in step (1), the LB solid culture medium formula includes: 8-10 g / L peptone, 5-6 g / L yeast extract, 8-10 g / L sodium chloride, 15-18 g / L agar, and pH 7.2-7.3;

[0019] In step (2), the seed culture medium formula includes: 18~20 g / L peptone, 8~10 g / L sodium chloride, 8~10 g / L yeast extract, and pH 7.2~7.3;

[0020] In steps (3) and (4), the culture medium used for secondary and tertiary fermentation includes: 0.6-1.0% yeast extract, 0.6-1.0% maltose, 0.4-0.9% ammonium sulfate, 0.4-0.9% peptone, 0.5-0.8% magnesium sulfate heptahydrate, 0.5-0.8% potassium dihydrogen phosphate, and pH 7.2-7.3.

[0021] In the above preparation method, preferably, in step (1), the activation temperature is 28~30℃ and the time is 22~24h.

[0022] In the above preparation method, preferably, the process conditions for primary fermentation in step (2) include: liquid volume of 40-60%, inoculum volume of 0.5%-2%, culture temperature of 28-30℃, and shaking culture at 180-200 rpm for 18-20 h;

[0023] In step (3), the process conditions for secondary fermentation include: liquid volume of 60-70%, inoculum volume of 7%-10%, culture temperature of 28-30 ℃, and shaking culture at 180-200 rpm for 18-20 h;

[0024] The process conditions for tertiary fermentation include: liquid volume of 60-70%, inoculum size of 7-10%, culture temperature of 28-30℃, and shaking culture at 150-180 rpm for 22-24 h.

[0025] As a general inventive concept, the present invention also provides the application of the formulation as described above or the formulation prepared by the preparation method described above in extending the shelf life of microbial agents, wherein the formulation is stored and used in an anaerobic environment or with an air content of less than 5%.

[0026] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0027] (1) Through research on preparations containing non-spore-forming bacteria, this invention has found that the appropriate combination of non-spore-forming bacteria and chemical stabilizers to form a preparation can maintain the stability of the concentration of live bacteria for a long time, which can extend the shelf life of microbial products, reduce the need for frequent production and storage, and ensure a more stable supply of products in the market, thereby directly reducing production costs and improving economic benefits. This invention can be applied to the field of microbial preparation technology.

[0028] (2) The formulations of the present invention do not require refrigeration or low-temperature storage, but only need to be stored in the absence of oxygen or at an air content of less than 5%, which makes logistics more economical and convenient and significantly reduces transportation and storage costs. Attached Figure Description

[0029] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0030] Figure 1 The above-side colony morphology of Serratia nematodes FQ268 plate involved in the embodiments of the present invention;

[0031] Figure 2 The above-side colony morphology of Acinetobacter calcifera CDWB36 plate involved in the embodiments of the present invention;

[0032] Figure 3 Phylogenetic tree analysis of the 16S rDNA sequence of strain FQ268 constructed by the neighbor-joining method in this embodiment of the invention;

[0033] Figure 4 Phylogenetic tree analysis of the 16S rDNA sequence of strain CDWB36 constructed by the neighbor-joining method in this embodiment of the invention;

[0034] Figure 5 This is a line graph showing the shelf life of the formulation against Serratia nematodes FQ268 in the embodiments of the present invention.

[0035] Figure 6 This is a line graph showing the shelf life of the formulations in this invention against Acinetobacter calcium acetate CDWB36. Detailed Implementation

[0036] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.

[0037] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.

[0038] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0039] Example 1: Isolation of bacteria

[0040] This embodiment of Serratia nematodes ( Serratia nematodiphila FQ268 and Acinetobacter calcium acetate ( Acinetobacter calcoaceticusThe isolation method for CDWB36 was as follows: At a tomato base in Haitang District, Sanya City, Hainan Province, and a chili pepper base in Changdu City, Tibet Province, the topsoil was removed using a sampling shovel, and 100 g of soil from a depth of 20-100 mm was collected and placed in a sterile kraft paper bag. The collection location and time were recorded and the bag was brought back to the laboratory for the isolation and purification of the strain. 0.1 g of the sample was taken with a sterile spatula and poured into a sterile 1.5 mL centrifuge tube containing 0.9 mL of LB liquid medium. The tube was incubated at 30℃ and 100 rpm for 30 min, then allowed to stand for 20 min. The solution was then diluted 10-fold using a 10-fold serial dilution method. -3 For gradient dilution, take 100 μL of the gradient dilution solution, spread it evenly on LB medium, and pick a single colony for bacterial purification. Figure 1 Serratia nematodes ( Serratia nematodiphila FQ268 agar plate front colony morphology, Figure 2 Acinetobacter calcifera ( Acinetobacter calcoaceticus )Coral morphology on the front of CDWB36 plate.

[0041] Example 2: Identification of bacteria

[0042] I. Morphological identification of strains

[0043] FQ268 cells are straight rods with rounded ends. Colonies are round, smooth, moist, milky white, and opaque. They are usually motile with peritrichous flagella and are Gram-negative. CDWB36 cells are short, stout rods or coccobacilli. Colonies are milky white, flat, and opaque, and are Gram-negative.

[0044] II. Physiological and biochemical characteristics of the strain

[0045] Table 1 shows that strain FQ268 can utilize mannitol, fructose, and glucose, but not inositol or citric acid; it is negative for catalase and methyl red tests, produces indole, and is insensitive to the antibiotics ampicillin sodium and tetracycline, but sensitive to rifampin. Furthermore, strain FQ268 is a facultative anaerobe.

[0046] As shown in Table 2, strain CDWB36 can utilize D-glucose but cannot utilize mannitol, sucrose, or D-maltose; it is negative for phosphatase and histidine assimilation reactions, tolerant to O / 129, and positive for succinate alkalization reaction; it is sensitive to ceftazidime and gentamicin but not to ampicillin.

[0047] Table 1. Physiological and biochemical results and carbohydrate utilization of strain FQ268

[0048]

[0049] Table 2. Physiological and biochemical results and carbohydrate utilization of strain CDWB36

[0050]

[0051] "+" indicates a positive reaction, and "-" indicates a negative reaction.

[0052] III. Identification of the strain by 16S rRNA sequencing

[0053] Species identification of strain FQ268 was performed using 16S rRNA identification technology. The 16S rRNA gene of strain FQ268 was amplified using universal bacterial primers (sequences shown in SEQ ID:1 and SEQ ID:2). After PCR amplification, the PCR products were detected by electrophoresis on a 1% agarose gel. The PCR-obtained gene product was sequenced, and the resulting sequence was entered into the NCBI database and analyzed using BLAST software. The 16S rRNA gene fragment of strain FQ268 obtained by PCR amplification is shown in SEQ ID:3. Analysis and comparison of this sequence showed that strain FQ268 is similar to... Serratia nematodiphila The similarity reached 99.93%. Strains with high homology were selected, and multiple sequence alignment was performed using MEGA 7.0 software to construct a phylogenetic tree. (See...) Figure 3 As shown, combining morphological and physiological-biochemical characteristics with 16S rRNA gene sequence determination results, strain FQ268 was found to be most closely related to *Serratia nematodes*. Therefore, strain FQ268 was identified as *Serratia nematodes* and named *Serratia nematodes*. Serratia nematodiphila FQ268 is deposited at the China Center for Type Culture Collection, Wuhan (Wuhan University), with accession number CCTCC M 20231765, on September 22, 2023.

[0054] Similarly, the 16S rRNA gene of strain CDWB36 was amplified using universal bacterial primers (sequences shown in SEQ ID:1 and SEQ ID:2). After PCR amplification, the PCR products were detected by electrophoresis on a 1% agarose gel. The gene products obtained by PCR were sequenced, and the resulting sequences were entered into the NCBI database and analyzed using BLAST software. The 16S rRNA gene fragment of strain CDWB36 obtained by PCR amplification is shown in SEQ ID:4. Analysis and comparison of this sequence showed that strain CDWB36 is similar to... Acinetobacter calcoaceticus The similarity reached 99.93%. Strains with high homology were selected, and multiple sequence alignment was performed using MEGA 7.0 software to construct a phylogenetic tree. (See...) Figure 4As shown, based on morphological characteristics and 16S rRNA gene sequence determination, strain CDWB36 was found to be most closely related to *Acinetobacter calciacetate*. Therefore, strain CDWB36 was identified as *Acinetobacter calciacetate* and named *Acinetobacter calciacetate*. Acinetobacter calcoaceticus CDWB36, deposited at the China Center for Type Culture Collection, Wuhan (Wuhan University), with accession number CCTCC NO:M2023964, on June 8, 2023.

[0055] SEQ ID:1:27F5' AGAGTTTGATCCTGGCTCAG 3';

[0056] SEQ ID:2:1492R5' TACGGCTACCTTGTTACGACTT 3';

[0057]

[0058]

[0059] Example 3: Preparation method of preparation containing Serratia nematodes FQ268

[0060] This embodiment provides a method for preparing a formulation containing Serratia marcescens FQ268, the specific process of which is as follows:

[0061] (1) Strain activation: The *Serratia nematodes* strain identified in Example 2 was activated. Serratia nematodiphila FQ268 was inoculated onto LB solid medium and cultured at 28℃ for 24 hours to obtain the activated strain. The LB solid medium was formulated as follows: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 18 g / L agar, and pH 7.3.

[0062] (2) Primary fermentation (50L): The activated Serratia nematodes were inoculated into the seed culture medium for primary fermentation. The liquid volume was 50%, the inoculum volume was 1%, the culture temperature was 29℃, and the culture was shaken at 190 rpm for 20h to obtain the primary seed culture of Serratia nematodes. The seed culture medium was formulated as follows: 20g / L peptone, 10g / L sodium chloride, 10g / L yeast extract, and pH 7.3.

[0063] (3) Secondary fermentation (500L): The primary seed culture was subjected to secondary fermentation with a liquid volume of 65%, an inoculum volume of 8%, and a culture temperature of 30℃; the culture was shaken at 190 rpm for 20 h to obtain the secondary seed culture of Serratia nematodes. The culture medium used for secondary fermentation was formulated as follows: 0.8% yeast extract, 0.8% maltose, 0.6% ammonium sulfate, 0.6% peptone, 0.5% magnesium sulfate heptahydrate, 0.5% potassium dihydrogen phosphate, and pH 7.3.

[0064] (4) Tertiary fermentation (50t): The secondary seed liquid was subjected to tertiary fermentation with a liquid volume of 70% and an inoculum of 10%. The culture temperature was 30℃ and the culture was shaken at 170 rpm for 22h. The culture medium used for tertiary fermentation was formulated as follows: 1.0% yeast extract, 1.0% maltose, 0.8% ammonium sulfate, 0.8% peptone, 0.6% magnesium sulfate heptahydrate, and 0.6% potassium dihydrogen phosphate. The pH was 7.3. The effective viable concentration of Serratia nematodes in the fermentation liquid was 26 billion CFU / mL.

[0065] (5) After the fermentation of Serratia nematodes solution is completed, add chemical stabilizer A and mix well before dispensing into a liquid dosage form, which is preparation A containing Serratia nematodes FQ268. The chemical stabilizer A contains: betaine 0.1%, PQQ 400 nmol / L, and L-hydroxyproline 800 μmol / L.

[0066] Example 4: Preparation method of Acinetobacter acetate-containing CDWB36 formulation

[0067] The preparation method of the Acinetobacter calciacetate CDWB36 preparation provided in this embodiment is the same as in Example 3. In the prepared preparation A containing Acinetobacter calciacetate CDWB36, the effective viable bacterial concentration of Acinetobacter calciacetate is 21 billion CFU / mL, and the content of chemical stabilizer A is: betaine 0.1%, PQQ 400 nmol / L, and L-hydroxyproline 800 μmol / L.

[0068] Comparative Example 1:

[0069] The Serratia nematodes broth was prepared using the same fermentation method as in Example 3. After fermentation, the broth was mixed with chemical stabilizer B and then packaged into a liquid dosage form, which is the product containing Serratia nematodes. Serratia nematodiphila Formulation B of FQ268 contains the following chemical stabilizer B: choline chloride 0.1%, PQQ 400 nmol / L, and L-hydroxyproline 800 μmol / L.

[0070] Comparative Example 2:

[0071] The same fermentation method as in Example 4 was used to prepare Acinetobacter calcium acetate bacterial solution. After fermentation, chemical stabilizer B was added to the bacterial solution, mixed well, and then packaged into a liquid dosage form, which is the product containing Acinetobacter calcium acetate. Acinetobacter calcoaceticus CDWB36 formulation B, wherein the chemical stabilizer B contains: choline chloride 0.1%, PQQ 400 nmol / L, and L-hydroxyproline 800 μmol / L.

[0072] Comparative Example 3:

[0073] The Serratia nematodes broth was prepared using the same fermentation method as in Example 3. After fermentation, chemical stabilizer C was added to the broth, and the mixture was then dispensed into a liquid dosage form, which is the product containing Serratia nematodes. Serratia nematodiphila Formulation C of FQ268 contains the following chemical stabilizer C contents: betaine 0.1%, ubiquinone 400 nmol / L, and L-hydroxyproline 800 μmol / L.

[0074] Comparative Example 4:

[0075] The same fermentation method as in Example 4 was used to prepare Acinetobacter calcium acetate bacterial solution. After fermentation, chemical stabilizer C was added to the bacterial solution, mixed well, and then packaged into a liquid dosage form, which is the product containing Acinetobacter calcium acetate. Acinetobacter calcoaceticusThe formulation C of CDWB36 contains the following chemical stabilizers: betaine 0.1%, ubiquinone 400 nmol / L, and L-hydroxyproline 800 μmol / L.

[0076] Comparative Example 5:

[0077] The Serratia nematodes broth was prepared using the same fermentation method as in Example 3. After fermentation, the high-concentration broth was mixed with chemical stabilizer D and then packaged into a liquid dosage form, which is the product containing Serratia nematodes. Serratia nematodiphila Formulation D of FQ268 contains the following chemical stabilizer D: betaine 0.1%, PQQ 400 nmol / L, and glutamic acid 800 μmol / L.

[0078] Comparative Example 6:

[0079] The same fermentation method as in Example 4 was used to prepare Acinetobacter calcium acetate bacterial solution. After fermentation, the high-concentration bacterial solution was added to chemical stabilizer D, mixed well, and then packaged into a liquid dosage form, which is a product containing Acinetobacter calcium acetate. Acinetobacter calcoaceticus The formulation D of CDWB36 contains the following chemical stabilizers: betaine 0.1%, PQQ 400 nmol / L, and glutamic acid 800 μmol / L.

[0080] Example 5: Effect Analysis of the Formulation

[0081] The viable cell quality of eight different formulations of *Serratia marcescens* or *Acinetobacter calcium acetate* preparations in Examples 3 and 4 and Comparative Examples 1-6 was dynamically monitored during multiple storage periods in an anaerobic environment. Figure 5 and Figure 6 The figures show line graphs illustrating the shelf life statistics of Serratia nematodes FQ268 and Acinetobacter calcitonin CDWB36 formulations. Analysis of the graphs indicates that for both Serratia nematodes FQ268 and Acinetobacter calcitonin CDWB36, the effectiveness in maintaining bacterial activity and extending shelf life, from best to worst, is formulation A > B > D > C. This means the optimal chemical stabilizer components and ratios for Serratia nematodes FQ268 and Acinetobacter calcitonin CDWB36 are: betaine 0.1%, PQQ 400 nmol / L, and L-hydroxyproline 800 μmol / L. The resulting microbial formulations, when combined with either Serratia nematodes FQ268 or Acinetobacter calcitonin CDWB36, can maintain a stable concentration of live bacteria over a long period, thereby extending the shelf life of the microbial products. This reduces the need for frequent production and storage, ensuring a more stable supply in the market, directly lowering production costs, and improving economic efficiency.

Claims

1. A formulation for extending the shelf life of microbial agents, characterized in that, Includes non-spore-forming bacteria or their fermentation broth, and chemical stabilizers; the chemical stabilizers include betaine, pyrroloquinoline quinone, and L-hydroxyproline; The preparation contains 0.1% betaine, 400 nmol / L pyrroloquinoline quinone, and 800 μmol / L L-hydroxyproline. The non-spore-forming bacillus is *Serratia nematode* (Serratia nematode Serratia nematodiphila The Serratia nematodes mentioned are Serratia nematodes FQ268, which was deposited at the China Center for Type Culture Collection on September 22, 2023, with accession number CCTCC M 20231765.

2. The formulation according to claim 1, characterized in that, In the formulation, the viable count of Serratia nematodes is 200-280 billion CFU / mL.

3. A method for preparing a formulation according to any one of claims 1 to 2, characterized in that, Includes the following steps: (1) Non-spore-forming bacteria were transferred to LB solid medium for bacterial activation to obtain activated non-spore-forming bacteria; (2) The activated non-spore-forming bacteria were inoculated into the seed culture medium for primary fermentation to obtain the primary seed liquid; (3) The primary seed liquid is subjected to secondary fermentation to obtain secondary seed liquid; (4) The secondary seed culture is subjected to tertiary fermentation to obtain the culture medium; (5) After adding a chemical stabilizer to the culture medium obtained in step (4), mix well and dispense into a liquid dosage form to obtain the preparation.

4. The preparation method according to claim 3, characterized in that, In step (1), the LB solid medium formula includes: 8-10 g / L peptone, 5-6 g / L yeast extract, 8-10 g / L sodium chloride, 15-18 g / L agar, and pH 7.2-7.3; In step (2), the seed culture medium formula includes: 18~20 g / L peptone, 8~10 g / L sodium chloride, 8~10 g / L yeast extract, and pH 7.2~7.3; In steps (3) and (4), the culture medium used for secondary and tertiary fermentation includes the following formulations: 0.6-1.0% yeast extract, 0.6-1.0% maltose, 0.4-0.9% ammonium sulfate, 0.4-0.9% peptone, 0.5-0.8% magnesium sulfate heptahydrate, 0.5-0.8% potassium dihydrogen phosphate, and pH 7.2-7.

3.

5. The preparation method according to claim 3, characterized in that, In step (1), the activation temperature is 28~30℃ and the time is 22~24 h; In step (2), the process conditions for primary fermentation include: liquid volume of 40-60%, inoculum volume of 0.5%-2%, culture temperature of 28-30℃, and shaking culture at 180-200 rpm for 18-20 h; In step (3), the process conditions for secondary fermentation include: liquid volume of 60-70%, inoculum volume of 7%-10%, culture temperature of 28-30℃, and shaking culture at 180-200 rpm for 18-20 h; The process conditions for tertiary fermentation include: liquid volume of 60-70%, inoculum size of 7-10%, culture temperature of 28-30℃, and shaking culture at 150-180 rpm for 22-24 h.

6. The use of a formulation according to any one of claims 1 to 2 or a formulation prepared by any one of claims 3 to 5 in extending the shelf life of microbial agents, characterized in that, The preparation is stored and used in an anaerobic environment or with an air content of less than 5%, and the bacterial strain in the bacterial agent is Serratia nematodes FQ268.

Citation Information

Patent Citations

  • Aspergillus sydowii and application thereof in promoting plant growth and preventing and treating plant diseases

    CN112680360A